Table 1.

Primers used for quantitative real-time PCR

Tilapia geneGenBank accession no.Sense (5′ to 3′)Antisense (5′ to 3′)Product size (bp)
NKCC1aAY513737GGAGGCAAGATCAACAGGATTGAATGTCCGAAAAGTCTATCCTGAACT84
NKCC1bAY513738AGAACTTTGGTCCAGAATTCAGAGATCCAGTAGCTGCAGGGAAGAAA76
NKCC2AY513739CTCATCGGTGACCTCAACACCAACCTGGAGATTTGGCATA113
NCCEU518934CCGAAAGGCACCCTAATGGCTACACTTGCACCAGAAGTGACAA79
NHE3AB326212AAGCGGCACCCATCACTACAGAGCCAGCAAACCAGAATCCA98
H+-ATPaseAB369668CCACAGCTCAGAGCGACAACAGCATACTCGGCCTTGATCTTG136
18S rRNAAF497908CGGAGAGGGAGCCTGAGAAAGTCGGGAGTGGGTAATTTGC73