Table 1.

Primer and dual-label probes designed from sequences obtained from GenBank

Accession no.Primer and probeSequences
NM_204107UCP (F)5′-CTGATGACAGACAACGTCCC-3′
UCP (R)5′-TTCATGTACCGCGTCTTCAC-3′
AB088686ANT (F)5′-CTATAGAGCTGCCTACTTTGG-3′
ANT (R)5′-ATGATATCAGCTCCTTTGCG-3′
NM_001006457PGC-1α (F)5′-GACGTATCGCCTTCTTGCTC-3′
PGC-1α (R)5′-CTCGATCGGGAATATGGAGA-3′
PGC-1α probe5′-(FAM)CCTCAACGCAGGTCTTGTTCCCG(BHQ1)-3′
NM_205521ATP1A1 (F)5′-TGCTCGACTCAACATTCCTG-3′
ATP1A1 (R)5′-GGGGAATCATTCACACCATC-3′
NM_205520ATP1B1 (F)5′-CTAAGGCGCCAGAAAATGAG-3′
ATP1B1 (R)5′-GGGTAGTACTGCAGGGCAAA-3′
XM_418224POLR2E (F)5′-CATGCAGGAGGAGAACATCA-3′
POLR2E (R)5′-TGCAGAAACTGCTCCAGGAT-3′
POLR2E probe5′-(cy5)TGCTGCACCACAATCAGCGCACG(BHQ1)-3′
  • (F), forward; (R), reverse