Table 1.

List of PCR primers used in the amplification of opsin sequences

PrimerPrimer sequence 5′-3′
VSWS1FTGGGCCTTYTACCTNCARRCNGCCTTYATGGG
VSWS1RGCTCTTRGAGAARAASGCVGGGATGGTGAC
5′ RACE adaptor primerGGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG
P.borch SWS1FTTATACAGTCGGAGGTCACGATGGGGAAG
P.borch SWS1RCATCCTTTAATCAGTCGTCATTTTGTCCCATCG
D.mawsUVFGCGCGAATTCCACCATGGGGAAGGACTTCCAC
D.mawsUVRCGGCGTCGACGCAGACACTGAGGACACCTC
D.mawsGFGCGCGAATTCCACCATGGAGACCAATGGCACAG
D.mawsGRCGGCGTCGACGCAGACACAGAGGACACTTCTG
Blue400FYYGTGGTCTCTKGCTGT
Blue818RCCAGCATACCAAGAAGCC
T.loen3′IGCAGAGTCTGCCTCCACC
MZbluestopCTAWGCAGGYSCCYACTTTRG
T.loenFCGGATGGAGCAGGTAC
T.loenRGGTGGAGGCAGACTCTGC
Green1FATGAAYGGCTGARGGMAA
Green596RCATATGATTCATTGTTGTAGCC
Green3′OTCCAGATACATTCCTGAGGG
Green3′IGCTGGAATTGGTGTTGGGA
GreenWkOCTAGAAGCTTGAACATGATGGG
GreenWkITAAGGACTTCTAACAATCCC
UNI33(T)15GTTTGTTGT(G)7TT
UNI17TTTTTGTTTGTTGTGGG
  • Underlined bases identify EcoRI and SalI restriction enzyme sites for cloning into the expression vector pMT.