Table 2.

Primers used for RT-PCR of MHC isoforms

MHC-2Afor 5′AGCCGGGAGGTTCACACAAA3′
rev 5′CTTTGCAATAGGGTAGGATAGGC3′
MHC-2Bfor 5′TGAAAATGAACAGAAGCGCAATG3′
rev 5′TTTCCTTGACATCACATGACATATAAC3′
MHC-2Xfor 5′TGAAGAAGAACCTGGAGCAGACG3′
rev 5′CATTAAGTACAAAACAGAGTGACAAAGATT3′
MHC-slowfor 5′TGGAGCGCATGAAGAAGAACA3′
rev 5′AGTGCTTTATTCTGCTTCCTCCAA3′
  • for, forward; rev, reverse.