Article Figures & Tables
Figures
- Table 1.
Real-time PCR primers
Gene Forward primer (5′–3′) Reverse primer (5′–3′) PGC-1α1 atggcgtgggacaggtgta tgattggtcactgtaccacttgag PGC-1β2 tggggaagaggaggtctgc ccgtccaggctgtctgtg PRC3 cagttatgagcaggtggaca tctcgcctctatctgaatgg PPARα4 gagcccaagtttcagtttgc ggaagaggaactcgttgtcg PPARβ5 tggctttgtggatctcttcc gatctcgctgaaaggtttgc NRF-16 aggccctgaggactatcgtt gctccagtgccaacctgtat CS7 atggacttgatcgccaagc ccaccctcatggtcactgt COX IV8 agggatcctggctgcact tcaaaggtatgggggacatc COX I9 gtgcctgagccggaatagt tcagtttccgaatcctccaat MCAD10 caatggtcagaaaatgtggat ggcccatgtttaattccttt FAS11 ccaacacctcagtgcagttc ggaacgtcacaccttgctc EF-1α12 atgcggtggaatcgacaa cagagagcaatgtcaatggtg -
Gene-specific primers were designed on goldfish or consensus sequences. CS, citrate synthase; COX, cytochrome oxidase; EF-1α, elongation factor-1α; FAS, fatty acid synthase; MCAD, medium chain acyl CoA dehydrogenase; NRF-1, nuclear respiratory factor-1; PPAR, peroxisome proliferator activator receptor; PGC-1, PPARγ coactivator-1; PRC, PGC-1-related coactivator. GenBank accession numbers: 1EU426842, XM678107; 2EU426839, XM678566; 3EU426841, XM001338200, CAAB01000022.1, CA371089; 4AY198322, AM230808, AY590299; 5AY894894, AF342937, AJ416953, AY590301, AY356399; 6AF087671; 7BC045362, DQ059757, AY382596; 8EU426840; 9AB111951, DQ656543, NC001606, AY996924; 10NM213010, NM016986, NM000016; 11XM682295, NM007988, NM004104, NM205155; and 12AB056104, NM1312
-
- Fig. 1.
Mitochondrial enzyme activities in red muscle (A,B), white muscle (C,D) and liver (E,F) of goldfish exposed to three acclimation temperatures (4, 20, 35°C) and three diets (fasted, control and high fat diet). Values are expressed as means + s.e.m., and are labelled with different letters to indicate statistical significance according to a Kruskall–Wallis test followed by a Mann–Whitney U-test, with N=5–7 for each treatment. CS, citrate synthase; COX, cytochrome oxidase.
- Fig. 2.
Gene expression in red muscle (A), white muscle (B), heart (C) and liver (D) of goldfish exposed to three acclimation temperatures (4, 20, 35°C). Values are expressed as means + s.e.m. relative to controls (20°C and control diet fish). Different letters indicate statistically significant differences between treatments according to a Kruskall–Wallis test followed by a Mann–Whitney U-test (N=7–17). MCAD, medium chain acyl CoA dehydrogenase; NRF-1, nuclear respiratory factor-1; PPAR, peroxisome proliferator-activated receptor; PGC-1, PPARγ coactivator-1; OXPHOS, oxidative phosphorylation; other abbreviations as in Fig. 1.
- Fig. 3.
Gene expression in red muscle (A), white muscle (B), heart (C) and liver (D) of goldfish exposed to three diets (fasted, control and high fat diet). Values are expressed as means + s.e.m. relative to controls (20°C and control diet fish). Different letters indicate statistically significant differences between treatments according to a Kruskall–Wallis test followed by a Mann–Whitney U-test (N=7–17). Abbreviations as in Fig. 2.
- Fig. 4.
PGC-1β mRNA expressed as a proportion of PGC-1α + β transcript levels in red muscle (A), white muscle (B), heart (C) and liver (D) of goldfish exposed to three acclimation temperatures (4, 20, 35°C) and three dietary treatments (fasted, control and high fat diet). Bars represent means + s.e.m. Different letters indicate statistically significant differences between treatments according to a Kruskall–Wallis test followed by a Mann–Whitney U-test (N=7–17). Abbreviations as in Fig. 2.
- Fig. 5.
Putative regulators of metabolic gene expression in goldfish tissue. Paired relative mRNA values for all tissues and all treatments were used; R2 values were determined by linear regression; all correlations were found to be significant (P<0.05; N=46–53 per tissue). Abbreviations as in Fig. 2.
Article navigation
Related articles
Cited by...
More in this TOC section
Similar articles
Other journals from The Company of Biologists
Welcome to JEB’s new Editor Monica Daley
We are pleased to welcome Monica Daley to JEB’s Editorial team. Monica has had a long association with JEB before taking up her new role, overseeing peer review of neuromuscular physiology, terrestrial biomechanics and integrative physiology of locomotion.
In the field with Robyn Hetem
Continuing our fieldwork series, Robyn Hetem reflects on working with species ranging from aardvark to zebra, and the impact COVID-19 has had on fieldwork.
Read & Publish participation continues to grow
“It is particularly encouraging for early career researchers, as it allows them to display their research globally without the need to find costs to cover the open access option.”
Professor Fernando Montealegre-Z (University of Lincoln) shares his experience of publishing Open Access as part of our growing Read & Publish initiative. We now have over 150 institutions in 15 countries and four library consortia taking part – find out more and view our full list of participating institutions.
Nocturnal reef residents have deep-sea-like eyes
Fanny de Busserolles and colleagues from The University of Queensland have discovered that the eyes of nocturnal reef fish have multibank retinas, layers of photoreceptors, similar to the eyes of deep-sea fish that live in dim light conditions.
Mechanisms underlying gut microbiota–host interactions in insects
In their Review, Konstantin Schmidt and Philipp Engel summarise recent findings about the mechanisms involved in gut colonisation and the provisioning of beneficial effects in gut microbiota–insect symbiosis.