Table 1.

Primers used for amplification and cloning of agNAT8

Oligo nameDescriptionNucleotide sequence
Lu4St115′ RACE adapterCGACGTGGACTATCCATGAACGCAACTCTCCGACCTCTCACCGAGTACG
Lu4Trsa3′ RACE adapterCGACGTGGACTATCCATGAACGCA CGCAGTCGGTACTTTTTTTTTTTTT
NsLu4nested 5″ and 3′ RACE adapterTCGAGCGGCCGCCCGGGCAGGT CGACGTGGACTATCCATGAACGCA
agNAT8_338-57_1>internal primerAGGCGGCGCGTTCGTGATAC
agNAT8_1115-34_2>internal primerGTCGCTGCTGGCCGGGTGTA
agNAT8_551-70_1<internal primerGCCCACGGGAGCGGGTACAT
agNAT8_1412-31_2<internal primerCCGCCCGGCGTCACGTAGAT
agNAT8_3′agNAT8 3′ endTCAGTCCTCGTCGATGAACTTTTTGTACT
agNAT8_5′agNAT8 5′ startATGGAAGGACGGGATAATAATGGGTTCA
5′agNAT8BamHI5′ primer for pXOOM cloningcgggatcccgATGGAAGGACGGGATAATAATGGGTTCA*
3′agNAT8HindIII3′ primer for pXOOM cloningcccaagcttgggTCAGTCCTCGTCGATGAACTTGTACTCGT*
agNAT8-7FqPCR primerGGACGGGATAATAATGGGTTCA
agNAT8-64RqPCR primerGGTACTGGCCCGCTATCGAT
ag18SrRNA-403FqPCR primerCGGCGCGAGAGGTGAA
ag18SrRNA-466RqPCR primerCCTTGGCAAACGCTTTCG
  • * BamHI and HindIII restriction sites with restriction enhancers are shown in lower case with restriction sites underlined.