|
| |
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online February 15, 2008
Journal of Experimental Biology 211, 709-716 (2008)
Published by The Company of Biologists 2008
doi: 10.1242/jeb.014159
Malvolio is a copper transporter in Drosophila melanogaster
1 Department of Genetics, The University of Melbourne, Victoria 3010,
Australia
2 School of Biological Sciences, Monash University, Victoria 3800,
Australia
* Author for correspondence (e-mail: j.camakaris{at}unimelb.edu.au)
Accepted 31 December 2007
 |
Summary |
|---|
 TOP Summary INTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONReferences |
|---|
Key words: Malvolio, Drosophila melanogaster, S2 cells, copper, DMT1, pigmentation
|
INTRODUCTION |
|---|
|
TOPSummaryINTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONReferences |
|---|
). Mechanisms for uptake, distribution, sequestration and
efflux of Cu are well conserved among yeast, insect and mammalian systems
(Camakaris et al., 1999). The
Ctr family are the best characterised Cu uptake proteins, with Drosophila
melanogaster having three, designated Ctr1A, B and C. In vivo
and in vitro studies have demonstrated Ctr1A and Ctr1B are functional
Cu transporters with different tissue and life stage expression profiles
(Southon et al., 2004;
Turski and Thiele, 2007;
Zhou et al., 2003). Although
human CTR1 (also known as SLC31A1 – HUGO) has traditionally been seen as
the primary Cu uptake mechanism in gut epithelium, a recent study by Zimnicka
et al. (Zimnicka et al., 2007)
has found endogenous CTR1 to be localised to the basolateral surface of
cultured intestinal and kidney cells, rather than the apical membrane,
suggesting CTR1 may not be responsible for dietary Cu absorption. Divalent
metal ion transporter 1 (DMT1; also known as SLC11A2 – HUGO, and
Nramp2), which is capable of transporting Fe2+, Mn2+,
Cu2+, Zn2+, Cd2+ and Pb2+
(Gunshin et al., 1997) may
also contribute to Cu uptake. DMT1 is expressed in multiple mammalian tissues,
whereas its paralogue Nramp1 (SLC11A1) is expressed in macrophages
(Gunshin et al., 1997;
Vidal et al., 1995) as well as
dendrites (Stober et al.,
2007) and tertiary granules of neutrophils
(Canonne-Hergaux and Gros,
2002). The DMT1 family is evolutionarily conserved, with
orthologues in several species including mouse, rat and yeast
(Cellier et al., 1995).
Although DMT1 is clearly a symporter that transports divalent cations across
the plasma or endosomal membranes into the cytoplasm
(Gunshin et al., 1997;
Touret et al., 2003) the
direction of Nramp1 transport is less clear, with some authors suggesting it
is an antiporter, exporting divalent cations from the cytoplasm
(Eichner Techau et al., 2007;
Goswami et al., 2001). Eichner
Techau et al. (Eichner Techau et al.,
2007) propose that symporter activity was the ancestral function
of this family and that following the gene duplication antiporter activity
evolved for Nramp1.
Malvolio (Mvl) is the only member of the DMT1 family in
the Drosophila genome and is orthologous to the human proteins NRAMP1
(54.9% identity) and DMT1 (57.4%) (Cellier
et al., 1995). Mvl was identified in a screen for mutants
that affect taste behaviour (Rodrigues et
al., 1995). A P-element induced partial loss-of-function mutant
(Mvl97f) causes flies to lose preference for
sugar-supplemented medium. Rearing these flies on medium supplemented with
Mn2+ or Fe2+ corrected this defect, whereas
Ca2+, Mg2+ or Zn2+ did not, suggesting
Mvl97f flies may have a Mn2+ or Fe2+
deficiency (Orgad et al.,
1998). Recently, Folwell et al.
(Folwell et al., 2006)
examined Mvl localisation in Drosophila. Protein expression was
detected in larval Malpighian tubules, testis and brain, in the amnioserosa of
embryos and in the larval and adult alimentary canal, with intracellular
localisation that was either punctate, cytoplasmic or at the plasma membrane.
The authors concluded that Mvl must fulfil the roles of both Nramp1 and DMT1
given its distribution, however, metal homeostasis was not examined. Mvl, like
DMT1, was recently shown to be a cation symporter
(Eichner Techau et al., 2007),
however it is still unclear if Mvl is a Cu transporter.
The model organism Drosophila melanogaster has recently been used
to enhance our understanding of several aspects of Cu homeostasis including:
Cu uptake by the Ctr family (Turski and
Thiele, 2007; Zhou et al.,
2003); Cu sequestration through the metallothionein (Mtn) system
(Balamurugan et al., 2007;
Egli et al., 2003;
Selvaraj et al., 2005); and Cu
efflux via ATP7 (Norgate et al.,
2006). We now use this system, together with the
Drosophila embryonic cell line S2, to demonstrate that Mvl is a
functional Cu transporter, necessary for optimal Cu uptake and
distribution.
|
MATERIALS AND METHODS |
|---|
|
TOPSummaryINTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONReferences |
|---|
). To
test for genetic interactions with ATP7, UAS-Mvl and
Mvl97f (Bloomington Stock # 5151, a viable P-element
insertion mutation of Mvl) homozygous flies were crossed to
pnr-Gal, UAS-ATP7/TM3,Sb flies and progeny examined. All
flies were raised on standard Drosophila food medium containing
approximately 5–10 µmol l–1 Cu.
Cell culture
S2 cells were propagated in Drosophila serum free medium (SFM,
Invitrogen) as previously reported
(Southon et al., 2004). Cu was
added to SFM as CuCl2 at the concentration specified in the
results. 10 µmol l–1 Diamsar was added to SFM to deplete
intracellular Cu as previously reported
(Bellingham et al., 2004;
Norgate et al., 2007). Mvl
dsRNA was derived from Mvl cDNA bases 786–1251 and control
dsRNA was derived from EYFP cDNA. dsRNA interference (dsRNAi) knockdown was
conducted as previously reported (Southon
et al., 2004; Worby et al.,
2001). S2 cells maintaining stable overexpression of Mvl
(55–60% of cells) were generated by co-transfecting pCoHygro with either
pAcMvl or pAc empty vector control using Lipofectamine 2000 and cells were
propagated in Schneider's Complete Medium (Invitrogen) with 10% foetal calf
serum (Trace Scientific, Melbourne, Vic, Australia) supplemented with 300
µg ml–1 hygromycin B according to the manufacturer's
instructions (Invitrogen). This medium was replaced with SFM for all
experiments.
Gene and protein expression analysis
Total RNA for gene expression was extracted using the RNeasy kit (Qiagen,
Doncaster, Victoria, Australia) and cDNA was transcribed using AMV reverse
transcriptase (Promega, Annandale, NSW, Australia) as previously described
(Southon et al., 2004).
Primers for real-time PCR were designed using Primer3 software
(Rozen and Skaletsky, 2000).
Mvl forward and reverse primer sequences were: GCACCACCAGCAGATACTCA,
and CCACAGCAAGACCCACAA, respectively. Actin 42A was used as a
housekeeping gene and primer sequences have been described elsewhere
(Southon et al., 2004).
Real-time PCR was performed using the Rotor Gene 3000 (Corbett Research,
Mortlake, NSW, Australia) using QuantiTect SYBR Green PCR Master Mix (Qiagen,
Doncaster, Vic, Australia) and analysed as previously described
(Southon et al., 2004).
Protein samples for western blotting were prepared from S2 cells with a
lysis buffer containing: 1% Triton X-100, 20 mmol l–1
Tris–HCl (pH 7.5), 150 mmol l–1 NaCl, 2 mmol
l–1 EDTA and 10% glycerol (Sigma, Castle Hill, NSW,
Australia) with protease inhibitor cocktail added (Roche Diagnostics,
Mannheim, Germany). Samples were lysed on ice for 2 h before clearing lysate
by centrifugation. Protein (40 µg) was run on NuPAGE 4–12%
Bis–Tris gels (Invitrogen), transferred to nitrocellulose membranes and
probed with monoclonal mouse anti-FLAG antibody (1:2000, KM5–1C7 Walter
and Eliza Hall Institute Biotechnology Centre, Melbourne, Vic, Australia) and
polyclonal rabbit anti-mouse horseradish peroxidase coupled secondary antibody
(1:7000, Dako, Glostrup, Denmark). Monoclonal mouse anti-
-tubulin was
used as a loading control (Sigma).
Microscopy
Immunofluorescent detection of Mvl in S2 cells utilised a monoclonal mouse
anti-FLAG antibody (1:200) and Alexa Fluor 488 anti-mouse secondary antibody
(1:400, Invitrogen). DAPI (300 nmol l–1; Invitrogen, Mount
Waverly, Vic, Australia) was used to detect the nucleus. Images were recorded
at 100x magnification using an Olympus FluoView 1000 confocal microscope
with Olympus FluoView ver1.6a software (Olympus, Center Valley, PA, USA) and
single sections are shown. An MtnA-EYFP reporter (provided by Prof. W.
Schaffner, Institute of Molecular Biology, University of Zurich, Zurich,
Switzerland) was used as a proxy measure of Cu distribution in dissected third
instar larvae as previously described
(Norgate et al., 2006;
Selvaraj et al., 2005).
Mvl97f and w1118 larval tissues were
examined at 15x magnification (60x for higher magnification
images) using the Olympus SZX12 dissecting microscope. Images were captured
using the Olympus DP controller software using identical exposure settings
(0.1 s exposure time). Twelve larvae (24 for basal food) were examined for
each condition. Images of adult Drosophila were also recorded using
this system. Representative images are shown.
S2 cell copper accumulation and cell viability assays
64Cu accumulation experiments were conducted as previously
reported (Camakaris et al.,
1995; Southon et al.,
2004). Briefly cells were incubated with approximately 0.4 MBq
64Cu (Australian Radioisotopes, Lucas Heights, NSW, Australia) and
2 µmol l–1 non-radioactive Cu for 1 or 24 h. Cu
accumulation was stopped by washing cells four times with 1 ml cold Hank's
balanced salt solution containing 1 mmol l–1 histidine
(Sigma). Cells were then lysed in 100 µl of 0.1% SDS, containing 2 mmol
l–1 EDTA. Radioactivity was measured with a 
-counter
(1282 CompuGamma, LKB Wallac, Turku, Finland) and Cu levels were standardised
to total cellular protein, which was determined using Bio-Rad protein reagent
according to the manufacturer's instructions (Bio-Rad, Gladesville, NSW,
Australia). Cell viability following Cu chelation was determined by cell
counting with a haemocytometer and Trypan Blue (Sigma) staining of dead
cells.
Drosophila metal accumulation and survival assays
Five replicates of 50 Drosophila where digested in 70%
HNO3 for 3 days at room temperature, with an additional 12 h at
60°C and then diluted to a final concentration of 10% HNO3 with
dH2O. Metal levels were measured using a Vista-AX inductively
coupled plasma atomic emission spectrometer (ICP-AES; Varian, Palo Alto, CA,
USA). Five reading at 327.395 and 327.754 nmol l–1 were
averaged to give one value per biological replicate and expressed relative to
the number of flies (ng/fly). A previous experiment showed no difference
between normalisation of metal levels to either the number of flies or wet
mass (data not shown).
Larval survival to adulthood was determined as reported previously
(Norgate et al., 2007).
Briefly, five replicates of 50 first instar larvae were scored for survival to
adulthood on basal food (5–10 µmol l–1 Cu) and 1 and
2 mmol l–1 CuSO4 (Sigma) as well as 100 µmol
l–1 bathocuproinedisulfonic acid (BCS; Sigma) to limit
available Cu. Survival of Mvl97f was compared to that of
wild-type Armenia and w1118 control
Drosophila.
Statistics
Statistical analysis was conducted using SPSS v11 (SPSS, Chicago, IL, USA).
A one-sample Kolomogorov-Smirinov test was used to assess whether data was
normally distributed. Statistical analyses are described in figure
legends. P<0.05 was deemed statistically significant.
|
RESULTS AND DISCUSSION |
|---|
|
TOPSummaryINTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONReferences |
|---|
). No
significant signal was visible in lysate from cells expressing an empty vector
control (pAc). Immunofluorescent confocal microscopy clearly demonstrated Mvl
was localised to the plasma membrane of pAcMvl cells, with additional large
punctate staining (Fig. 1B),
whereas no significant staining was detected in pAc cells
(Fig. 1C). Mvl localisation was
not affected by either 24 h Cu limitation or 2.5 h exposure to 0.8 mmol
l–1 Cu (data not shown). The cellular localisation of Mvl is
consistent with that seen in vivo with larval and adult
Drosophila (Folwell et al.,
2006) and is also similar to that of DMT1 in mammalian cells. DMT1
is localised to the apical membrane of mammalian intestinal and kidney cells
where it is involved in Fe uptake and reabsorption, respectively
(Canonne-Hergaux and Gros,
2002; Knopfel et al.,
2005), as well as in recycling endosomes to mediate Fe transport
into the cytosol (Gruenheid et al.,
1999; Lam-Yuk-Tseung et al.,
2005). The punctate localisation of Mvl is likely to be a similar
endosomal compartment.
|
We next measured Cu uptake using the radioisotope 64Cu. S2 cells overexpressing Mvl or an empty vector control were exposed to 2 µmol l–1 Cu. Relative to control, overexpression of Mvl increased Cu levels by 9% and 35% after 1 h and 24 h exposure times, respectively (Fig. 2A). Conversely, dsRNAi knockdown of endogenous Mvl reduced Cu accumulation by 8% and 28% when cells were exposed to 2 µmol l–1 Cu for 1 and 24 h, respectively (Fig. 2B). These results demonstrate Mvl is a functional Cu uptake protein in vitro, able to transport Cu across the plasma membrane under physiological conditions. To determine if Mvl-mediated Cu uptake is important for Cu homeostasis, we examined the viability of S2 cells following dsRNAi knockdown of Mvl. Cell viability was determined after 6 days following exposure to basal medium or Cu-limited medium using the Cu chelator Diamsar (Fig. 3). Viability under basal conditions was not affected by dsRNAi knockdown of Mvl. Control cells were sensitive to Cu limitation, with the number of viable cells reduced by 28% compared with cells maintained on basal medium. Cells were significantly more susceptible to Cu limitation following knockdown of Mvl, with viability reduced by 49%. Under Cu limiting conditions, relative to control cells, significantly fewer cells were viable when Mvl was knocked down. By contrast, dsRNAi knockdown of Mvl did not affect cell viability, relative to control, when cells were challenged with excess Cu for 48 h (data not shown).
|
|
The overexpression of Mvl in S2 cells significantly increased Cu
levels, however, the effect was not as dramatic as that previously seen with
Ctr1A and Ctr1B (Zhou et
al., 2003), supporting the established view that the Cu-specific
Ctr1 system is the primary Cu uptake mechanism. Nevertheless, impairment of
Mvl function significantly decreases Cu uptake and reduces cell
viability when Cu availability is low, whereas cell viability is unaffected
when Cu levels are either adequate or elevated. This reduced Mvl-mediated Cu
uptake suggests Ctr1A and Ctr1B are unable to elevate Cu uptake to compensate
for reduction in Mvl activity. Similar results were seen when either
Ctr1A or Ctr1B were suppressed in these cells
(Southon et al., 2004)
suggesting the Ctr1 and Mvl systems are independently regulated. Although
speculative, the two systems may transport Cu to different cellular
compartments. It is unclear if DMT1 can transport Cu to Atox1 as occurs with
Ctr1 (Xiao and Wedd, 2002), or
whether an alternative Cu chaperone is used for this non-Cu-specific transport
system in mammals.
Malvolio transports Cu in Drosophila melanogaster
We sought to explore Mvl-mediated Cu transport in vivo utilising
the homozygous viable, partial loss-of-function, Mvl97f
mutant flies (Rodrigues et al.,
1995) as well as overexpression of Mvl with the UAS-Gal4
system. We examined viability, Cu uptake and distribution and markers of
Cu-dependent enzyme activity.
Hypopigmentation seen with impairment of Ctr1B
(Zhou et al., 2003) or with
overexpression of ATP7 (Norgate
et al., 2006) is indicative of a functional Cu deficiency and has
previously been used to demonstrate in vivo Cu uptake and efflux,
respectively, as tyrosinase is a Cu-dependent phenol oxidase involved in the
production of biogenic amines needed for pigmentation
(Wright, 1987). ATP7
overexpression in the adult thorax also results in developmental disruption of
the thorax, including absence of scutelar bristles and reduced thorax width
(Norgate et al., 2006),
presumably due to impaired activity of lysyl oxidase, the Cu-dependent enzyme
involved the biogenesis of connective tissue matrices
(Smith-Mungo and Kagan,
1998).
We examined adult cuticle in homozygous Mvl97f mutant flies under basal conditions, Cu-limited and Cu-excess conditions, but did not observe any significant change to pigmentation or cuticle morphology (data not shown). Similarly overexpression of Mvl in the pannier domain under the control of the pnr-Gal4 driver did not have any observable effect (data not shown). These results demonstrate that impaired Mvl function does not cause a functional Cu deficiency and suggests other transporters, presumably Ctr1A or Ctr1B, are primarily responsible for Cu uptake into the developing epidermis.
To determine if any Mvl-mediated Cu transport occurs in the thorax, we next
examined the effect of impaired Mvl function and Mvl
overexpression when cuticle Cu levels are depleted by ATP7
overexpression. Compared with w1118 control flies
(Fig. 4A), overexpression of
ATP7 in the pannier domain
(Fig. 4B) caused a severe Cu
depletion, including hypopigmentation and reduced thoracic width (indicated by
the distance between the two major posterior sensory bristles) as previously
reported (Norgate et al.,
2006). Overexpression of ATP7 in the pannier
domain in Mvl97f/+ flies did not significantly affect
pigmentation or thoracic development, relative to ATP7 overexpression
in a wild-type background (Fig.
4C). By contrast, simultaneous overexpression of Mvl and
ATP7 caused a more severe hypopigmentation phenotype and further
reduction in thorax width, than ATP7 overexpression alone, indicative
of a more severe functional Cu deficiency
(Fig. 4D). These phenotypes
were not affected by raising these flies on Cu-limited or Cu-excess food (data
not shown).
|
). These results are inconsistent with a simple model of Mvl
acting at the plasma membrane to transport Cu into a tissue, and may be due to
a more complex level of intracellular Cu regulation. In mammals, DMT1 not only
functions at the plasma membrane but also transports Fe
(Gruenheid et al., 1999;
Lam-Yuk-Tseung et al., 2005)
and Cd (Abouhamed et al., 2007)
from an endosomal compartment into the cytosol. Therefore, it is reasonable to
speculate that the punctate intracellular localisation of Mvl in S2 cells
(Fig. 1) and
Drosophila tissues (Folwell et
al., 2006) represents an endosomal compartment and that Mvl can
transport Cu from this organelle into the cytosol. It is possible that the
overexpression of Mvl may worsen the hypopigmentation and cuticle
phenotype through a redistribution of intracellular Cu, increasing transport
of Cu out of an endosomal compartment and further restricting Cu delivery to
Cu-dependent enzymes within the secretory pathway. The hypothesis that there
are distinct pathways for Cu uptake and delivery to specific subcellular
compartments and Cu-dependent proteins is supported by our in vitro
results, which show Ctr1A and Ctr1B are unable to maintain optimal Cu levels
and prevent susceptibility to Cu limitation when Mvl is impaired
(Fig. 3).
To assess the importance of Mvl to Cu homeostasis in live
Drosophila we examined the viability of Mvl97f
flies in response to Cu limitation as well as Cu excess. First instar larvae
were raised on basal food, on food containing the Cu chelator BCS, or on food
with excess Cu, and survival to adulthood was determined for female
(Fig. 5A) and male
(Fig. 5B) flies separately.
Compared to the control strains Armenia (wild-type) and w1118,
Mvl97f males and females showed a strong sensitivity to excess
Cu, with a significant reduction in viability at 1 mmol l–1
Cu and essentially no survival at 2 mmol l–1 Cu. Under
limiting Cu conditions Mvl97f females again demonstrated
reduced viability but, interestingly, Mvl97f males were
unaffected. Thus reduced Mvl function confers sensitivity to Cu
excess and, in female flies, Cu limitation as well. It is unclear why male
flies were unaffected by Cu limitation, but it is possible that Mvl
expression levels are gender specific. SEBIDA, the Drosophila sex
bias database, cites seven different cDNA microarray studies that have
compared male and female Drosophila melanogaster gene expression
profiles and all have shown greater Mvl expression in male flies,
with this difference statistically significant in four of the arrays
(Gnad and Parsch, 2006). Given
the Mvl97f mutation is only a partial loss of function it
is possible that male flies are able to produce sufficient Mvl protein for Cu
uptake, whereas female flies are not.
|
). Absence of Ctr1B causes sensitivity to Cu
limitation, suggestive of reduced transport from the midgut, as well as
sensitivity to excess Cu due to reduced transport into a detoxification
tissues such as the fat body or Malpighian tubules [analogous to the mammalian
liver and kidneys, respectively (Cagan,
2003; Sondergaard,
1993)].
To explore why Mvl97f flies are sensitive to Cu
manipulation we used an MtnA-EYFP reporter as a marker for Cu distribution
within third instar larvae. Excess Cu induces expression of the EYFP marker
from the promoter of MtnA, and this technique has previously been
used as a proxy measure of Cu distribution
(Norgate et al., 2006;
Selvaraj et al., 2005). We
examined male and female larvae separately, but did not detect any differences
between the sexes (data not shown). Mvl97f/+/MtnA-EYFP
larvae were dissected and compared to w1118/MtnA-EYFP
controls (Fig. 6). When larvae
were raised on BCS to limit available Cu, EYFP could only be detected in the
iron-cell region of the middle midgut and in the imaginal ring at the
midgut–hindgut border of both control
(Fig. 6A) and
Mvl97f/+ (Fig.
6B) larvae. The lack of EYFP expression in the remainder of the
midgut and other tissues does not suggest that these tissues are not taking up
Cu, but that all available Cu is being utilised. The EYFP detected in the
iron-cell region and the imaginal ring suggests these were the only tissues
where an excess of Cu was available to stimulate MtnA expression.
Under basal conditions control larvae displayed significant EYFP in the
proventriculus, gastric caecum, anterior midgut and Malpighian tubules
(Fig. 6C,E). Importantly,
Mvl97f/+ larvae had dramatically reduced EYFP expression
in the proventriculus and anterior midgut
(Fig. 6D,F). We next exposed
larvae to 1 mmol l–1 Cu for 4 h prior to dissection to see if
excess Cu altered this distribution. There was a dramatic increase in EYFP
levels in all tissues including the posterior midgut, fatbody, hindgut and
larval epidermis. However, there was no detectable difference between
Mvl97f/+ (Fig.
6H) and control (Fig.
6G) larvae. This saturation of EYFP in all tissues supports the
hypothesis that Drosophila essentially take up all available Cu
rather than risk a deficiency (Balamurugan
et al., 2007).
|
We next raised Mvl97f and w1118 control larvae under various Cu conditions and measured metal levels at pupation and adulthood by ICP-AES (Table 1). When raised on basal food, Fe levels were 40% lower in Mvl97f pupae than controls. Cu levels were 7% lower, however, this was not statistically significant (P=0.09). Mn and Zn levels were unchanged. Raising larvae under Cu-limited conditions significantly reduced Cu levels in both control and Mvl97f pupae. Cu levels were 10% lower in Mvl97f pupae than control, however, again this was not statistically significant (P=0.10). Cu levels could not be assessed in Mvl97f pupae following Cu exposure as viability was too severely reduced (Fig. 5). We therefore raised larvae under basal condition and exposed the adults to 6 mmol l–1 excess Cu for 24 h. Cu levels were dramatically higher in Mvl97f and w1118 flies than that seen in pupae. Interestingly Mvl97f flies also contained significantly more Mn and Zn than controls, and Fe levels were no longer lower in Mvl97f, demonstrating a general elevation of metal levels. The elevated Cu seen in Mvl97f flies exposed to short-term excess Cu is consistent with the hypothesis that reduced Cu transport into the fat body or Malpighian tubules leads to systemic accumulation and reduced viability. Unfortunately we could not detect any difference in MtnA-EYFP fluorescence between Mvl97f/+ and control larvae at high Cu levels as the EYFP signal was saturated in all tissues because of a systemic upregulation of the Mtn Cu sequestration system.
|
The relatively small reduction in Cu levels seen in
Mvl97f pupae relative to controls, shows impaired
Mvl-mediated Cu uptake does not result in a systemic Cu deficiency, presumably
because of a compensatory Ctr1-mediated Cu uptake. The reduced MtnA-EYFP
expression in the anterior midgut, a tissue known to express Mvl
(Folwell et al., 2006), and
the proventriculus of Mvl97f larvae suggests that impaired
Mvl-mediated Cu uptake in one or both of these regions is likely to be
responsible for the reduced viability of female Drosophila under Cu
limiting conditions. Ctr1A and Ctr1B are also expressed in
the midgut (Chintapalli et al.,
2007) and the loss of function of either of these Cu transporters
confers sensitivity to Cu deficiency
(Turski and Thiele, 2007;
Zhou et al., 2003), suggesting
these transporters are unable to fully compensate for the absence of another
in this tissue.
Conclusion
These results demonstrate Malvolio is a physiologically important Cu
transporter both in vitro and in vivo. The similarity
between Mvl and Ctr1B mutant Drosophila with
respect to their sensitivity to both Cu limitation and excess Cu, despite
similar expression profiles, suggests each of these pathways are essential for
optimal Cu uptake and distribution with only partial redundancy, and this is
supported by in vitro experiments with dsRNAi knockdown in S2 cells.
These results, together with the recent study redefining the role of human
CTR1 (Zimnicka et al., 2007),
suggest the role of DMT1 in mammalian dietary Cu uptake and distribution
should be investigated further.
LIST OF ABBREVIATIONS
|
Acknowledgments |
|---|
|
References |
|---|
|
TOPSummaryINTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONReferences |
|---|
Abouhamed, M., Wolff, N. A., Lee, W. K., Smith, C. P. and Thevenod, F. (2007). Knockdown of endosomal/lysosomal divalent metal transporter 1 by RNA interference prevents cadmium-metallothionein-1 cytotoxicity in renal proximal tubule cells. Am. J. Physiol. 293,F705 -F712.[CrossRef]
Balamurugan, K., Egli, D., Hua, H., Rajaram, R., Seisenbacher, G., Georgiev, O. and Schaffner, W. (2007). Copper homeostasis in Drosophila by complex interplay of import, storage and behavioral avoidance. EMBO J. 26,1035 -1044.[CrossRef][Medline]
Bellingham, S. A., Lahiri, D. K., Maloney, B., La Fontaine, S.,
Multhaup, G. and Camakaris, J. (2004). Copper depletion
down-regulates expression of the Alzheimer's disease amyloid-beta precursor
protein gene. J. Biol. Chem.
279,20378
-20386.
Cagan, R. (2003). The signals that drive kidney development: a view from the fly eye. Curr. Opin. Nephrol. Hypertens. 12,11 -17.[CrossRef][Medline]
Camakaris, J., Petris, M. J., Bailey, L., Shen, P., Lockhart,
P., Glover, T. W., Barcroft, C., Patton, J. and Mercer, J. F.
(1995). Gene amplification of the Menkes (MNK; ATP7A) P-type
ATPase gene of CHO cells is associated with copper resistance and enhanced
copper efflux. Hum. Mol. Genet.
4,2117
-2123.
Camakaris, J., Voskoboinik, I. and Mercer, J. F. (1999). Molecular mechanisms of copper homeostasis. Biochem. Biophys. Res. Commun. 261,225 -232.[CrossRef][Medline]
Canonne-Hergaux, F. and Gros, P. (2002). Expression of the iron transporter DMT1 in kidney from normal and anemic mk mice. Kidney Int. 62,147 -156.[CrossRef][Medline]
Cellier, M., Prive, G., Belouchi, A., Kwan, T., Rodrigues, V.,
Chia, W. and Gros, P. (1995). Nramp defines a family of
membrane proteins. Proc. Natl. Acad. Sci. USA
92,10089
-10093.
Chintapalli, V. R., Wang, J. and Dow, J. A. (2007). Using FlyAtlas to identify better Drosophila melanogaster models of human disease. Nat. Genet. 39,715 -720.[CrossRef][Medline]
Egli, D., Selvaraj, A., Yepiskoposyan, H., Zhang, B., Hafen, E., Georgiev, O. and Schaffner, W. (2003). Knockout of `metal-responsive transcription factor' MTF-1 in Drosophila by homologous recombination reveals its central role in heavy metal homeostasis. EMBO J. 22,100 -108.[CrossRef][Medline]
Eichner Techau, M., Valdez-Taubas, J., Popoff, J. F., Francis,
R., Seaman, M. and Blackwell, J. M. (2007). Evolution of
differences in transport function in SLC11A family members. J.
Biol. Chem. 282,35646
-35656.
Folwell, J. L., Barton, C. H. and Shepherd, D.
(2006). Immunolocalisation of the D. melanogaster Nramp
homologue Malvolio to gut and Malpighian tubules provides evidence that
Malvolio and Nramp2 are orthologous. J. Exp. Biol.
209,1988
-1995.
Gnad, F. and Parsch, J. (2006). Sebida: a
database for the functional and evolutionary analysis of genes with sex-biased
expression. Bioinformatics
22,2577
-2579.
Goswami, T., Bhattacharjee, A., Babal, P., Searle, S., Moore, E., Li, M. and Blackwell, J. M. (2001). Natural-resistance-associated macrophage protein 1 is an H+/bivalent cation antiporter. Biochem. J. 354,511 -519.[CrossRef][Medline]
Gruenheid, S., Canonne-Hergaux, F., Gauthier, S., Hackam, D. J.,
Grinstein, S. and Gros, P. (1999). The iron transport protein
NRAMP2 is an integral membrane glycoprotein that colocalizes with transferrin
in recycling endosomes. J. Exp. Med.
189,831
-841.
Gunshin, H., Mackenzie, B., Berger, U. V., Gunshin, Y., Romero, M. F., Boron, W. F., Nussberger, S., Gollan, J. L. and Hediger, M. A. (1997). Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 388,482 -488.[CrossRef][Medline]
Knopfel, M., Zhao, L. and Garrick, M. D. (2005). Transport of divalent transition-metal ions is lost in small-intestinal tissue of b/b Belgrade rats. Biochemistry 44,3454 -3465.[CrossRef][Medline]
Lam-Yuk-Tseung, S., Touret, N., Grinstein, S. and Gros, P. (2005). Carboxyl-terminus determinants of the iron transporter DMT1/SLC11A2 isoform II (-IRE/1B) mediate internalization from the plasma membrane into recycling endosomes. Biochemistry 44,12149 -12159.[CrossRef][Medline]
Linder, M. C. and Hazegh-Azam, M. (1996). Copper biochemistry and molecular biology. Am. J. Clin. Nutr. 63,797S -811S.
Norgate, M., Lee, E., Southon, A., Farlow, A., Batterham, P.,
Camakaris, J. and Burke, R. (2006). Essential roles in
development and pigmentation for the Drosophila copper transporter
DmATP7. Mol. Biol. Cell
17,475
-484.
Norgate, M., Southon, A., Zou, S., Zhan, M., Sun, Y., Batterham, P. and Camakaris, J. (2007). Copper homeostasis gene discovery in Drosophila melanogaster. Biometals 20,683 -697.[CrossRef][Medline]
Orgad, S., Nelson, H., Segal, D. and Nelson, N.
(1998). Metal ions suppress the abnormal taste behavior of the
Drosophila mutant malvolio. J. Exp. Biol.
201,115
-120.
Rodrigues, V., Cheah, P. Y., Ray, K. and Chia, W. (1995). malvolio, the Drosophila homologue of mouse NRAMP-1 (Bcg), is expressed in macrophages and in the nervous system and is required for normal taste behaviour. EMBO J. 14,3007 -3020.[Medline]
Rozen, S. and Skaletsky, H. J. (2000). Primer3 on the WWW for general users and for biologist programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology (ed. S. Krawetz and S. Misener), pp.365 -386. Totowa: Humana Press.
Selvaraj, A., Balamurugan, K., Yepiskoposyan, H., Zhou, H.,
Egli, D., Georgiev, O., Thiele, D. J. and Schaffner, W.
(2005). Metal-responsive transcription factor (MTF-1) handles
both extremes, copper load and copper starvation, by activating different
genes. Genes Dev. 19,891
-896.
Smith-Mungo, L. I. and Kagan, H. M. (1998). Lysyl oxidase: properties, regulation and multiple functions in biology. Matrix Biol. 16,387 -398.[CrossRef][Medline]
Sondergaard, L. (1993). Homology between the mammalian liver and the Drosophila fat body. Trends Genet. 9,193 .[CrossRef][Medline]
Southon, A., Burke, R., Norgate, M., Batterham, P. and Camakaris, J. (2004). Copper homoeostasis in Drosophila melanogaster S2 cells. Biochem. J. 383,303 -309.[CrossRef][Medline]
Stober, C. B., Brode, S., White, J. K., Popoff, J. F. and
Blackwell, J. M. (2007). Slc11a1, formerly Nramp1, is
expressed in dendritic cells and influences major histocompatibility complex
class II expression and antigen-presenting cell function. Infect.
Immun. 75,5059
-5067.
Touret, N., Furuya, W., Forbes, J., Gros, P. and Grinstein,
S. (2003). Dynamic traffic through the recycling compartment
couples the metal transporter Nramp2 (DMT1) with the transferrin receptor.
J. Biol. Chem. 278,25548
-25557.
Turski, M. L. and Thiele, D. J. (2007).
Drosophila Ctr1A functions as a copper transporter essential for development.
J. Biol. Chem. 282,24017
-24026.
Vidal, S., Gros, P. and Skamene, E. (1995). Natural resistance to infection with intracellular parasites: molecular genetics identifies Nramp1 as the Bcg/Ity/Lsh locus. J. Leukoc. Biol. 58,382 -390.[Abstract]
Worby, C. A., Simonson-Leff, N. and Dixon, J. E. (2001). RNA interference of gene expression (RNAi) in cultured Drosophila cells. Sci. STKE 2001, PL1.[Medline]
Wright, T. R. (1987). The genetics of biogenic amine metabolism, sclerotization, and melanization in Drosophila melanogaster. Adv. Genet. 24,127 -222.[Medline]
Xiao, Z. and Wedd, A. G. (2002). A C-terminal domain of the membrane copper pump Ctr1 exchanges copper(I) with the copper chaperone Atx1. Chem. Commun. Camb. 2002,588 -589.
Zhou, H., Cadigan, K. M. and Thiele, D. J.
(2003). A copper-regulated transporter required for copper
acquisition, pigmentation, and specific stages of development in
Drosophila melanogaster. J. Biol. Chem.
278,48210
-48218.
Zimnicka, A. M., Maryon, E. B. and Kaplan, J. H.
(2007). Human copper transporter hCTR1 mediates basolateral
uptake of copper into enterocytes: implications for copper homeostasis.
J. Biol. Chem. 282,26471
-26480.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
P<0.0001 compared to control.
