Table 2.

Sequences of the real-time RT-PCR primers for quail 18S and for the PPARα, β and γ genes

Real-time RT-PCR (5′ to 3′)
GeneGenBank accession no.ForwardReverse
18SEU847817GAAACGGCTACCACATCCAACACCAGACTTGCCCTCCA
PPARαEU159428ATCCCTGGCTTCTCCAATCTCAGCATCCCGTCTTTGTTC
PPARβEU847819GCTCCTCTCCCTCCCTGTTCCGCTCACACTTCTCATACTC
PPARγEU847820CCTCCTTCTCCACCCTATTTTTAGCCCTTACAACCCTCACAC