Table 1.

Oligonucleotide primers for cloning, sequencing and expressing A. franciscana V-ATPase B-subunit

Primer titlePrimer sequence (5′→3′)Position in cDNAUse
HATR4Degenerate (Weihrauch et al., 2001)719-739A, S
HATF2Degenerate (Weihrauch et al., 2001)1092-1110A, S
5′ RACE innerGAACCGAGCAGTTTCCATATTC731-752R, S
5′ RACE outer#2GATCCATTTCTGCCTTCAACTC1041-1062R, S
3′ RACE innerCTACGAAAGAGCTGGCAGAGTT1024-1045R, S
3′ RACE outerAGTGTGAGAAACATGTGCTCGT885-906R, S
Bsub3′walkGTAGGCGAAGAAGCTCTTAC1337-1356S
Bsub3′walk2TTGGATGGCAACTTCTTCGT1458-1477S
5′walkbackTGCTGGTCTTCCTCACAAT601-622S
5′walk1GGACCATTGACTCCAGAAACA166-186S
expr(L)Bsub2CTGGGAATTCGTGAATATGGAAACT728-742E, S
expr(R)Bsub2TGCCTCGAGTAGTAATGTCATCGTT1094-1108E, S
  • Adapter sequences containing restriction sites are underlined. Abbreviations: A, primer used in first PCR amplification; R, primer used in RACE amplification; S, primer used in sequencing cDNA; E, primer used for amplification of sequence employed in protein expression.