Table 2.

PCR primer sequences for amplification of possum NBCs

Primer namePrimer sequence (5′–3′)
Primers for cloning and expression
   NBC-For 1ATCAGTGATTTTGCCATTAT
   NBC-Rev 1ATGTGAGCAATGGAGATGAC
   NBC-For 2GCCTTGCTGGTCACCATCCTGATT
   NBC-Rev 2TGGGCTACTTGCACTGGAGA
   pNBC-For 1CAARCTGGAGGAGCGACGGAAG
   kNBC-For 1ATCCCACCWRTSTTTAACC
   kNBC-Rev 1CCGAGGTAAAAATACTACGGTTAAAGA
   pNBC-For 2ATGGAGGATGAAGCCGTCCTG
   kNBC-For 2ACCAAATTGAAGCTGGGATCT
Primers for in situ probe
   ForwardTGGAGGATGAAGCTGTCCTG
   ReverseTGAGTGGTTTGAGGATGCTAC