Table 1.

PCR amplification of TonEBP, AR, BGT-1, SMIT and TauT from N. alexis

Forward primer (5′–3′)Reverse primer (5′–3′)ATPS (bp)
TonEBPATGCAATTTCAGAATCAGCCGCATTTGCTGAGAAAGAAG60°C514
ARTTGACTGCGCCCAGGTGTACTATATGCTGTCACCACGATGC60°C504
BGT-1ATGGACCAGAAAGGCAAGGACCTCTCCCAGAATTCCATGACAG60°C509
SMITCACTGTGAGTGGATACTTCCTCTCTTAACTTCCTCAAACC52°C544
TauTTCCACAAAGACATCCTGAAGCGGTGAAGTTGGCAGTGCTAAG60°C539
  • AR, aldose reductase; BGT-1, betaine/GABA transporter; SMIT, myo-inositol transporter; TauT, taurine transporter; TonEBP, tonicity-responsive enhancer binding protein; AT, annealing temperature; PS, expected size of the PCR amplicons (bp)