|
| ![]() |
|
||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online January 30, 2009
Journal of Experimental Biology 212, 494-498 (2009)
Published by The Company of Biologists 2009
doi: 10.1242/jeb.022780
Increase in Presenilin 1 (PS1) levels in senescence-accelerated mice (SAMP8) may indirectly impair memory by affecting amyloid precursor protein (APP) processing


Division of Geriatric Research, Education and Clinical Center, VA Medical Center, St Louis, MO 63125, USA and St Louis University Health Sciences Center, St Louis, MO 63104, USA
* Author for correspondence (e-mail: kumar{at}slu.edu)
Accepted 7 October 2008
| Summary |
|---|
|
|
|---|
-
or β-secretases, releasing a large fragment called APPS that
contains most of the extracellular sequences of APP, a small extracellular
stub, the transmembrane region and the cytoplasmic tail of APP (`AICD'-APP
intracellular domain). These are subsequently cleaved by
-secretase at
multiple sites in the transmembrane region, releasing small peptides,
Aβ1-40 and Aβ1-42, the major components of
AD-associated amyloid fibrils.
-secretase is a high-molecular-mass
complex composed of presenilin-1 (PS1), nicastrin, APH-1 and Pen-2. As PS1 has
been shown to play a critical role in facilitating
-secretase activity,
and mutations in this protein are associated with familial AD (FAD), we have
cloned it from SAMP8 mouse hippocampus and compared its sequence with those of
other species. Furthermore, changes in the expression of PS1 with age in the
hippocampal tissue of SAMP8 were studied. The results showed that the SAMP8
PS1 cDNA sequence is identical to that of normal mice. However, its expression
in the hippocampus of SAMP8 exhibited an increase, while CD-1 mice, a strain
that does not exhibit premature memory loss, showed no change with age. An
increased amount or mutation(s) in PS1, which alters the stoichiometric
balance of the
-secretase complex, may be the cause of aberrant or
increased processing of APP, resulting in Aβ accumulation leading to loss
of memory.
Key words: aging, amyloid, memory, presenilin, scenecence
| INTRODUCTION |
|---|
|
|
|---|
-secretase, and mutations
in PS1 in some way augment the aberrant processing of APP
(Xia et al., 1998
-secretase modulate the Aβ42/Aβ40
ratio, which is important for plaque formation
(Yin et al., 2007In view of the importance of PS1 in APP processing, we hypothesize that its levels play a significant role in the modulation of Aβ levels, thereby causing memory loss with age. SAMP8 mice, which exhibit early loss of memory, therefore serve as an excellent model for such study.
In the Golgi region, PS1 exists as a heterodimer, with the NTF (N-terminal
fragment) and CTF (C-terminal fragment) separated but closely associated in a
1:1 stoichiometry of about 150 kDa (Capell
et al., 1998
). PS1 consists of 467 amino acids with a molecular
mass of 52,671, arranged in 7–9 transmembrane (TM) helices and a
hydrophilic acidic loop region encompassing amino acids 203–407. It is
subjected to endolytic cleavage between amino acids 260 and 320, generating a
27–28 kDa NTF and a 17–18 kDa CTF derivative
(Ratovitski et al., 1997
;
Thinakaran et al., 1996
). In
the endoplasmic reticulum, it exists as an inactive uncleaved 53 kDa
holoprotein (Huynh et al.,
1996
). In the mouse brain, both the 150 kDa heterodimer
(NTF–CTF associated complex) and the 53 kDa holoprotein can be detected
(Capell et al., 1998
).
Immunohistochemical staining has revealed that PS1 is localized predominantly
to large neurons in areas that have increased concentrations of senile plaques
in AD, such as the hippocampal formation, entorhinal cortex and the subiculum
(Huynh et al., 1996
). Early
on, PS1 was shown to bind APP at one or more sites
(Waragai et al., 1997
;
Weidemann et al., 1997
).
Later,
-secretase and associated enzymes were found to participate in
cleaving APP to generate Aβ42
(Evin et al., 2000
;
Wolfe et al., 1999
).
For the current investigation, we have cloned PS1 from the hippocampus of SAMP8 mouse. Its sequence is compared with those of other species, including the house mouse, in order to locate any mutations that may be presented in the SAMP8 mouse sequence. Many mutations that are linked to FAD occur in human PS1 but only a few occur in APP. Therefore, even a single change in the PS1 sequence in SAMP8 mouse may explain the cause of its loss of memory at an earlier age. While no change in sequence was noticed in the SAMP8 PS1, protein expression increased with age in these mice, providing a possible mechanism for the increase in hippocampal Aβ.
| MATERIALS AND METHODS |
|---|
|
|
|---|
RNA isolation and molecular cloning
Total RNA was isolated from the hippocampal tissue of 4-month-old P8 mice
by a previously described method (Chirgwin
et al., 1979
). Cloning of presenilin cDNA was performed by RT-PCR
from total RNA isolated from SAMP8 hippocampus. The primers used were
5'-ATGACAGAGATACCTGCACCTTTG–forward and
5'CTAGATATAAAACTGATGGAATGCAA–reverse. The PCR products from three
independent reactions were directly cloned into the PCR-II vector supplied by
Invitrogen.
|
Western blotting
Western blotting was performed essentially as described previously
(Kumar et al., 2001
). Briefly,
10–20 mg of hippocampal tissue from 4-month-old mice was homogenized in
PBS containing protease inhibitors (1% Triton-X100, 2 mmol
l–1 PMSF, 3 mmol l–1 EDTA and 0.1% SDS).
Protein (2–5 µg) was run on 10% tris-glycine polyacrylamide gels and
transferred to nitrocellulose nylon membranes. The blot was blocked with 1%
milk protein in TBS (25 mmol l–1 Tris-HCl, pH7.4, 137 mmol
l–1 NaCl, 2.7 mmol l–1KCl) followed by
treatment with the first antibody for 1 h. The antigen–antibody complex
was detected by using the second antibody conjugated to peroxidase, followed
by ECL (advanced Western Blotting Detection kit, GE Healthcare,
Buckinghamshire, UK) luminal reaction and exposure for a few seconds to X-ray
film.
| RESULTS |
|---|
|
|
|---|
|
The densities of the PS1 bands were normalized to the densities of GAPDH bands obtained using the same quantities of protein loaded on identical gels, blotted and probed with GAPDH antibodies or by stripping the same blot (Fig. 2B).
Fig. 3 shows the plot of ratios of band intensities of P8 PS1 and the corresponding GAPDH bands shown in Fig. 2. The results show that the amount of holoprotein increased from 4 to 18 months (Fig. 3A). Similar quantification of the heterodimer showed a pronounced decrease with age (Fig. 3B). Fig. 3 represents an average of three animals per experiment.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
-secretase complex, its
stoichiometry may play an important role in balanced processing of APP. A
decrease in PS1 (Refolo et al.,
1999
-secretase activity. Accumulation of Aβ is attributed to loss of
memory, as reduction of APP expression reverses this loss
(Kumar et al., 2000
-secretase, PS1 is another
therapeutic target for reducing Aβ formation. As SAMP8 mice have been
shown to exhibit memory loss at a relatively early age
(Flood and Morley, 1998
-secretase activity may become
less regulated by the increased expression or mutation of PS1, leading to an
increased Aβ, which may in turn cause early loss of memory in SAMP8
mice.
Several reports suggest that inhibition of the expression of APP or
secretases would reduce Aβ accumulation
(McMahon et al., 2001
;
Nawrot, 2004
;
Tomita and Iwatsubo, 2004
). A
few potent inhibitors of β- and
-secretases have been reported
inter alia (Dominguez et al.,
2001
; Maiorini et al.,
2002
; Schenk et al.,
2001
; Shearman et al.,
2000
; Tomita and Iwatsubo,
2004
), which is rational in view of the fact that, even recently,
β-secretase has been shown to be elevated in AD patients
(Zhao et al., 2007
). These
inhibitors are small-molecular-mass chemicals that inhibit secretase activity.
-secretase is a high-molecular-mass membrane protein complex that
includes PS1, nicastrin, anterior pharynx homolog 1 (APH-1) and presenilin
enhancer protein 2 (Pen-2) (Morohashi et
al., 2006
). It was shown that highly specific inhibitors that
modulate PS1 activity in human CNS neurons not only affected Aβ
generation but also affected Notch and its activity
(Seiffert et al., 2000
). This
was accompanied by changes in neurite morphology, suggesting that regulation
of
-secretase/PS1 activity may have clinically beneficial effects on
the neuritic pathology of AD (Figueroa et
al., 2002
). Antisense oligonucleotides
(Dolnick, 1991
), RNA cleaving
agents like ribozyme (Macpherson et al.,
1999
) and RNA interference
(Elbashir et al., 2001
) have
recently taken strides as therapeutic agents that regulate messages thereby
regulating the corresponding protein expression. Targeting
-secretase
activity is one of the therapeutic approaches for AD
(Seiffert et al., 2000
;
Tomita and Iwatsubo, 2004
).
Reduction of PS1 was shown to downregulate amyloid
(Luo et al., 2004
;
Saura et al., 2005
). We have
observed that inhibition of PS1 in SAMP8 mice improves memory (B.V.K., S.A.F.,
W.A.B.,M.F. and J.-E.M., unpublished). Downregulation of PS1 was shown to
decrease the secretion of amyloid β protein
(Luo et al., 2004
). Refolo et
al. noticed that antisense against PS1 increased the secretion of
Aβ42 without affecting Aβ40 in transfected
human cell cultures (Refolo et al.,
1999
). It is possible that either the increase in PS1 or its
inactivation by mutation may result in the aberrant activity of
-secretase, consequently increasing the production of Aβ protein.
Our group has shown that the efflux of amyloid β protein in SAMP8 mice is
impaired (Banks et al., 2003
).
Therefore, it is also possible that PS1 may assist in the removal of excess
amyloid β protein. Interestingly, while an excess amount of amyloid
β protein causes impairment of memory, too little of it may also be
detrimental to cognitive functions. We have recently shown that blocking
amyloid β protein with a specific peptide antibody resulted in impaired
acquisition in CD-1 mice (Morley et al.,
2005
). Taking these results together, PS1 may be involved in the
regulation of Aβ42 secretion in addition to aiding
-secretase activity. Most importantly, it may serve as a regulator of
-secretase activity. If this were the case, the therapeutic approach
should involve coordinated reduction of
-secretase and PS1 rather than
just one of the components of this enzyme complex. Regardless of the overall
function of PS1, upregulation or downregulation of PS1, depending on the
available PS1, may be one of the therapeutic approaches in AD pathogenesis. We
are currently in the process of developing novel technologies to upregulate or
downregulate proteins. In a separate study we have shown that expression of
PS1 and APP may be regulated by hybrid antisense technology in transiently
co-transfected COS 7 (B.V.K., M.F. and P.K., unpublished). Such molecular
modulation of more than one protein at a time may become necessary to offset
the adverse affects of simultaneous over- and/or under-expression of certain
important proteins.
| Acknowledgments |
|---|
| Footnotes |
|---|
Present address: Forest Park Health Center, St Louis, MO 63139, USA
Present address: St Anthony's Medical Center St Louis, MO 63128, USA ![]()
| References |
|---|
|
|
|---|
Banks, W. A., Robinson, S. M., Verma, S. and Morley, J. E. (2003). Efflux of human and mouse amyloid beta proteins1-40 and 1-42 from brain: impairment in a mouse model of Alzheimer's disease. Neuroscience 121,487 -492.[CrossRef][Medline]
Bradford, M. M. (1976). A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72,248 -254.[CrossRef][Medline]
Capell, A., Grunberg, J., Pesold, B., Diehlmann, A., Citron, M.,
Nixon, R., Beyreuther, K., Selkoe, D. J. and Haass, C.
(1998). The proteolytic fragments of the Alzheimer's
disease-associated presenilin-1 form heterodimers and occur as a 100–150
kDa molecular mass complex. J. Biol. Chem.
273,3205
-3211.
Chen, M. and Fernandez, H. L. (1999). The Alzheimer's plaques, tangles and memory deficits may have a common origin. Part V: why is Ca2+ signal lower in the disease? Front. Biosci. 4,A9 -A15.[Medline]
Chirgwin, J. M., Przybyla, A. E., McDonald, R. J. and Rutter, W. J. (1979). Isolation of biologically active ribonucleic acid from sources enriched in bibonuclease. Biochemistry Mosc. 18,5294 -5299.[CrossRef]
Dolnick, B. J. (1991). Antisense agents in cancer research and therapeutics. Cancer Invest. 9, 185-194.[Medline]
Dominguez, D. I., De S. and Annaert, W. (2001). Secretases as therapeutic targets for the treatment of Alzheimer's disease. Amyloid 8,124 -142.[Medline]
Edwards-Lee, T., Wen, J., Bell, J., Hardy, J., Chung, J. and Momeni, P. (2006). A presenilin-1 mutation (T245P) in transmembrane domain 6 causes early onset Alzheimer's disease. Neurosci. Rep. 398,251 -252.
Elbashir, S. M., Lendeckel, W. and Tuschl, T.
(2001). RNA interference is mediated by 21- and 22-nucleotide
RNAs. Genes Dev. 15,188
-200.
Evin, G., Le Brocque, D., Culvenor, J. G., Galatis, D., Weidemann, A., Beyreuther, K., Masters, C. L. and Cappai, R. (2000). Presenilin I expression in yeast lowers secretion of the amyloid precursor protein. NeuroReport 11,405 -408.[Medline]
Figueroa, D. J., Morris, J. A., Ma, L., Kandpal, G., Chen, E., Li, Y. M. and Austin, C. P. (2002). Presenilin-dependent gamma-secretase activity modulates neurite outgrowth. Neurobiol. Dis. 9,49 -60.[CrossRef][Medline]
Flood, J. F. and Morley, J. E. (1998). Learning and memory in SAMP8 mouse. Neurosci. Biobehav. Rev. 14,153 -157.
Goedert, M. and Crowther, R. A. (1989). Amyloid plaques, neurofibrillary tangles and their relevance for the study of Alzheimer's disease. Neurobiol. Aging 10,405 -406.[CrossRef][Medline]
Heyn, S. N. and Vulliet, P. R. (2001). Presenilin 1 mutations increase amyloid precursor protein production and proteolysis in Xenopus laevis oocytes. Brain Res. 904,189 -198.[CrossRef][Medline]
Huynh, D. P., Ho, V. V. and Pulst, S. M. (1996). Characterization and expression of presenilin 1 in mouse brain. NeuroReport 7,2423 -2428.[Medline]
Kumar, V. B. (1993). Cloning and expression of rabbit pancreatic phospholipase A2. Biochem. Biophys. Res. Commun. 192,683 -692.[CrossRef][Medline]
Kumar, V. B., Farr, S. A., Flood, J. F., Kamlesh, V., Franko, M., Banks, W. A. and Morley, J. E. (2000). Site-directed antisense oligonucleotide decreases the expression of amyloid precursor protein and reverses deficits in learning and memory in aged SAMP8 mice. Peptides 21,1769 -1775.[CrossRef][Medline]
Kumar, V. B., Vyas, K., Franko, M., Choudhary, V., Buddhiraju, C., Alvarez, J. and Morley, J. E. (2001). Molecular cloning, expression, and regulation of hippocampal amyloid precursor protein of senescence accelerated mouse (SAMP8). Biochem. Cell Biol. 79,57 -67.[CrossRef][Medline]
Luo, H. M., Deng, H., Xiao, F., Gao, Q., Weng, W., Zhang, P. F. and Li, X. G. (2004). Down-regulation amyloid beta-protein 42 production by interfering with transcript of presenilin 1 gene with siRNA. Acta Pharmacol. Sin. 25,1613 -1618.[Medline]
Macpherson, J. L., Ely, J. A., Sun, L. Q. and Symonds, G. P. (1999). Ribozymes in gene therapy of HIV-1. Front. Biosci. 4,D497 -D505.[Medline]
Maiorini, A. F., Gaunt, M. J., Jacobsen, T. M., McKay, A. E., Waldman, L. D. and Raffa, R. B. (2002). Potential novel targets for Alzheimer pharmacotherapy: I. Secretases. J. Clin. Pharm. Ther. 27,169 -183.[CrossRef][Medline]
Maury, C. P. J., Nurmiaho-Lassila, E.-L. and Liljestrom, M. (1997). Alzheimer's disease-associated presenilins 1 and 2, accelerated amyloid fibril formation of mutant 410 Cys>Tyr and 141 Asn>Ile peptides. Biochem. Biophys. Res. Commun. 235,249 -252.[CrossRef][Medline]
McMahon, B. M., Stewart, J., Fauq, A., Younkin, S., Younkin, L. and Richelson, E. (2001). Using peptide nucleic acids as gene-expression modifiers to reduce beta-amyloid levels. J. Mol. Neurosci. 19,71 -76.
Miyamoto, M. (1997). Characteristics of age-related behavioral changes in senescence-accelerated mouse SAMP8 and SAMP10. Exp. Gerontol. 32,139 -148.[Medline]
Morley, J. E., Kumar, V. B., Bernardo, A. E., Farr, S. A., Uezu, K., Tumosa, N. and Flood, J. F. (2000). Beta-amyloid precursor polypeptide in SAMP8 mice affects learning and memory. Peptides 21,1761 -1767.[CrossRef][Medline]
Morley, J. E., Farr, S. A. and Banks, W. A. (2005). The presence of amyloid β protein in CD-1 mice is important for learning. Soc. Neurosci.A199.13 .
Morohashi, Y., Kan, T., Tominari, Y., Fuwa, H., Okamura, Y.,
Watanabe, N., Sato, C., Natsugari, H., Fukuyama, T., Watsubo, T. et al.
(2006). C-terminal fragment of presenilin is the molecular target
of a dipeptidic -secretase-specific inhibitor
DAPT(N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycinet-Butyl
Ester). J. Biol. Chem.
281,14670
-14676.
Nawrot, B. (2004). Targeting BACE with small inhibitory nucleic acids-a future for Alzheimer's disease therapy? Acta Biochim. Pol. 51,431 -444.[Medline]
Pantieri, R., Pardini, M., Cecconi, M., Dagna-Bricarelli, F., Vitali, A., Piccini, A., Russo, R., Borghi, R. and Tabaton, M. (2005). A novel presenilin 1 L166H mutation in a pseudo-sporadic case of early-onset Alzheimer's disease. Neurol. Sci. 26,349 -350.[CrossRef][Medline]
Ratovitski, T., Slunt, H. H., Thinakaran, G., Price, D. L.,
Sisodia, S. S. and Borchelt, D. R. (1997). Endoproteolytic
processing and stabilization of wild-type and mutant presenilin. J.
Biol. Chem. 272,24536
-24541.
Refolo, L. M., Eckman, C., Prada, C. M., Yager, D., Sambamurti, K., Mehta, N., Hardy, J. and Younkin, S. G. (1999). Antisense-induced reduction of presenilin 1 expression selectively increases the production of amyloid beta42 in transfected cells. J. Neurochem. 73,2383 -2388.[CrossRef][Medline]
Saura, C. A., Chen, G., Malkani, S., Choi, S. Y., Takahashi, R.
H., Zhang, D., Gouras, G. K., Kirkwood, A., Morris, R. G. and Shen, J.
(2005). Conditional inactivation of presenilin 1 prevents amyloid
accumulation and temporarily rescues contextual and spatial working memory
impairments in amyloid precursor protein transgenic mice. J.
Neurosci. 25,6755
-6764.
Schenk, D., Games, D. and Seubert, P. (2001). Potential treatment opportunities for Alzheimer's disease through inhibition of secretases and Abeta immunization. J. Mol. Neurosci. 17,259 -267.[Medline]
Seiffert, D., Bradley, J. D., Rominger, C. M., Rominger, D. H.,
Yang, F., Meredith, J. E., Jr, Wang, Q., Roach, A. H., Thompson, L. A., Spitz,
S. M. et al. (2000). Presenilin-1 and -2 are molecular
targets for gamma-secretase inhibitors. J. Biol. Chem.
275,34086
-34091.
Shearman, M. S., Beher, D., Clarke, E. E., Lewis, H. D., Harrison, T., Hunt, P., Nadin, A., Smith, A. L., Stevenson, G. and Castro, J. L. (2000). L-685,458, an aspartyl protease transition state mimic, is a potent inhibitor of amyloid beta-protein precursor gamma-secretase activity. Biochemistry 39,8698 -8704.[CrossRef][Medline]
Sudoh, S., Kawamura, Y., Sato, S., Wang, R., Saido, T. C., Oyama, F., Sakaki, Y., Komano, H. and Yanagisawa, K. (1998). Presenilin 1 mutations linked to familial Alzheimer's disease increase the intracellular levels of amyloid beta-protein 1-42 and its N-terminally truncated variant(s) which are generated at distinct sites. J. Neurochem. 71,1535 -1543.[Medline]
Taniguchi, T., Hashimoto, T., Taniguchi, R., Shimada, K., Kawamata, T., Yasuda, M., Nakai, M., Terashima, A., Koizumi, T., Maeda, K. et al. (1997). Cloning of the cDNA encoding rat Presenilin-1. Gene 186,73 -75.[CrossRef][Medline]
Thinakaran, G., Borchelt, D. R., Lee, M. K., Slunt, H. H., Spitzer, L., Kim, G., Ratovitsky, T., Davenport, F., Nordstedt, C., Seeger, M. et al. (1996). Endoproteolysis of presenilin 1 and accumulation of processed derivatives in vivo. Neuron 17,181 -190.[CrossRef][Medline]
Tomita, T. and Iwatsubo, T. (2004). The inhibition of gamma-secretase as a therapeutic approach to Alzheimer's disease. Drug News Perspect. 17,321 -325.[CrossRef][Medline]
Waragai, M., Imafuku, I., Takeuchi, S., Kanazawa, I., Oyama, F., Udagawa, Y., Kawabata, M. and Okazawa, H. (1997). Presenilin 1 binds to amyloid precursor protein directly. Biochem. Biophys. Res. Commun. 239,480 -482.[CrossRef][Medline]
Weidemann, A., Paliga, K., Durrwang, U., Czech, C., Evin, G., Masters, C. L. and Beyreuther, K. (1997). Formation of stable complexes between two Alzheimer's disease gene products: presenilin-2 and beta-amyloid precursor protein. Nature Med. 3, 328-332.[CrossRef][Medline]
Wolfe, M. S., Xia, W., Ostaszewski, B. L., Diehi, T. S., Kimberly, W. T. and Selkoe, D. (1999). Two transmembrane aspartates in presenilin-1 required for presenilin endoproteolysis and gamma secretase activity. Nature 398,513 -517.[CrossRef][Medline]
Xia, W., Zhang, J., Ostaszewski, B. L., Kimberly, W. T., Seubert, P., Koo, E. H., Shen, J. and Selkoe, D. J. (1998). Presenilin 1 regulates the processing of beta-amyloid precursor protein C-terminal fragments and the generation of amyloid beta-protein in endoplasmic reticulum and Golgi. Biochemistry 37,16465 -16471.[CrossRef][Medline]
Yin, Y. I., Bassit, B., Zhu, L., Yang, X., Wang, C. and Li, Y.
M. (2007). {gamma}-secretase substrate concentration
modulates the Abeta42/Abeta40 Ratio: implications for alzheimer disease.
J. Biol. Chem. 282,23639
-23644.
Zhao, J., Fu, Y., Yasvoina, M., Shao, P., Hitt, B., O'Connor,
T., Logan, S., Maus, E., Citron, M., Berry, R. et al. (2007).
Beta-site amyloid precursor protein cleaving enzyme 1 levels become elevated
in neurons around amyloid plaques: implications for Alzheimer's disease
pathogenesis. J. Neurosci.
27,3639
-3649.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
A. Auffret, V. Gautheron, M. Repici, R. Kraftsik, H. T. J. Mount, J. Mariani, and C. Rovira Age-Dependent Impairment of Spine Morphology and Synaptic Plasticity in Hippocampal CA1 Neurons of a Presenilin 1 Transgenic Mouse Model of Alzheimer's Disease J. Neurosci., August 12, 2009; 29(32): 10144 - 10152. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||