Table 1.

PCR primer sequences (5′→3′)

SequenceForwardReverse
Fast MHCGCATTCGTGAACTTGAAGGTCAACCTTATAGCCCATGAATCTAGG
S1 MHCCGAAACCAATGCTCTGAAGAACACCGTAAGCATCAAGTACCGTCCAAGG
P75AACGAGATCACCACTGACCCCATGGTAGTCTTGCCGGTTT
Actin *TACATCCAGACCAGTAGCAAGCACTGGGTCATCTTCTCACGGTTGG
  • MHC, myosin heavy chain.

  • * Primers for actin are the same as used by Koenders et al. (2002); GenBank accession #AF399872.