Article Figures & Tables
Figures
- Fig. 1.
RT-PCR expression analysis of pig myosin isoforms (1, 2A, 2B, 2X) on different muscle tissue. (A) Samples were loaded onto agarose gel in the following order: masseter (M), longissimus dorsi (LD), semitendinosus red portion (Sr), diaphragm (D), white semitendinosus (Sw) and duplicated masseter (M′), longissimus dorsi (LD′), red semitendinosus (Sr′). s, standards; 1Kb Plus DNA Ladder (Invitrogen). The brightest band (500 bp) and bottom band (100 bp) of the molecular size markers are indicated. (B) The same isoforms were analysed in the retractor bulbi muscle (Rb). All MHC isoforms are expressed except for the slow isoform (type 1). The arrow indicates the position of the amplification of the slow isoform fragment (of 573 bp, see A) that is not expressed in this muscle. The band at 100 bp is due to primer aspecific anealing. s, markers as in A.
- Fig. 2.
Histochemistry and immunohistochemistry on a composition of masseter (m) and longissimus dorsi (Ld) (a–c) and on a sample of red semitendinosus (Str) (d–f). Consecutive sections were stained for mATPase with acid (pH 4.55; a) or alkali (pH 10.3; d) preincubation and with monoclonal antibodies specific for MHC-2A (SC71; b,e) and MHC-2X (BF-35; c,f). Slow fibres (type1) are dark with mATPase staining after acid preincubation and white after alkali preincubation. In masseter, only type 1 and 2A are present, whereas in red semitendinosus type 2X and 2A/X fibres are also detectable. In Ld muscle, the conventional 2B fibre type (2*) might be either 2B or 2X or hybrids (2A/X or 2X/B). Scale bars, 40 μm.
- Fig. 3.
Histochemistry and immunohistochemistry on longissimus dorsi muscle. Consecutive sections were stained for mATPase after acid (a) or alkali (d) preincubation and with four monoclonal antibodies specific for MHC isoforms (b,c,e,f). The typical organization of islets of slow fibres surrounded by fast fibres is visible. Among fast fibres, hybrid fibres 2A/X and 2X/B are very abundant, while only few pure 2A and 2X are present. In the deep portion of the muscle, next to multifidus lomborum muscle, some pure 2B fibres are detectable (indicated as B). Scale bars, 40 μm.
- Fig. 4.
Electrophoretic separation of MHC isoforms in muscle samples and single fibres. (A) Two bands (MHC-1 and MHC-2A) can be seen in masseter (M), three bands (MHC-1 MHC-2A and MHC-2X) in diaphragm (D) and (MHC-1 MHC-2B and MHC-2X) in red semitendinosus (Sr), white semitendinosus (Sw) and longissimus dorsi (LD). (B) Two hybrid single fibres (2X-2B and 2X-2A) are compared with masseter (M), diaphragm (D) and longissimus (L). (C) Five bands (three fast MHC-2B, -2X and -2A, extraocular (Eo) and MHC-1, barely detectable) are separated in the extraocular rectus lateralis (RL) and two bands (MHC-2X and MHC-2B) in rectractor bulbi (RB). Three single fibres (pure 2B and hybrid 2X-2B and 2X-2A) are also shown.
- Fig. 5.
Mean values of cross sectional area (CSA) (A), isometric tension Po (B) and maximum shortening velocity Vo (C) of the six fibre types identified in pig muscles. Values are means ± s.e.m. ANOVA showed that (i) CSA values of slow fibres (type 1) were significantly different from those of 2A and 2B fibres, values of 2A fibres were significantly different from those of all other fibre types, values of 2B fibres were significantly different from those of all other fibre types; (ii) Po values of slow fibres (type 1) were significantly different from those of all other fibre types except 2B fibres and Po values of 2B fibres were significantly different from those of all fibre types except slow fibres; (iii) Vo values of slow fibres (type 1) were significantly different from those of all other fibre types, Vo values of 2A fibres were significantly different from those of all other fibre types, Vo values of 2B fibres were significantly different from those of all other fibre types.
- Fig. 6.
Interspecies variations of Vo and Po. (A) Relationship between maximum shortening velocity Vo (expressed in μm h-1 s-1 for correct comparison among species) and body size. A regression line for slow fibres was obtained by fitting the experimental data with the scaling equation y=ax-b; the parameters were a=3.309±0.614 and b=0.192±0.013. (B) Values of isometric tension Po measured in various fibre types in five animal species. Statistically significant differences were found for slow fibres (mouse and pig different from all other species) and for 2B fibres (pig different from all other species). Data for mouse, rat, rabbit and man from Pellegrino et al. (2003).
Tables
- Table 1.
Specificity of the mATPase staining in relation to pH values and reactivity of the monoclonal antibodies used to identify MHC isoforms and fibre types
MHC isoform 1 2A 2A/X 2X 2X/B 2B mATPase pH 10.3 — +++ +++ +++ +++ +++ pH 10.5 — ++ ++ +++ +++ +++ pH 4.6 +++ — + ++ ++ ++ pH4.55/4.5 +++ — —/+ + +/++ ++ pH 4.4 +++ — — — — — Antibodies BAF8 +++ — — — — — BFD5 +++ — — — — — SC71 — +++ ++/+ — — — BF35 — — +/++ +++ ++/+ — BFF3 — — — — — + - Table 2.
Primers used for RT-PCR of MHC isoforms
MHC-2A for 5′AGCCGGGAGGTTCACACAAA3′ rev 5′CTTTGCAATAGGGTAGGATAGGC3′ MHC-2B for 5′TGAAAATGAACAGAAGCGCAATG3′ rev 5′TTTCCTTGACATCACATGACATATAAC3′ MHC-2X for 5′TGAAGAAGAACCTGGAGCAGACG3′ rev 5′CATTAAGTACAAAACAGAGTGACAAAGATT3′ MHC-slow for 5′TGGAGCGCATGAAGAAGAACA3′ rev 5′AGTGCTTTATTCTGCTTCCTCCAA3′ -
for, forward; rev, reverse.
-
Article navigation
Related articles
Cited by...
More in this TOC section
Similar articles
Other journals from The Company of Biologists
Meet the team at SICB – 3-7 January 2020
Meet the Journal of Experimental Biology team at the SICB 2020 meeting in Austin, Texas! News & Views Editor Kathryn Knight and Reviews Editor Stefan Galander will be at booth 507, along with a selection of JEB goodies including the 2020 Calendar, 2019 Highlights booklet and new JEB T-shirts.
Springy bamboo poles help villagers carry more than their own body weight
People in Southeast Asia often carry extremely heavy loads suspended from a bouncy bamboo pole slung over one shoulder. It turns out that they adjust their stride to bounce in time with the pole, allowing them to save 20% of their energy. Read more.
Two-year pilot transitional open access agreement
We are excited to announce a two-year pilot transitional open access agreement with Jisc from January 2020. Researchers at participating institutions will have unlimited access to The Company of Biologists’ three subscription journals and will be able to publish their research papers open access. Find out more.
Commentary — The utility and determination of Pcrit in fishes
Gordon Ultsch and Matthew Regan outline why Pcrit is a useful and informative comparator of hypoxia tolerance in fishes, provided it is determined using standardized respirometry methods and sound statistical approaches.
Where will your research take you?
Early-career researchers can apply for up to £2,500 to offset the cost of travel and expenses to make collaborative visits to other labs around the world. Read about Pierre’s experience in Greenland, where he continued research into the Greenland Shark’s remarkable longevity.