|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online February 29, 2008
Journal of Experimental Biology 211, 890-899 (2008)
Published by The Company of Biologists 2008
doi: 10.1242/jeb.014837
A new role for a classical gene: White transports cyclic GMP
Division of Molecular Genetics, Faculty of Biomedical and Life Sciences, University of Glasgow, Glasgow G11 6NU, UK
* Author for correspondence (e-mail: s.a.davies{at}bio.gla.ac.uk)
Accepted 16 January 2008
| Summary |
|---|
|
|
|---|
Key words: Malpighian tubule, functional genomics, cyclic nucleotide, transporters, ABCC, ABCG
| INTRODUCTION |
|---|
|
|
|---|
|
Work from other groups has demonstrated that cGMP and cAMP are transported
into the Malpighian tubules (Riegel et
al., 1998
); our laboratory has also recently shown that cGMP
transport across the tubule (efflux) is modulated by cGMP-dependent
phosphodiesterases (cG-PDEs) (Day et al.,
2006
). In mammalian systems, cyclic nucleotide transport has been
attributed to a number of ATP binding cassette (ABC) transporters and solute
carriers (members of the SLC22 family)
(Dazert et al., 2003
;
Koepsell, 2004
;
van Aubel et al., 2002
). These
transporters have been widely studied in mammals but equivalent transporters
have not previously been identified in dipteran insects.
White is a member of the ABC transporter subfamily G
(Shulenin et al., 2001
), with
greatest sequence similarity to human ABCG2. Investigations of the role of
White in Malpighian tubules were carried out
30 years ago, and
tentatively identified location of, and transport substrates for, White. The
location of White in the tubules was thought to be either the basolateral
membrane (Sullivan et al.,
1980
) or the pigment storage vesicle membranes
(Sullivan et al., 1979
).
Potential substrates for White included tryptophan
(Sullivan et al., 1980
),
kynurenine (Sullivan and Sullivan,
1975
), 3-hydroxykynurenine
(Howells et al., 1977
),
guanine and riboflavin (Sullivan et al.,
1979
).
Here we demonstrate that cGMP transport by the tubule occurs via ABCG2 transporters, and that White is required for cGMP but not cAMP, transport across the Malpighian tubule. Localisation of White to intracellular vesicles in the principal cells in the main, fluid-transporting segment of the tubule, indicates a possible storage–excretion mechanism of cGMP transport via vesicles.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Mutant w Drosophila (w1118 and wH) were `cantonized' by crossing white-eyed flies with isogenized Canton S wild-type flies. The offspring were collected and interbred to produce recessively white-eyed offspring. This process was repeated five times, thus removing 97% of any compensatory mutations that might have accumulated since the mutant stocks were first isolated.
For dissection, flies were anaesthetized by chilling on ice, and decapitated, before removing the tubules in Schneider's medium (Invitrogen Ltd, Paisley, Scotland). All chemicals and drugs were obtained from Sigma (Sigma-Aldrich, Gillingham, Dorset, UK), unless otherwise stated.
Generation of transgenic Drosophila
Over-expression lines containing White tagged with enhanced yellow
fluorescent protein (eYFP) at the C terminus were generated as follows:
The coding sequence for eYFP (Clontech UK Ltd, Basingstoke, Hampshire, UK) was amplified using primers that incorporated NotI and KpnI sites at the 5' and 3' ends, respectively (GCGGCCGCCATGGTGAGCAAGGGCGAGG/GGTACCCTACTTGTACAGCTCGTCCATGC). The resulting fragment was cloned into the NotI and KpnI sites of pP{UAST} using standard methods to form pP{eYFP-UAST}. The white open reading frame, excluding the stop codon, was PCR amplified from tubule cDNA template using primers: AGATCTATGGGCCAAGAGGATCAGGAG/GCGGCCGCCTCCTTGCGTCGGGCCCGAAG, that incorporated EcoRI and NotI sites at the 5' and 3' ends, respectively. This fragment was cloned into pP{eYFP-UAST} using the EcoRI and NotI restriction sites to form plasmid pP{w–eYFP-UAST}. The insert was sequenced to check for PCR errors, and the plasmid injected into w– Drosophila embryos (w1118) by standard techniques (Vanedis Drosophila injections service, www.vanedis.no). Transformants were selected and maintained using standard Drosophila genetic techniques.
Fluid transport assays
Fluid transport assays were performed as previously described
(Dow et al., 1994b
) on intact
tubules from Canton S, w1118 and cantonised
w1118 7-day-old adult flies. Basal rates of fluid
transport were established for 30 min, after which 100 µmol
l–1 cGMP was added to tubules and fluid transport rates
measured for a further 60 min. Data are shown as mean fluid transport rates
± s.e.m., N=7.
Cyclic nucleotide transport assays
Transport assays for cGMP and cAMP were based on a modified fluid transport
assay; transport rates ratios were calculated as previously described
(Day et al., 2006
). The
transport rate provides a linear measure of basal to apical unidirectional
flux, whereas a secreted:bathing ratio of >1 indicates that the transport
substrate is being concentrated by the tubules
(Maddrell et al., 1974
).
Maximal rates of cGMP and cAMP transport occurred at 100 µmol
l–1 (Evans,
2007
); thus, all transport assays were conducted with a final
concentration of 100 µmol l–1 of cyclic nucleotide. The
maximal rates of transport of cAMP are significantly higher than that of cGMP:
a transport ratio of
5 at 100 µmol l–1 cAMP,
vs
3 for cGMP at 100 µmol l–1 cGMP.
Tubules were dissected into saline (Dow
et al., 1994a
) and allowed to recover for 30 min prior to addition
of cyclic nucleotides: `cold' cGMP or cAMP at 100 µmol
l–1, and tritiated cGMP or cAMP added as tracer (Amersham
Pharmacia, Biotech UK Ltd, Amersham, Bucks, UK). Where competitors or drugs
were included, these were added 30 min before the radiolabelled substrate.
Where the removal of amino acids and citrate was investigated, a minimal
Drosophila saline was used
(Linton and O'Donnell, 1999
)
to which the missing ingredients of Drosophila saline
(Dow et al., 1994a
) were
reintroduced at the concentrations normally used.
In all the transport assays, the ratio and rate of transport was measured 1
h after the radiolabelled cyclic nucleotide was added
(Evans, 2007
). The tubules
were allowed to secrete for 1 h before the secreted droplet was measured and
removed to Eppendorf tubes containing scintillation fluid (Fisher Scientific,
Loughborough, UK). A 1 µl sample of each reservoir droplet was also removed
and radioactivity measured in the scintillation counter (Beckman, High
Wycombe, UK).
cGMP-dependent kinase bioassay for secreted cGMP
In order to determine if unaltered cGMP is transported through the tubule
from the bathing droplet into the lumen, secreted fluid was tested for its
ability to stimulate cGMP-dependent protein kinase (cGK) activity in
vitro. A secretion assay was carried out with 80 tubules in the standard
bathing droplet of Drosophila saline/Schneiders' medium (control) or
saline/Schneiders' medium with 100 µmol l–1 cGMP. After
allowing the tubules to secrete for 1 h, secreted droplets were pooled (
2
ml in total), removed from the secretion assay dish and placed into an
Eppendorf tube. To remove any residual mineral oil derived from the secretion
assay, samples were centrifuged and the oil (top layer) was discarded. A cGK
assay was then carried out using the Drosophila cGK, DG2
(MacPherson et al., 2004
),
which had been expressed in S2 cells as a source of DG2 and therefore, cGK
activity (MacPherson et al.,
2004
). Standard kinase reactions were set up in a total volume of
44 µl with 5 µl of DG2 protein sample, 39 µl of kinase assay buffer
(MacPherson et al., 2004
) and
either 1 µl of secreted fluid from control samples or 1 µl of secreted
fluid from tubules incubated in 100 µmol l–1 cGMP.
Positive controls were set up by adding 1 µl of 100 µmol
l–1 cGMP (final concentration 2.2 mmol l–1)
to the assay mix as described above. Three separate experiments were performed
for each condition and the results expressed in pmol ATP
min–1 mg–1 protein (mean ±
s.e.m.).
Real-time quantitative PCR (Q-PCR)
Q-PCR was performed as described previously
(McGettigan et al., 2005
),
using mRNA prepared from tubules from 7-day-old adult Drosophila.
Where the effect of cGMP on gene expression was being investigated, tubules
were incubated with or without 100 µmol l–1 cGMP in
Schneider's medium for 3 h before the mRNA was extracted. Reverse
transcription was carried out using Superscript II (Invitrogen) using
oligo(dT) primers. For each sample, 500 ng of cDNA was added to 25 µl of
SYBR Green reaction mix (Finnzyme, Oy Espoo, Finland) with an appropriate
concentration of the primers – WhiteF: GCCACCAAAAATCTGGAGAAGC/WhiteR:
CACCCACTTGCGTGAGTTGTTG. Reactions were carried out in an Opticon 2
thermocycler (MJ Research Inc., Waltham, MA, USA). The ribosomal rp49
(rpl32) gene (primers rp49F: TGACCATCCGCCCAGCATAC/rp49R:
TTCTTGGAGGAGGACGCCGTG) was used as a reference standard in all experiments
(McGettigan et al., 2005
).
Immunocytochemistry
Immunocytochemistry on intact Malpighian tubules was carried out as
previously described (MacPherson et al.,
2001
). A mouse monoclonal primary anti-GFP antibody recognising
GFP variants (Zymed, Invitrogen Ltd) diluted 1:1000 in PAT [0.05% (v/v) Triton
X-100 and 0.5% (w/v) BSA in PBS with14 mmol l–1 NaCl, 0.2
mmol l–1 KCl, 1 mmol l–1
Na2HPO4 and 0.2 mmol l–1
KH2PO4, pH 7.4], was used; followed by addition of
secondary antibody, Alexa Fluor® 568-labelled anti-mouse IgG (Molecular
Probes, Invitrogen Ltd), diluted 1:500 in PAT. The nuclear stain
4',6-diamidino-2-phenylindole, dihydrochloride (DAPI) was applied to the
tubules for 1 min at 500 ng ml–1 in PBS. Samples were viewed
using a Zeiss 510 Meta confocal system and images processed using LMS image
software. All images were taken at the same gain and exposure.
| RESULTS |
|---|
|
|
|---|
|
Net transport of the tritium label does not of itself imply that cGMP is
transported unmodified by the tubule; for example, cGMP could be cleaved to
GMP by cellular phosphodiesterases. In mammals, cGMP is detected in unmodified
form in urine (Ashman et al.,
1963
). In Drosophila, cGMP uptake studies in tubule have
shown that
20% of total tubule cGMP remains in unmodified form
(Riegel et al., 1998
).
However, it can be expected that at least some unmodified cGMP is excreted by
the Drosophila tubule. Here we show that secreted fluid from the
tubule can significantly stimulate cGMP-dependent protein kinase (cGK)
activity (Fig. 2B).
Drosophila cGKs are high Km enzymes, requiring
cGMP in the micromolar range for activation
(MacPherson et al., 2004
).
Thus, although the stimulation of cGK activity by secreted tubule fluid does
not prove that all cGMP is transported in unmodified form, these data
strongly suggest that a significant amount of cGMP is secreted by the tubule
in unmodified form.
Distinct transport processes for cGMP and cAMP by Drosophila tubules; cAMP transport requires di- and tri-carboxylates
In order to determine if tubules transport cGMP via a common route
for cyclic nucleotides, or if cGMP transport was specific for that cyclic
nucleotide, competition assays were carried out for both cAMP and cGMP
transport in the presence of the competing cyclic nucleotide
(Fig. 3A). The results show
that for all concentrations of cyclic nucleotide tested, including the
saturating concentration of 100 µmol l–1, no statistically
significant effect on cyclic nucleotide transport was determined. This
strongly suggests that cAMP and cGMP are differentially transported by the
tubule.
|
Identification of cyclic nucleotide transporter families in Malpighian tubules
Putative cyclic nucleotide transporters have yet to be identified in
Drosophila Malpighian tubules. In this work, identification of
putative cGMP or cAMP transporters in the tubule was achieved by using several
different substrates and pharmaceutical drugs. As ABCG2 and ABCC4 transporters
have been shown to be involved in cyclic nucleotide transport in mammalian
cells, known substrates for these were tested
(Table 1).
|
Glibenclamide is a broad-specificity ABC transporter inhibitor.
Glibenclamide was previously shown to be a potent inhibitor of cGMP transport
in human erythrocyte membrane vesicles, with an IC50 of 2.8 µmol
l–1 (Klokouzas et al.,
2003
). Although glibenclamide has been shown to inhibit fluid
transport by Malpighian tubules, probably by virtue of its action on
inwardly-rectifying K+ channels
(Evans et al., 2005
),
application of glibenclamide to tubules at concentrations far too low to
affect fluid transport in tubules (Evans
et al., 2005
) potently inhibited both cGMP and cAMP transport in
tubules (Table 1). This
suggests that ABC transporters are involved, but does not indicate a specific
ABC sub-family. Thus, substrates specific for sub-families of the ABC
transporter class, ABCG and ABCC4, were tested for their effects on cyclic
nucleotide transport.
ABCG
To test the involvement of transporters of the sub-family ABCG, the known
pharmacological inhibitors methotrexate
(Volk and Schneider, 2003
) and
mitoxantrone (Doyle et al.,
1998
) were used. Methotrexate has been shown to inhibit cGMP
uptake by inside-out human erythrocyte membrane vesicles by 75% at 275 µmol
l–1 and by 100% at 375 µmol l–1
(Klokouzas et al., 2003
). In
Drosophila tubules, both cGMP and cAMP transport were both reduced at
high concentrations of methotrexate; this reduction became statistically
significant at a concentration of 4 mmol l–1. Although the
ABCG inhibitor mitoxantrone has not been shown to affect cGMP transport in
erythrocytes (Sundkvist et al.,
2002
), treatment of tubules with mitoxantrone did impact on cGMP
transport; at 20 µmol l–1 the ratio of cGMP transport by
tubules was reduced to 27% of that of untreated control tubules
(Table 1).
ABCC4
In mammalian renal cells, cGMP is transported by ABCC4
(van Aubel et al., 2002
); and
is potently inhibited by dipyridamole at a concentration of 1.0 µmol
l–1. In Drosophila Malpighian tubules, dipyridamole
did not affect the transport of cGMP (Table
1). ABCC4-associated cAMP transport occurs in mammals
(van Aubel et al., 2002
), and
cAMP-induced inhibition of cGMP transport has been shown to occur at 50
µmol l–1 cAMP. However, this is not the case in
Drosophila tubules because application of cAMP at concentrations
between 1–100 µmol l–1 does not significantly affect
cGMP transport (Table 1).
Furthermore, cGMP treatment did not significantly inhibit cAMP transport
(Table 1). This suggests that
ABCC4-like transporters are not involved in cyclic nucleotide transport in the
tubules and that cAMP and cGMP transport do not occur via the same
transporter.
The Malpighian tubules are the major site of w expression in the fly
white (w) is famously associated with eye colour in
Drosophila but also has phenotypic effects in the tubule
(Fig. 1). Recently, a
comprehensive tissue-based microarray dataset
(FlyAtlas.org)
has become available for adult Drosophila tissues
(Chintapalli et al., 2007
),
allowing sites of gene expression to be determined easily `in silico'.
FlyAtlas expression data reveal that w expression is highest in
tubules (up by 40x compared with the whole fly), and in relation to
other adult tissue in the fly, including the head, which contain the eyes.
Furthermore, expression of w is very high in larval tubules
(56x) compared to whole adults (Table
2). The larval fat body also shows significant expression of
w.
|
One of the roles of insect Malpighian tubules is the secretion of fluid in the maintenance of homeostasis. Given the very high levels of w expression in tubules, investigation of fluid transport rate by wild-type and w mutant (w1118, both extant and cantonised stocks) tubules was carried out. This revealed no significant difference in either basal fluid transport rates, or rates stimulated by cGMP, between these tubules (Fig. 4A). Thus, w is not directly involved in fluid transport by the tubule.
|
White modulates cGMP transport
w is an orthologue of members of the ABCG family of genes, with
closest similarity to ABCG2
(Mackenzie et al., 1999
).
Given that data in Table 1 show
a significant effect on cGMP transport by ABCG inhibitors, and that the
w gene product is an ABCG2 family member, which is very highly
expressed in the tubule, we tested the hypotheses that White acts as a cGMP
transporter in the tubule. To initiate these studies, potential substrates of
White, including tryptophan, kynurenine and 3-hydroxykynurenine
(Howells et al., 1977
;
Sullivan et al., 1980
) were
utilised in the cGMP transport competition assays
(Table 3). At high
concentrations, kynurenine inhibited both cGMP and cAMP transport
(Table 3), but tryptophan did
not. The mechanism of kynurenine inhibition on cAMP/cGMP transport is unknown.
Kynurenine is a large, anionic molecule and may competitively block transport
of either cGMP or cAMP. It is also possible that in addition to inhibition of
White (and therefore of cGMP transport), a transporter for cAMP is inhibited
by kynurenine. Tubule-specific microarray experiments have demonstrated high
enrichment of genes encoding monocarboxylic acid transporters, including
CG12286 (Wang et al.,
2004
), which we argued corresponds to karmoisin
(http://flybase.bio.indiana.edu/reports/FBgn0001296.html),
a probable kynurenine tranporter. Thus, given the requirement for di- and
tri-carboxylates for cAMP transport by tubules, it is possible that the
CG12286-encoded transporter also transports cAMP; and that this
transport of cAMP is inhibited when kynurenine is added exogenously to
tubules, thus explaining the data in Table
3. The concentrations of tryptophan and kynurenine used did not
affect fluid transport rates by the tubules (data not shown).
Hydroxykynurenine was not tested because it is insoluble in aqueous solutions
and so could not be added to conventional assays.
|
As w is most abundantly expressed in the tubule, and as substrates for White inhibit cGMP transport by the tubule, cGMP transport in tubules of White mutants was investigated. Such transport assays showed that transport of cGMP was inhibited in tubules from flies that were mutant for w (loss-of-function w1118), although cAMP flux was unaffected (Fig. 4B). Furthermore, the ratio of cGMP transport was approximately one, indicating markedly reduced active transport of cGMP. The inhibition of cGMP transport observed in the w1118 tubules was not due to genetic modifiers accumulated by this line, as tubules from `cantonized' w mutants (w1118 and wH) also showed reduced cGMP transport (Fig. 4C). This demonstrates that cGMP transport is directly associated with functional White.
Overexpression of w rescues the cGMP transport defect in white mutants
Most transgenic Drosophila lines are generated in a
w– background, eg. w1118.
Generation of the w::eYFP lines in such a background thus allows not
only for overexpression of w but also for rescue of the
white phenotype upon targeted overexpression. For these studies,
several independently generated w::eYFP lines were used, in
conjunction with the tubule principal cell-specific GAL4 driver, c42
(Broderick et al., 2004
). Q-PCR
data for expression of w in tubules of c42/w::eYFP(D4) and
c42/w::eYFP(E5) compared to parental UAS-w::eYFP lines shows
between 15-fold [c42/w::eYFP(D4)] and 1.3-fold
[c42/w::eYFP(E5)] overexpression compared with parental lines
(Evans, 2007
). Thus,
expression levels of w are significantly increased upon induction
with GAL4 in tubules from these lines.
Furthermore, targeted overexpression of w to tubule principal cells resulted in a cGMP transport ratio significantly greater than that observed in tubules from the parental UAS-w::eYFP lines (Fig. 4D); and compared to w1118 (Fig. 4C). Taken together, these data thus establish a direct role of White in cGMP transport in Drosophila tubules.
Exogenous cGMP upregulates expression of white
Is transport of cGMP by White incidental to its role in transport of eye
pigment precursors, or is White-associated cGMP transport physiologically
relevant? In order to test this, possible feedback effects of cGMP on
w expression were investigated: does an increase in cGMP levels
upregulate its expression, so increasing cGMP clearance? Real-time PCR of
w expression was assessed in control, untreated tubules and in
tubules treated with exogenous cGMP for 3 h. In the cGMP-treated tubules,
w expression increased significantly by 3.8±0.92 fold (Q-PCR
data, Fig. 4E). Thus, the
cGMP-induced increase in w expression supports a role for White in
cGMP transport.
Localisation of White in adult tubules
In the Drosophila eye, White has been identified in the pigment
granule membrane (Mackenzie et al.,
2000
). In order to resolve the localisation of White in tubules,
targeted expression of the w::eYFP fusion was driven in tubules using
the principal cell-specific GAL4 driver c42. Whilst the fluorescence emitted
by eYFP would be expected to be indicative of the expression pattern of White,
immunocytochemistry against eYFP using an anti-GFP antibody that recognises
GFP derivatives was performed in order to amplify the signal, and to reduce
the impact of autofluorescence by the tubule. Results from these experiments
in two independently derived UAS-w::eYFP lines show that White is
expressed in the cytoplasm of the principal cells
(Fig. 5A, B). Closer inspection
reveals vesicular expression of White in the cytoplasm of principal cells
(Fig. 5D, compare to
autofluorescence in Canton S tubules, Fig.
5C). Thus, given that White is required for cGMP transport by the
tubule, its localisation suggests that trafficking of cGMP can occur through
the cell via intracellular vesicles.
|
| DISCUSSION |
|---|
|
|
|---|
The primarily vesicular localisation of White may also indicate trafficking
of cGMP across the Malpighian tubules in vesicles, a novel mechanism of
transepithelial cGMP transport that would not compromise the integrity of
intracellular cGMP signalling pathways. This would explain why fluid transport
assays on tubules from w loss-of-function mutants show similar rates
of cGMP-induced fluid transport (Davies et
al., 1995
; Dow et al.,
1994b
) to wild-type tubules. Our model is thus that cGMP is
transported into the cell by a basolateral plasma membrane cGMP transporter
that still remains to be discovered; once in the cell, it can act to stimulate
fluid transport. However, White sequesters cGMP into vesicles, contributing
[perhaps together with the action of DmPDE6
(Day et al., 2006
)] to its
clearance from the cell; and these vesicles are excreted from the apical
surface of the cell, presumably as part of a general purpose organic solute
clearance mechanism. In the absence of White, cGMP is still transported into
cells but due to reduced uptake into intracellular vesicles, is transported
into the lumen at a much reduced rate. It will be interesting in due course to
try to identify the plasma membrane transporter for cGMP. Importantly, this
multi-stage transport model explains why we were unable to demonstrate
accumulation of cGMP beyond Nernst-predicted ratios, despite the involvement
of a transport ATPase in the process.
Although the w gene has almost exclusively been researched in
association with its role as an eye colour marker, recent microarray data of
adult fly tissues (Chintapalli et al.,
2007
) has shown that w is most highly expressed in
Malpighian tubule, a tissue enriched for organic anion transporters
(Wang et al., 2004
). Previous
studies have shown that White can act as a heteromeric transporter: with
Scarlet, it is a tryptophan transporter, responsible for brown eye colour;
with Brown, it transports guanine, the precursor of the red pigment in eye
(Dreesen et al., 1988
).
Mutation of key residues such as glycine 589 in the fifth transmembrane helix
of White, significantly reduces guanine transport by White–Brown
heterodimers, suggesting the importance of G589 in heterodimerisation and in
guanine transport (Mackenzie et al.,
1999
). Interestingly, mutation of amino acid 553 in TM5 of ABCG2
– a well-conserved residue corresponding to G589 in White –
disrupts function and trafficking of ABCG2, implying conservation of
dimerisation function of these residues across evolution
(Polgar et al., 2006
).
Other candidates for cGMP transporters
Even if White does play a key role in cGMP transport, organic solute
transporters are heavily represented in the tubule transcriptome
(Wang et al., 2004
), and so
there are other potential candidate transporters. In mammals, transporters of
the ABCC class, notably MRP4 (ABCC4) and MRP5 (ABCC5) have been shown to
transport cyclic nucleotides out of the cell
(Ritter et al., 2005
).
Treatment of Drosophila tubules with glibenclamide, a broad-spectrum
inhibitor of ABC transporters, results in inhibition of both cAMP and cGMP
transport. However, utilising either known inhibitors or competing substrates
for ABBC transporters shows that such transporters are not involved in
cAMP/cGMP transport by Malpighian tubules. Interestingly, tubules express five
of the seven Drosophila homologues of mammalian ABCC transporters
(Day et al., 2006
); with one
gene, CG9270, being expressed only in tubules of the adult
fly. It would be interesting to screen the product of this gene for ABCC
transporter function, and to determine its substrate specificity. In any case,
the lack of effect of ABCC-specific drugs on the tubule could indicate
evolutionary divergence between mammalian and Drosophila ABCC
transporters, or may simply reflect inaccessibility of these transporters to
specific drugs if the transporters are localised to the apical membrane.
Differences between cAMP and cGMP transport
We show that cGMP transport by the tubule is specific and possesses
distinct properties from cAMP transport. Previous investigations have
suggested that there may be some overlapping function of cyclic nucleotide
transporters (Riegel et al.,
1998
). The different conclusions reached by these different
studies may be a reflection of the concentration of each cyclic nucleotide
used – the competing cyclic nucleotide was greatly in excess in the
Riegel study. We show here that cAMP transport requires the presence of di- or
tri-carboxylates; but that cGMP transport is unaffected by these compounds.
cAMP transport probably requires an OAT-like transporter at the basolateral
membrane, whereas cGMP is transported via a different mechanism. Thus
in the tubules, the mechanisms of transport of cGMP and cAMP are largely
independent and specific. This could reflect the importance of these
signalling molecules in the tubules. Alternatively, it could reflect the
transport mechanisms necessary in a tissue for which there is a requirement
for an established potential gradient to enable solute uptake and
excretion.
Overall, though, the results suggest that the extraordinary abundance of White in the adult Malpighian tubule may reflect a novel role that continues beyond the need to handle visual pigment precursors in the larva and pupa. White is thus a more versatile transport protein that previously suspected.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Ashman, D. F., Lipton, R., Melicow, M. M. and Price, T. D. (1963). Isolation of adenosine 3', 5'-monophosphate and guanosine 3', 5'-monophosphate from rat urine. Biochem. Biophys. Res. Commun. 11,330 -334.[CrossRef][Medline]
Broderick, K. E., Kean, L., Dow, J. A. T., Pyne, N. J. and
Davies, S. A. (2004). Ectopic expression of bovine type 5
phosphodiesterase confers a renal phenotype in Drosophila. J. Biol.
Chem. 279,8159
-8168.
Cabrero, P., Radford, J. C., Broderick, K. E., Veenstra, J.,
Spana, E., Davies, S. and Dow, J. A. T. (2002). The CRF gene
of Drosophila melanogaster encodes a diuretic peptide that activates
cAMP signalling. J. Exp. Biol.
205,3799
-3807.
Castanys-Munoz, E., Alder-Baerens, N., Pomorski, T., Gamarro, F. and Castanys, S. (2007). A novel ATP-binding cassette transporter from Leishmania is involved in transport of phosphatidylcholine analogues and resistance to alkyl-phospholipids. Mol. Microbiol. 64,1141 -1153.[CrossRef][Medline]
Chintapalli, V. R., Wang, J. and Dow, J. A. (2007). Using FlyAtlas to identify better Drosophila melanogaster models of human disease. Nat. Genet. 39,715 -720.[CrossRef][Medline]
Coast, G. M., Webster, S. G., Schegg, K. M., Tobe, S. S. and Schooley, D. A. (2001). The Drosophila melanogaster homologue of an insect calcitonin-like diuretic peptide stimulates V-ATPase activity in fruit fly Malpighian tubules. J. Exp. Biol. 204,1795 -1804.[Abstract]
Davies, S. A., Huesmann, G. R., Maddrell, S. H. P., O'Donnell, M. J., Skaer, N. J. V., Dow, J. A. T. and Tublitz, N. J. (1995). CAP2b, a cardioacceleratory peptide, is present in Drosophila and stimulates tubule fluid secretion via cGMP. Am. J. Physiol. 269,R1321 -R1326.[Medline]
Day, J. P., Houslay, M. D. and Davies, S. A. (2006). A novel role for a Drosophila homologue of cGMP-specific phosphodiesterase in the active transport of cGMP. Biochem. J. 393,481 -488.[CrossRef][Medline]
Dazert, P., Meissner, K., Vogelgesang, S., Heydrich, B., Eckel,
L., Bohm, M., Warzok, R., Kerb, R., Brinkmann, U., Schaeffeler, E. et al.
(2003). Expression and localization of the multidrug resistance
protein 5 (MRP5/ABCC5), a cellular export pump for cyclic nucleotides, in
human heart. Am. J. Pathol.
163,1567
-1577.
Dow, J. A. T. and Davies, S. A. (2003).
Integrative physiology, functional genomics and epithelial function in a
genetic model organism. Physiol. Rev.
83,687
-729.
Dow, J. A. and Davies, S. A. (2005). The Malpighian tubule: rapid insights from post-genomic biology. J. Insect Physiol. 52,365 -378.[CrossRef][Medline]
Dow, J. A., Maddrell, S. H., Gortz, A., Skaer, N. J., Brogan, S. and Kaiser, K. (1994a). The Malpighian tubules of Drosophila melanogaster: a novel phenotype for studies of fluid secretion and its control. J. Exp. Biol. 197,421 -428.[Abstract]
Dow, J. A. T., Maddrell, S. H., Davies, S. A., Skaer, N. J. and Kaiser, K. (1994b). A novel role for the nitric oxide-cGMP signaling pathway: the control of epithelial function in Drosophila.Am. J. Physiol. 266,R1716 -R1719.[Medline]
Doyle, L., Yang, W., Abruzzo, L., Krogmann, T., Gao, Y., Rishi,
A. and Ross, D. (1998). A multidrug resistance transporter
from human MCF-7 breast cancer cells. Proc. Natl. Acad. Sci.
USA 95,15665
-15670.
Dreesen, T., Johnson, D. and Henikoff, S.
(1988). The brown protein of Drosophila melanogaster is
similar to the white protein and to components of active transport complexes.
Mol. Cell. Biol. 8,5206
-5215.
Evans, J. (2007). From microarrays to renal transporter function in Drosophila melanogaster Malpighian tubules. PhD thesis, University of Glasgow, UK.
Evans, J. M., Allan, A. K., Davies, S. A. and Dow, J. A.
(2005). Sulphonylurea sensitivity and enriched expression
implicate inward rectifier K+ channels in Drosophila
melanogaster renal function. J. Exp. Biol.
208,3771
-3783.
Howells, A., Summers, K. and Ryall, R. (1977). Developmental patterns of 3-hydroxykynurenine accumulation in white and various other eye color mutants of Drosophila melanogaster.Biochem. Genet. 15,1049 -1059.[CrossRef][Medline]
Jedlitschky, G., Tirschmann, K., Lubenow, L. E., Nieuwenhuis, H.
K., Akkerman, J. W., Greinacher, A. and Kroemer, H. K.
(2004). The nucleotide transporter MRP4 (ABCC4) is highly
expressed in human platelets and present in dense granules, indicating a role
in mediator storage. Blood
104,3603
-3610.
Klokouzas, A., Wu, C., van Veen, H., Barrand, M. and Hladky, S. (2003). cGMP and glutathione-conjugate transport in human erythrocytes. Eur. J. Biochem. 270,3696 -3708.[Medline]
Koepsell, H. (2004). Polyspecific organic cation transporters: their functions and interactions with drugs. Trends Pharmacol. Sci. 25,375 -381.[CrossRef][Medline]
Linton, S. and O'Donnell, M. (1999). Contributions of K+:Cl– cotransport and Na+/K+-ATPase to basolateral ion transport in Malpighian tubules of Drosophila melanogaster. J. Exp. Biol. 202,1561 -1570.[Abstract]
Mackenzie, S., Brooker, M., Gill, T., Cox, G., Howells, A. and Ewart, G. (1999). Mutations in the white gene of Drosophila melanogaster affecting ABC transporters that determine eye colouration. Biochem. Biophys. Acta 1419,173 -185.[Medline]
Mackenzie, S., Howells, A., Cox, G. and Ewart, G. (2000). Sub-cellular localisation of the white/scarlet ABC transporter to pigment granule membranes within the compound eye of Drosophila melanogaster. Genetica 108,239 -252.[CrossRef][Medline]
MacPherson, M. R., Pollock, V. P., Broderick, K. B., Kean, L., O'Connell, F. C., Dow, J. A. T. and Davies, S.-A. (2001). Model organisms: new insights into ion channel and transporter function: L-type calcium channels regulate epithelial fluid transport in Drosophila melanogaster. Am. J. Physiol. 280,C394 -C407.
MacPherson, M. R., Lohmann, S. M. and Davies, S. A.
(2004). Analysis of Drosophila cGMP-dependent protein
kinases and assessment of their in vivo roles by targeted expression
in a renal transporting epithelium. J. Biol. Chem.
279,40026
-40034.
Maddrell, S. H. P., Gardiner, B. O. C., Pilcher, D. E. M. and
Reynolds, S. E. (1974). Active transport by insect Malpighian
tubules of acidic dyes and of acylamides. J. Exp.
Biol. 61,357
-377.
McGettigan, J., McLennan, R. K., Broderick, K. E., Kean, L., Allan, A. K., Cabrero, P., Regulski, M. R., Pollock, V. P., Gould, G. W., Davies, S. A. et al. (2005). Insect renal tubules constitute a cell-autonomous immune system that protects the organism against bacterial infection. Insect Biochem. Mol. Biol. 35,741 -754.[CrossRef][Medline]
Morgan, T. H. (1910). Sex limited inheritance
in Drosophila. Science
32,120
-122.
O'Donnell, M. J., Dow, J. A. T., Huesmann, G. R., Tublitz, N. J. and Maddrell, S. H. P. (1996). Separate control of anion and cation transport in Malpighian tubules of Drosophila melanogaster.J. Exp. Biol. 199,1163 -1175.[Abstract]
Polgar, O., Ozvegy-Laczka, C., Robey, R., Morisaki, K., Okada, M., Tamaki, A., Koblos, G., Elkind, N., Ward, Y., Dean, M. et al. (2006). Mutational studies of G553 in TM5 of ABCG2: a residue potentially involved in dimerization. Biochemistry 45,5251 -5260.[CrossRef][Medline]
Pollock, V. P., McGettigan, J., Cabrero, P., Maudlin, I. M.,
Dow, J. A. and Davies, S. A. (2004). Conservation of capa
peptide-induced nitric oxide signalling in Diptera. J. Exp.
Biol. 207,4135
-4145.
Riegel, J. A., Maddrell, S. H., Farndale, R. W. and Caldwell, F. M. (1998). Stimulation of fluid secretion of malpighian tubules of Drosophila melanogaster Meig. by cyclic nucleotides of inosine, cytidine, thymidine and uridine. J. Exp. Biol. 201,3411 -3418.[Abstract]
Ritter, C. A., Jedlitschky, G., Meyer zu Schwabedissen, H., Grube, M., Kock, K. and Kroemer, H. K. (2005). Cellular export of drugs and signaling molecules by the ATP-binding cassette transporters MRP4 (ABCC4) and MRP5 (ABCC5). Drug Metab. Rev. 37,253 -278.[CrossRef][Medline]
Sekine, T., Cha, S. and Endou, H. (2000). The multispecific organic anion transporter (OAT) family. Pflugers Arch. 440,337 -350.[CrossRef][Medline]
Shulenin, S., Schriml, L. M., Remaley, A. T., Fojo, S., Brewer, B., Allikmets, R. and Dean, M. (2001). An ATP-binding cassette gene (ABCG5) from the ABCG (White) gene subfamily maps to human chromosome 2p21 in the region of the Sitosterolemia locus. Cytogenet. Cell Genet. 92,204 -208.[CrossRef][Medline]
Sullivan, D. and Sullivan, M. (1975). Transport defects as the physiological basis for eye color mutants of Drosophila melanogaster. Biochem. Genet. 13,603 -613.[CrossRef][Medline]
Sullivan, D., Bell, L., Paton, D. and Sullivan, M. C. (1979). Purine transport by malpighian tubules of pteridine-deficient eye color mutants of Drosophila melanogaster.Biochem. Genet. 17,565 -573.[CrossRef][Medline]
Sullivan, D., Bell, L., Paton, D. and Sullivan, M. C. (1980). Genetic and functional analysis of tryptophan transport in Malpighian tubules of Drosophila. Biochem. Genet. 18,1109 -1130.[CrossRef][Medline]
Sundkvist, E., Jaeger, R. and Sager, G. (2002). Pharmacological characterization of the ATP-dependent low K(m) guanosine 3',5'-cyclic monophosphate (cGMP) transporter in human erythrocytes. Biochem. Pharmacol. 63,945 -949.[CrossRef][Medline]
van Aubel, R., Smeets, P., Peters, J., Bindels, R. and Russel,
F. (2002). The MRP4/ABCC4 gene encodes a novel apical organic
anion transporter in human kidney proximal tubules: putative efflux pump for
urinary cAMP and cGMP. J. Am. Soc. Nephrol.
13,595
-603.
Volk, E. and Schneider, E. (2003). Wild-type
breast cancer resistance protein (BCRP/ABCG2) is a methotrexate polyglutamate
transporter. Cancer Res.
63,5538
-5543.
Wang, J., Kean, L., Yang, J., Allan, A. K., Davies, S. A., Herzyk, P. and Dow, J. A. (2004). Function-informed transcriptome analysis of Drosophila renal tubule. Genome Biol. 5,R69 .[CrossRef][Medline]
Wessing, A. and Eichelberg, D. (1968). Fluorescing substances from the Malpighian tubules of wild-type and various eye color mutants of Drosophila melanogaster. Z. Naturforsch. B 23,376 -386.[Medline]
Wessing, A. and Eichelberg, D. (1978). Malpighian tubules, rectal papillae and excretion. In The Genetics and Biology of Drosophila. Vol. 2c (ed. A. Ashburner and T. R. F. Wright), pp. 1-42. London: Academic Press.
Zachar, Z. and Bingham, P. M. (1982). Regulation of white locus expression: the structure of mutant alleles at the white locus of Drosophila melanogaster. Cell 30,529 -541.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
S. R. Singh and S. X. Hou Multipotent stem cells in the Malpighian tubules of adult Drosophila melanogaster J. Exp. Biol., February 1, 2009; 212(3): 413 - 423. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. T. Dow Insights into the Malpighian tubule from functional genomics J. Exp. Biol., February 1, 2009; 212(3): 435 - 445. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||