Table 1.

PCR reactions and primers used to determine the cDNA sequence of M. californianus preCols

PreCol D5′RACE/DR-1, DF-2/DR-2, DF-3/DR-3
   McDR-15′ TCCGCCACCTACAACTGGACC 3′
   McDF-25′ GCAGCAGCAAACGCAGCAGCAGGAGGAT 3′
   McDR-25′ CTCCGGCTGTTCTGAGGTCTTCAAT 3′
   McDF-3*5′ GTGGTATGGGTAGACGAG 3′
   McDR-3*5′ AACACTTGCAGATTTTATTGATA 3′
PreCol NG5′RACE/NGR-1, NGF-2/NGR-2dg, NGF-3/NGR-3, NGf-4/NGR-4
   McNGR-15′ AAGTGGGAATCCGCCGCCACCAGTTGC 3′
   McNGF-25′ GCGGCTATCGCCCGCACAGGACTA 3′
   McNGR-2dg5′ YTGWCCWGGDGCWCCWCCDGCATTWCCWGGTTGG 3′
   McNGF-35′ GCAACTGGTGGCGGCGGATTCCCACTT 3′
   McNGR-35′ CCACCAGCCTCTCCTGCTGGTCCTTCT 3′
   McNGF-4*5′ AAGGAGAACTTGGACCAGTCG 3′
   McNGR-4*5′ AGGAACTTGCACTTTTTAT 3′
PreCol P5′RACE/PR-1, PF-2/PR-2, PF-3/3′RACE
   McPR-15′ GGATCAGGCAGTGGCAGAGCATTTGGTGG 3′
   McPR-2*5′ GAATAACACCTGGTGCTCCT 3′
   McPF-2*5′ GAGGATTCGGTGGACCAGGTAC 3′
   McPF-35′ GGGACCAGGAGGTGAAAGAGGAGGCCAAGG 3′
  • * Primers from M. edulis. McDR-3 and McNGR-4 are based on the 3′ UTR

  • dg Degenerate primer