|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online November 14, 2008
Journal of Experimental Biology 211, 3750-3758 (2008)
Published by The Company of Biologists 2008
doi: 10.1242/jeb.018440
Branchial FXYD protein expression in response to salinity change and its interaction with Na+/K+-ATPase of the euryhaline teleost Tetraodon nigroviridis


Department of Life Sciences, National Chung-Hsing University, Taichung 402, Taiwan
Author for correspondence (e-mail:
thlee{at}dragon.nchu.edu.tw)
Accepted 23 September 2008
| Summary |
|---|
|
|
|---|
subunit and a glycosylated β
subunit which is responsible for membrane targeting of the enzyme. In mammals,
seven FXYD members have been found. FXYD proteins have been identified as the
regulatory protein of NKA in mammals and elasmobranchs, it is thus interesting
to examine the expression and functions of FXYD protein in the euryhaline
teleosts with salinity-dependent changes of gill NKA activity. The present
study investigated the expression and distribution of the FXYD protein in
gills of seawater (SW)- or freshwater (FW)-acclimated euryhaline pufferfish
(Tetraodon nigroviridis). The full-length pufferfish FXYD gene
(pFXYD) was confirmed by RT-PCR. pFXYD was found to be
expressed in many organs including gills of both SW and FW pufferfish.
pFXYD mRNA abundance in gills, determined by real-time PCR, was
significantly higher in FW fish than in SW fish. An antiserum raised against a
partial amino acid sequence of pFXYD was used for the immunoblots of gill
homogenates and a major band at 13 kDa was detected. The relative amounts of
pFXYD protein and mRNA in gills of SW and FW pufferfish were identical, but
opposite to the expression levels of NKA. Immunofluorescent staining of frozen
sections demonstrated that pFXYD was colocalized to NKA-immunoreactive cells
in the gill filaments. In addition, interaction between pFXYD and NKA was
demonstrated by co-immunoprecipitation. Taken together, salinity-dependent
expression of pFXYD protein and NKA, as well as the evidence for their
colocalization and interaction in pufferfish gills suggested that pFXYD
regulates NKA activity in gills of euryhaline teleosts upon salinity
challenge.
Key words: gill, Na+/K+-ATPase, pufferfish, salinity, Tetraodon nigroviridis, pFXYD
| INTRODUCTION |
|---|
|
|
|---|
For teleosts, NKA not only sustains homeostasis but also provides a driving
force for many transporting systems, including those of gill epithelial cells.
Immunocytochemical studies on gill sections as well as biochemical studies on
isolated epithelial cells demonstrated that mitochondrion-rich (MR) cells had
the highest level of NKA in fish gills
(Dang et al., 2000
;
Lee et al., 2000
;
Sakamoto et al., 2001
;
Brauer et al., 2005
). Most
euryhaline teleosts exhibit adaptive changes in gill NKA activity following
salinity challenge (Marshall,
2002
; Evans et al.,
2005
). These have been attributed to (1) an increase in NKA
-subunit mRNA abundance (Seidelin
et al., 2001
; Singer et al.,
2002
; Scott et al.,
2004
), protein amounts (Lee et
al., 2000
; Tipsmark et al.,
2002
; Lin et al.,
2003
) or both (D'Cotta et al.,
2000
; Lin et al.,
2004a
; Lin et al.,
2006
); or (2) modulation of the hydrolytic rate of this enzyme as
reported in gills of the Atlantic cod (Gadus morhua)
(Crombie et al., 1996
) and
striped bass (Morone saxatilis)
(Tipsmark et al., 2004
). These
two adaptive mechanisms are regulated by short-term (rapid) or long-term
(sustained) control. Long-term regulation is found to be mediated by
mineralocorticoid or thyroid hormone and leads to a significant change in the
total amount of NKA, whereas short-term regulation involves protein kinases
and results in modulation of NKA expression in the cell membrane
(Therien and Blostein, 2000
;
Feraille and Doucet, 2001
). In
addition, a novel regulatory mechanism which revealed tissue- and
isozyme-specific interaction of NKA with the members of the FXYD protein
family has been elucidated in mammals and elasmobranchs
(Crambert and Geering,
2003
).
The FXYD proteins, so named because of their invariant extracellular motif
FXYD, belonging to a family with a conserved single-span transmembrane domain
(Sweadner and Rael, 2000
).
These proteins are characterized by a conserved FXYD motif, two identified
glycine residues and a serine residue
(Geering, 2005
). There are
seven clear members in mammals: FXYD1 (phospholemman; PLM)
(Palmer et al., 1991
;
Crambert et al., 2002
;
Feschenko et al., 2003
), FXYD2
(the
subunit of NKA) (Forbush et
al., 1978
; Mercer et al.,
1993
), FXYD3 (mammary tumor marker Mat-8)
(Morrison et al., 1995
;
Crambert et al., 2005
), FXYD4
(corticosteroid hormone-induced factor, CHIF)
(Attali et al., 1995
;
Beguin et al., 2001
;
Garty et al., 2002
;
Lindzen et al., 2003
), FXYD5
(related to ion channel RIC or dysadherin)
(Fu and Kamps, 1997
), FXYD6
(phosphohippolin) (Yamaguchi et al.,
2001
) and FXYD7 (Beguin et al.,
2002
). In elasmobranchs, a phospholemman-like protein has been
cloned (Mohmmoud et al., 2000; Mohmmoud et al., 2003) and subsequently named
FXYD10 (Mohmmoud et al., 2005). In teleosts, eight FXYD isoforms were recently
cloned in Atlantic salmon (Tipsmark,
2008
). Tissue-dependent expression of different FXYD isoforms and
their modulation by salinity were identified by quantitative PCR. Among these
isoforms, FXYD11 was predominantly expressed in gills.
FXYD protein members cloned from different animal tissues were thought to
be involved in a variety of cellular functions. The smaller NKA
subunit, also known as FXYD2, is the first example of a small single
transmembrane protein interacting with and regulating renal NKA
(Forbush et al., 1978
). In
mammals, significant functional effects of FXYD proteins 1–7 were
demonstrated, mainly by co-immunoprecipitation and various expression systems,
including their specific associations with the
/β complex of NKA,
and thereby altering its kinetic properties
(Therien et al., 2001
;
Cornelius and Mahmmoud, 2003
;
Crambert and Geering, 2003
;
Crambert et al., 2005
;
Garty and Karlish, 2005
;
Lubarski et al., 2005
;
Delprat et al., 2007
).
Elasmobranch FXYD protein (PLMS) was also found to be associated with NKA,
modify its activity in vitro
(Mahmmoud et al., 2000
;
Mahmmoud et al., 2003
). In
teleosts, however, it is not clear if FXYD proteins interact with NKA and play
similar roles to those in the mammals and elasmobranchs.
The spotted green pufferfish (Tetraodon nigroviridis) is an
advanced tetraodontid teleost whose native range covers the rivers and
estuaries of Southeast Asia (Rainboth,
1996
). Being a peripheral freshwater (FW) inhabitant
(Helfman et al., 1997
), this
pufferfish has been demonstrated to be an efficient osmoregulator in
experimental conditions, as it can tolerate a direct transfer from FW to
seawater (SW) or vice versa (Lin
et al., 2004b
). The great euryhalinity, wide availability and
inexpensive maintenance all make the pufferfish a good experimental animal in
the laboratory for studies on ionoregulation.
Salinity adaptation of euryhaline teleosts is a series of physiological
responses in osmoregulatory organs, including gills, to differing
ionoregulatory requirements. Lin et al.
(Lin et al., 2004b
) reported
that the SW-acclimated pufferfish had higher protein abundance as well as
activity of gill NKA than the FW-acclimated individuals. Since the estuary is
an environment with changing salinities, pufferfish must have corresponding
strategies for rapid ionic regulation and acclimation. Expression and
functions of NKA regulatory proteins, such FXYD proteins, in the euryhaline
pufferfish are thus worth investigating.
In this study, a new member of FXYD protein family, termed pufferfish FXYD protein (pFXYD) was identified. pFXYD was cloned and found to have substantial homology with the other FXYD proteins at the transmembrane domain. pFXYD was also characterized by its molecular mass, similar to the other members of the FXYD protein family, as determined by immunoblots with specific antiserum. These experiments were designed to explore the expression and distribution of pFXYD in gills of SW- and FW-acclimated euryhaline pufferfish (Tetraodon nigroviridis). Furthermore, the relationship between NKA and FXYD in gills was examined by immunostaining and co-immunoprecipitation to elucidate possible functions of FXYD in pufferfish.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Total RNA extraction and reverse transcription
Before sampling, the fish were killed by spinal section and pithing of the
brain. Total RNA was extracted from the gill epithelium using the RNeasy Mini
kit (Qiagen, Valencia, CA, USA) following the manufacturer's instructions. RNA
integrity was verified by 0.8% agarose gel electrophoresis. Extracted RNA
samples were stored at –80°C after isolation. First-strand cDNA was
synthesized by reverse transcribing 9µl of the total RNA (5µg) using a
1µl oligo(dT) primer and a 1 µl PowerScriptTM reverse transcriptase
(Clontech, Franklin Lakes, NJ, USA) following the manufacturer's
instructions.
Primers used for PCR and real-time PCR
The pufferfish FXYD DNA sequence (pFXYD) was derived from the
puffer genome database
(http://www.genoscope.cns.fr/externe/tetranew/).
The full-length pFXYD sequence from the database was verified by PCR
and DNA sequencing experiments. To amplify the full open reading frame region
(ORF) of pFXYD, PCR primers were designed according to the pufferfish
FXYD 5' and 3' UTR regions. pFXYD gene-specific primer
sequences were as follows (5' to 3'): forward –
AGGTAAACCACTTGAA and reverse – CCTTCCATTTAATCCCAGAACA. Q-PCR primers
were designed using the on-line public website
(https://www.genscript.com/ssl-bin/app/primer).
pFXYD gene-specific primer sequences were as follows (5' to
3'): forward – GCTCTGCTGCTGATGACACT and reverse –
GATGCCAATGAGACAGAGGA. β-Actin primer sequences were as follows (5'
to 3'): forward – CATGTTCGAGACCTTCAACG and reverse –
GTCACACCGTCACCAGAGTC. The cDNA sequence of pufferfish FXYD (GenBank
accession no. EF028083) and β-actin (NCBI, CAAE01015104) were aligned and
compared with the sequences of other species from the NCBI database.
Polymerase chain reaction
The PCR cycle protocol was as follows: 95°C for 1 min, 30 cycles of
95°C for 1 min, 53°C for 90 s and 72°C for 2 min, with a final
incubation at 72°C for 15 min. The PCR product could be stored at 4°C
before running agarose gels.
Real-time PCR analysis
Pufferfish FXYD mRNA was quantified using the ABI PRISM 7000
Sequence Detection System (SYBR Green II) real-time quantitative PCR (Applied
Biosystems, Foster City, CA, USA). For methods of quantifying mRNA by
real-time PCR, refer to Johnson et al.
(Johnson et al., 2000
). PCR
reactions contained 8µl of cDNA (500x dilution), 2 µl of FXYD
primer mixture (l00 nmol l–1) or β-actin primer mixture
(100 nmol l–1), and 10µl of SYBR Green PCR Master Mix
(Applied Biosystems). Real-time PCR reactions were performed as follows: 1
cycle of 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of
95°C for 15 s and 60°C for 1 min. All samples were run in triplicate.
Reactions for quantifying β-actin copy number were performed exactly as
described above except for the use of a different probes and primers.
pFXYD mRNA values were adjusted by the values obtained for
β-actin from each DNA samples, to obtain the values reported. For each
unknown sample, the corresponding pFXYD and β-actin values were
read using linear regression analyses from their respective standard curves
(data not shown). Relative pFXYD expression value was obtained using
the following formula:
2^[(CtFXYD,N–Ctβ-actin,N)–(CtFXYD,0–Ctβ-actin,0)],
where Ct is the threshold cycle number.
Preparation of gill homogenates
Gill scrapings prepared as described above were suspended in 1 ml of
homogenization solution (100 mmol l–1 imidazole-HCl, 5 mmol
l–1 sodium EDTA, 200 mmol l–1 sucrose, 0.1%
sodium deoxychlolate, pH 7.6) with 10 µl proteinase inhibitor (10 mg
antipain, 5 mg leupeptin and 50 mg benzamidine dissolved in 5 ml aprotinin;
100:1). Homogenization was performed in a glass Potter-Elvehjem homogenizer
with a Brinkmann polytron homogenizer (PT1200E; Kinematica, Lucerne,
Switzerland) at maximal speed for 20 strokes. The homogenate was then
centrifuged at 13,000 g at 4°C for 20 min. Protein
concentrations of the supernatant were identified using reagents from the
Protein Assay Kit (Bio-Rad, Hercules, CA, USA), using bovine serum albumin
(Sigma, St Louis, MO, USA) as a standard.
Preparation of membrane fractions
The tissue scrapings were suspended in the mixture of homogenization medium
and proteinase inhibitor as described previously. The membrane fraction was
prepared according to the method modified from Stanwell et al.
(Stanwell et al., 1994
). All
procedures were performed on ice. 10 µl of proteinase inhibitor was added
to 1 ml of buffer A or B (1:100 each). Gill scrapings were suspended in 1 ml
of buffer A (20 mmol l–1 Tris-base, 2 mmol
l–1 MgCl2 6H2O, 2 mmol
l–1 EDTA, 0.5 mmol l–1 EGTA, 1 mmol
l–1 DTT, 250 mmol l–1 sucrose, proteinase
inhibitor, pH 7.4). Homogenization procedure was as described above. The
homogenate was then centrifuged at 135,000 g for 1 h at
4°C. The pellet was suspended in 200 µl of buffer B (20 mmol
l–1 Tris-base, 2 mmol l–1 MgCl2
6H2O, 5 mmol l–1 EDTA, 0.5 mmol
l–1 EGTA, 1 mmol l–1 DTT, 5 mmol
l–1 NaF, 0.1% Triton X-100, proteinase inhibitor, pH 7.5) and
vortexed every 10 min during a 1 h incubation period at 4°C. This
suspension was centrifuged again at 135,000 g for 1 h at
4°C. The supernatant, referred to as the membrane fractions, was stored at
–80°C. Protein concentrations of the supernatant were determined as
described above. The immunoblot of NKA, a membrane protein, was used to
confirm the membrane fraction preparation (supplementary material Fig.
S1).
Antiserum and antibody
The polyclonal antiserum of pFXYD was made against the specific epitope
(LAAAEEHSPEDDPF) corresponding to N-terminal region of the cloned pFXYD
protein. The antiserum of pFXYD was obtained from the MDBio (Taipei, Taiwan).
The Na+/K+-ATPase (NKA) antibody is a mouse monoclonal
antibody (
5) against the
subunit of the avian sodium pump
(Takeyasu et al., 1988
)
purchased from the Developmental Studies Hybridoma Bank (The University of
Iowa, Department of Biological Sciences, Iowa City, IA, USA). The secondary
antibody for immunoblots was horseradish phosphatase-conjugated goat
anti-mouse IgG or goat anti-rabbit IgG (Pierce, Rockford, IL, USA). For
immunolocalization, the secondary antibodies were Alexa-Fluor-488-conjugated
goat anti-mouse and Alexa-Fluor-546-conjugated goat anti-rabbit (Molecular
Probes, Eugene, OR, USA).
Immunoblots of pufferfish FXYD and NKA
Immunoblotting procedures were carried out as described by Wu et al.
(Wu et al., 2003
) with some
modifications. For detection of pFXYD protein, protein samples were heated at
100°C for 5 min and separated by electrophoresis on sodium dodecyl sulfate
(SDS)-containing 15% polyacrylamide gels (30 µg of protein/lane). The
separated proteins were then transferred to PVDF membranes (Millipore,
Billerica, MA, USA) by a tank transfer system (Mini Protean 3, Bio-Rad,
Hercules, CA, USA). After pre-incubation for 1 h in PBST buffer containing 5%
(w/v) nonfat dried milk to minimize non-specific binding, the blots were
incubated for 1 h with the primary pFXYD protein antiserum diluted in 5% (w/v)
nonfat dried milk sodium azide in PBST (1:500 dilution), washed in PBST, and
reacted for 1 h with secondary antibody (1:15000 dilution). For detection of
NKA proteins, the membrane fractions were separated by electrophoresis on
SDS-containing 7.5% polyacrylamide gels. The separated proteins were then
transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA,
USA) by electroblotting. After pre-incubation for 1 h in PBST buffer
containing 5% (w/v) nonfat dried milk to minimize non-specific binding, the
blots were incubated for 1 h with the primary antibody (
5) diluted in
PBST (1:2500 dilution), washed in PBST, and reacted for 1 h with secondary
antibody (1:5000 dilution). Blots were developed after incubation with the ECL
kit (Pierce, Rockford, IL, USA). Immunoblots were photographed and imported as
JPEG files into the ID image analysis software package (MCID Analysis
Evaluation 7.0). Results were converted to numerical values in order to
compare the relative intensities of the immunoreactive bands.
Immunolocalization
The first left and right gill arches with filaments were excised and fixed
immediately in a mixture of methanol and DMSO (4:1 v/v) at –20°C for
3 h (Chen et al., 2004
). After
washing with phosphate-buffered saline (PBS; 137.00 mmol l–1
NaCl, 2.68 mmol l–1 KCl, 10.14 mmol l–1
Na2HPO4, 1.76 mmol l–1
KH2PO4, pH 7.4), the arch and one row of the filaments
of the gills were removed. The remaining filaments were perfused with 30%
sucrose in PBS for 1 h at room temperature. Gill tissue was then mounted in
OCT (optimal cutting temperature) compound (Tissue-Tek, Sakura, Torrance, CA,
USA) for cryosectioning. Sections of gills were cut at 5–7 µm thick
using a Cryostat Microtome (Microm HM 505E, Walldorf, Germany) at
–25°C. The sections were placed on 0.01% poly-L-lysine (Sigma, St
Louis, MO, USA)-coated slides, and kept in slide boxes at –20°C
before staining. Samples were rinsed with PBS three times and then incubated
in 5% bovine serum albumin (Sigma) and 2% Tween 20 (Merck, Hohenbrunn,
Germany) in PBS for 0.5 h at room temperature. Cryosections were then
incubated at room temperature for 1 h with 300x diluted pFXYD polyclonal
antiserum. Following incubation, the sections were washed several times with
PBS, and then labeled with 500x diluted Alexa-Fluor-546-conjugated goat
anti-rabbit secondary antibody at room temperature for 2 h. After the first
staining, the cryosections were washed several times with PBS to continue the
second staining. The sections were subsequently incubated with 100x
diluted NKA monoclonal antibody
5 for 3 h at room temperature followed
by labeling with Alexa-Fluor-488-conjugated goat anti-mouse secondary antibody
at room temperature for 1 h. The samples were then washed with PBS, mounted
using coverslips with ClearmountTM mounting solution (Zymed, South San
Francisco, CA, USA), and observed with a confocal laser scanning microscope
(LSM 510, Zeiss, Hamburg, Germany) to determine immunolocalization. The
micrographs of immunofluorescence staining were controlled by the Zeiss LSM
image software.
Immunoprecipitation
Immunoprecipitation (IP) with primary antibody of either NKA or pFXYD was
carried out with the Catch and Release reversible immunoprecipitation system
(Upstate Biotechnology, Lake Placid, NY, USA) according to the manufacturer's
manual. After elution with non-denaturing elution buffer, the samples were
stored at –80°C before immunoblotting.
Statistical analyses
Values are expressed as means ± s.e.m. Results were analyzed using
Student's t-test and P<0.05 was set as the level of
significance.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
Immunolocalization of pFXYD and Na+/K+-ATPase (NKA)
Fig. 5 shows the confocal
images of frozen longitudinal sections of gill filaments of FW- and
SW-acclimated pufferfish double immunostained with antibody specific to the
NKA
subunit and antiserum to pFXYD. Confocal micrographs reveal that
pFXYD (Fig. 5A,D, red cells)
and NKA-immunoreactive cells (Fig.
5B,E, green cells) colocalized
(Fig. 5C,F yellow cells) in
gill filaments of both FW and SW pufferfish.
|
Co-immunoprecipitation of pFXYD and NKA
Immunoblotting was used to examine the interaction between pFXYD and NKA.
The results showed that when pFXYD and NKA were precipitated, band were found
at 100 kDa (Fig. 6A, lane 1)
and 13 kDa (Fig. 6B, lane 1)
corresponding to the molecular masses of pufferfish NKA and FXYD protein,
respectively. Lane 2 was the negative control in which no antibody was used in
immunoprecipitates. Lane 3 was the positive control, which demonstrated the
immunoprecipitation efficiency. The present data demonstrated that pFXYD
interacted with NKA in gills of pufferfish.
|
| DISCUSSION |
|---|
|
|
|---|
Our results indicated that the pFXYD gene is expressed in several
organs of the pufferfish including gills
(Fig. 2). In mammals,
tissue-specific distribution of different FXYD members was found, e.g. PLM
(FXYD1) was detected mainly in the brain, heart and skeletal muscle
(Feschenko et al., 2003
;
Wetzel and Sweadner, 2003
;
Zhang et al., 2003
); the
Na+/K+-ATPase (NKA)
subunit (FXYD2) was detected
only in the kidney (Pu et al.,
2001
; Wetzel and Sweadner,
2001
); CHIF (FXYD4) was detected in kidney and colon
(Shi et al., 2001
;
Garty et al., 2002
); and FXYD7
was brain-specific (Beguin et al.,
2002
). In addition, the elasmobranch PLMS (FXYD10) is expressed in
the rectal gland, the osmoregulatory organ of shark
(Mahmmoud et al., 2003
). Our
results showed the osmoregulatory organs: gill, kidney and gut all expressed
the pFXYD protein (data not shown). In addition, the levels of pFXYD
mRNA in gills of FW-acclimated pufferfish were higher than in the
SW-acclimated group (Fig. 3B).
For pufferfish acclimating to different salinity, pFXYD might play the
important role for adjusting ion regulation.
The significance of the role of teleostean branchial NKA in ion transport
has been confirmed in a range of species (reviewed by
Hwang and Lee, 2007
) since the
first studies of Epstein et al. (Epstein
et al., 1967
) on killifish, Fundulus heteroclitus, and
Kamiya and Utida (Kamiya and Utida,
1968
) on eels, Anguilla japonica. Significantly higher
branchial NKA activity as well as
-subunit protein abundance were found
in SW- than FW-acclimated pufferfish (Lin
et al., 2004b
). Since the elevation of pufferfish gill NKA
activity and
-subunit protein abundance occurred within 3 h
post-transfer from FW to SW (C.-H.L. and T.-H.L., unpublished data), it was
postulated that pufferfish NKA expression was rapidly modified by FXYD protein
upon salinity challenge. In this study, expression of pFXYD mRNA was
found, by real-time PCR, as well as protein levels, determined by immunoblot
using pufferfish FXYD antiserum. The specificity of the antiserum was
confirmed by the 13 kDa major band and the negative control
(Fig. 4A). The higher
pFXYD mRNA and protein levels in gills of FW-acclimated pufferfish
(Figs 3 and
4) is opposite to the trend of
the NKA protein abundance and activity. The phylogenetic tree revealed a close
relationship between pFXYD and the shark FXYD10 and human FXYD3 and FXYD4
(Fig. 1B). Since these FXYD
proteins have been demonstrated to associate specifically with NKA and affect
the pump function (Beguin et al.,
2001
; Feschenko et al.,
2003
; Mahmmoud et al.,
2003
; Crambert et al.,
2005
; Silverman et al.,
2005
), it is suggested that pFXYD also functions as a NKA
regulator through their inhibition of NKA activity when pufferfish are exposed
to FW.
The relative abundance of the pufferfish FXYD protein in the membranes of
the gills was analyzed in the present study
(Fig. 4B,C). The membrane
proteins of gill homogenates was assayed by ultracentrifugation
(Stanwell et al., 1994
) and
the NKA
subunit (a membrane protein) was found to be present in one
band only in the membrane fraction (supplementary material Fig. S1). Using
this protocol to separate membrane protein, our results showed a major 13 kDa
band in immunoblots of membrane fractions from pufferfish gills. The pFXYD
protein was significantly more abundant in the membrane fraction of the
FW-acclimated group (Fig. 4C).
This suggests that the abundance of pFXYD protein in branchial cells is
correlated with the environmental salinity. The epitope sequence of our pFXYD
antiserum covered the predicted N-terminal signal peptide. It was thus
reasonable that the antiserum recognized both cytosol and membrane pFXYD.
However, it has been shown that mammalian FXYD1 and FXYD4, as well as
elasmobranch PLMS (FXYD10), determined their orientation in the membrane and
become mature proteins after cleavage of the 20-amino acid N-terminal signal
peptide (Palmer et al., 1991
;
Beguin et al., 2001
;
Mahmmoud et al., 2003
). In
this study, the N-terminal 18-amino acid sequence was predicted to be the
signal peptide of the pFXYD protein (Fig.
1A). Since the pFXYD sequence was very similar to the FXYD4 and
FXYD10 sequences (Fig. 1B), the
immature pFXYD protein in organelles of the cytosol might also be matured and
transported to membrane through cleavage of its signal peptide. Furthermore,
the threonine71 of pFXYD peptide sequence were predicted to be the site of
phosphorylation by PKA (Fig.
1A). Because phosphorylation at a specific residue of FXYD1 (PLM)
was found to result in transportation of PLM from an intracellular compartment
to the plasma membrane (Lansbery et al.,
2006
), phosphorylation may also play an important role in
transport of pFXYD in gill epithelial cells of pufferfish. The intracellular
transport mechanisms of pFXYD protein should be investigated in future
studies.
In mammals and elasmobranchs, most FXYD proteins were colocalized to NKA in
different organs (Wetzel and Sweadner,
2001
; Feschenko et al.,
2003
; Mahmmoud et al.,
2003
; Crambert et al.,
2005
; Lubarski et al.,
2005
; Delprat et al.,
2007
). The present study revealed that pFXYD protein was
colocalized to NKA immunoreactive (NKIR) cells in gill filaments of FW- or
SW-acclimated pufferfish (Fig.
5C,F, yellow cells). In gills of the euryhaline teleosts,
epithelial NKIR cells are mitochondrion-rich (MR) cells responsible for
ionoregulation, as NKA was detected in their basolateral membrane
(Hwang and Lee, 2007
).
Although in some FW-acclimated euryhaline fish NKIR cells are distributed in
epithelia of both gill filaments and lamellae
(Sakamoto et al., 2001
;
Lin et al., 2006
), the
pufferfish NKIR cells were normally observed in filament epithelia of both FW-
or SW-acclimated individuals (Fig.
5B,E) (Lin et al.,
2004b
), similar to the situation in tilapia
(Lee et al., 1996
;
Lee et al., 2003
;
Uchida et al., 2000
). Hence,
the colocalization of pFXYD and NKA suggests that pFXYD may interact with NKA
at the basolateral membrane of MR cells in gill filaments of pufferfish.
In addition to colocalization, all mammalian FXYD proteins have been
demonstrated to interact with NKA and alter its kinetic properties (reviewed
by Garty and Karlish, 2006
).
Shark FXYD protein (PLMS) also associate with NKA and modify its activity
(Mahmmoud et al., 2000
;
Mahmmoud et al., 2003
).
Interaction between NKA
subunit and FXYD proteins, including FXYD1, 2,
3, 4, 7 and 10 was demonstrated mainly by co-immunoprecipitation
(Therien et al., 2001
;
Cornelius and Mahmmoud, 2003
;
Crambert and Geering, 2003
;
Garty and Karlish, 2005
;
Crambert et al., 2005
).
Interaction between pFXYD and NKA protein of the teleost, the pufferfish, was
also proved by co-immunoprecipitation in this study
(Fig. 6). Since pFXYD protein
was found to interact with, as well as colocalize to, NKA
subunit in
gills (Fig. 5), pFXYD was
suggested to regulate NKA activity via interaction with NKA
subunit when pufferfish experience salinity challenge.
Taken together, salinity-dependent expression of pFXYD protein and its interaction with NKA in gills of the euryhaline teleost was first reported in this study. Pufferfish exposed to SW experienced osmotic stress because the osmolality of plasma was hypotonic to the external environment, and the mRNA and protein levels of pFXYD were reduced to elevate NKA activity through their interaction in epithelial NKIR cells of gill filaments. By contrast, FW-acclimated pufferfish had increased pFXYD mRNA and protein levels to inhibit NKA activity. The pFXYD protein regulation of NKA appears to exist in all vertebrates from human to fish. More detailed investigation of the interaction of FXYD and NKA in euryhaline teleosts will be intriguing and provide insights into the understanding of teleost ionoregulation.
| Acknowledgments |
|---|
subunit (
5) was purchased from the Developmental Studies Hybridoma Bank
maintained by the Department of Pharmacology and Molecular Sciences, John
Hopkins University School of Medicine, Baltimore, MD 2120521205, and the
Department of Biological Sciences, University of Iowa, Iowa City, IA 52242,
under Contract N01-HD-6-2915, NICHD, USA. This study was supported by a grant
from the National Science Council of Taiwan to T.H.L. (NSC
96-2313-B-005-010-MY3). | Footnotes |
|---|
* These authors contributed equally to this work ![]()
Present address: Graduate Institute of Life Sciences, National Defense
Medical Center, Taipei 100, Taiwan ![]()
| References |
|---|
|
|
|---|
Attali, B., Latter, H., Rachamim, N. and Garty, H.
(1995). A corticosteroid-induced gene expressing an
"IsK-like" K+ channel activity in Xenopus oocytes.
Proc. Natl. Acad. Sci. USA
92,6092
-6096.
Beguin, P., Crambert, G., Guennoun, S., Garty, H., Horisberger,
J. D. and Geering, K. (2001). CHIF, a member of the FXYD
protein family, is a regulator of Na,K-ATPase distinct from the
-subunit. EMBO J.
20,3993
-4002.[CrossRef][Medline]
Beguin, P., Crambert, G., Monnet-Tschudi, F., Uldry, M.,
Horisberger, J. D., Garty, H. and Geering, K. (2002). FXYD7
is a brain-specific regulator of Na,K-ATPase
1-β isozymes.
EMBO J. 21,3264
-3273.[CrossRef][Medline]
Brauer, P. R., Sanmann, J. N. and Petzel, D. H.
(2005). Effects of warm acclimation on
Na+,K+-ATPase
-subunit expression in chloride
cells of Antarctic fish. Anat. Rec. A Discov. Mol. Cell Evol.
Biol. 285,600
-609.[Medline]
Chen, C. N., Lin, L. Y. and Lee, T. H. (2004). Distributions of ionocytes in gills of the euryhaline milkfish, Chanos chanos (Försskal, 1775). Zool. Stud. 43,772 -777.
Cornelius, F. and Mahmmoud, Y. A. (2003).
Functional modulation of the sodium pump: the regulatory proteins
"Fixit". News Physiol. Sci.
18,119
-124.
Crambert, G. and Geering, K. (2003). FXYD proteins: new tissue-specific regulators of the ubiquitous Na, K-ATPase. Sci. STKE 2003,RE1 .[Medline]
Crambert, G., Fuzesi, M., Garty, H., Karlish, S. and Geering,
K. (2002). Phospholemman (FXYD1) associates with Na,K-ATPase
and regulates its transport properties. Proc. Natl. Acad. Sci.
USA 99,11476
-11481.
Crambert, G., Li, C., Claeys, D. and Geering, K.
(2005). FXYD3 (Mat-8), a new regulator of Na, K-ATPase.
Mol. Biol. Cell 16,2363
-2371.
Crombie, H. J., Bell, M. V. and Tytler, P. (1996). Inhibition of sodium-plus-potassium-stimulated adenosine triphosphatase (Na+-K+-ATPase) by protein kinase C activators in the gills of Atlantic cod (Gadus morhua). Comp. Biochem. Physiol. 113B,765 -772.[CrossRef]
Dang, Z., Balm, P. H., Flik, G., Wendelaar Bonga, S. E. and Lock, R. A. (2000). Cortisol increases Na+/K+-ATPase density in plasma membranes of gill chloride cells in the freshwater tilapia Oreochromis mossambicus.J. Exp. Biol. 203,2349 -2355.[Abstract]
D'Cotta, H., Valotaire, C., le Gac, F. and Prunet, P.
(2000). Synthesis of gill Na+-K+-ATPase in
Atlantic salmon smolts: differences in
-mRNA and
-protein
levels. Am. J. Physiol.
278,R101
-R110.
Delprat, B., Schaer, D., Roy, S., Wang, J., Puel, J. L. and
Geering, K. (2007). FXYD6 is a novel regulator of Na,
K-ATPase expressed in the inner ear. J. Biol. Chem.
282,7450
-7456.
Epstein, F. H., Katz, A. I. and Pickford, G. E.
(1967). Sodium- and potassium-activated adenosine triphosphatase
of gills: role in adaptation of teleosts to salt water.
Science 156,1245
-1247.
Evans, D. H., Piermarini, P. M. and Choe, K. P.
(2005). The multifunctional fish gill: dominant site of gas
exchange, osmoregulation, acid-base regulation, and excretion of nitrogenous
waste. Physiol. Rev. 85,97
-177.
Feraille, E. and Doucet, A. (2001).
Sodium-potassium-adenosinetriphosphatase-dependent sodium transport in the
kidney: hormonal control. Physiol. Rev.
81,345
-418.
Feschenko, M. S., Donnet, C., Wetzel, R. K., Asinovski, N. K.,
Jones, L. R. and Sweadner, K. J. (2003). Phospholemman, a
single-span membrane protein, is an accessory protein of Na, K-ATPase in
cerebellum and choroid plexus. J. Neurosci.
23,2161
-2169.
Forbush, B., 3rd, Kaplan, J. H. and Hoffman, J. F. (1978). Characterization of a new photoaffinity derivative of ouabain: labeling of the large polypeptide and of a proteolipid component of the Na, K-ATPase. Biochemistry 17,3667 -3676.[CrossRef][Medline]
Fu, X. and Kamps, M. P. (1997). E2a-Pbx1
induces aberrant expression of tissue-specific and developmentally regulated
genes when expressed in NIH 3T3 fibroblasts. Mol. Cell.
Biol. 17,1503
-1512.
Garty, H. and Karlish, S. J. (2005). FXYD proteins: tissue-specific regulators of the Na, K-ATPase. Semin. Nephrol. 25,304 -311.[CrossRef][Medline]
Garty, H. and Karlish, S. J. (2006). Role of FXYD proteins in ion transport. Annu. Rev. Physiol. 68,431 -459.[CrossRef][Medline]
Garty, H., Lindzen, M., Scanzano, R., Aizman, R., Fuzesi, M., Goldshleger, R., Farman, N., Blostein, R. and Karlish, S. J. (2002). A functional interaction between CHIF and Na-K-ATPase: implication for regulation by FXYD proteins. Am. J. Physiol. 283,F607 -F615.
Geering, K. (2005). Function of FXYD proteins, regulators of Na, K-ATPase. J. Bioenerg. Biomembr. 37,387 -392.[CrossRef][Medline]
Helfman, G. S., Collette, B. B. and Facey, D. E. (1997). The Diversity of Fishes. Malden, MA: Blackwell Science.
Hwang, P. P. and Lee, T. H. (2007). New insights into fish ion regulation and mitochondrion-rich cells. Comp. Biochem. Physiol. 148,479 -497.
Johnson, M. R., Wang, K., Smith, J. B., Heslin, M. J. and Diasio, R. B. (2000). Quantitation of dihydropyrimidine dehydrogenase expression by real-time reverse transcription polymerase chain reaction. Anal. Biochem. 278,175 -184.[CrossRef][Medline]
Kamiya, M. and Utida, S. (1968). Changes in activity of sodium-potassium-activated adenosinetriphosphatase in gills during adaptation of the Japanese eel to sea water. Comp. Biochem. Physiol. 26,675 -685.[Medline]
Lansbery, K. L., Burcea, L. C., Mendenhall, M. L. and Mercer, R. W. (2006). Cytoplasmic targeting signals mediate delivery of phospholemman to the plasma membrane. Am. J. Physiol. 290,C1275 -C1286.[CrossRef]
Lee, T.-H., Hwang, P.-P., Lin, H.-C. and Huang, F.-L. (1996). Mitochondria-rich cells in the branchial epithelium of the teleost, Oreochromis mossambicus, acclimated to various hypotonic environments. Fish Physiol. Biochem. 15,513 -523.[CrossRef]
Lee, T. H., Hwang, P. P., Shieh, Y. E. and Lin, C. H. (2000). The relationship between `deep-hole' mitochondria-rich cells and salinity adaptation in the euryhaline teleost, Oreochromis mossambicus. Fish Physiol. Biochem. 23,133 -140.[CrossRef]
Lee, T.-H., Feng, S.-H., Lin, C.-H., Hwang, Y.-H., Huang, C.-L. and Hwang, P.-P. (2003). Ambient salinity modulates the expression of sodium pumps in branchial mitochondria-rich cells of mozambique tilapia, Oreochromis mossambicus. Zool. Sci. 20, 29-36.[CrossRef][Medline]
Lin, C. H., Huang, C. L., Yang, C. H., Lee, T. H. and Hwang, P. P. (2004a). Time-course changes in the expression of Na, K-ATPase and the morphometry of mitochondrion-rich cells in gills of euryhaline tilapia (Oreochromis mossambicus) during freshwater acclimation. J. Exp. Zool. A 301, 85-96.
Lin, C. H., Tsai, R. S. and Lee, T. H. (2004b). Expression and distribution of Na, K-ATPase in gill and kidney of the spotted green pufferfish, Tetraodon nigroviridis, in response to salinity challenge. Comp. Biochem. Physiol. 138A,287 -295.
Lin, Y. M., Chen, C. N. and Lee, T. H. (2003). The expression of gill Na, K-ATPase in milkfish, Chanos chanos, acclimated to seawater, brackish water and fresh water. Comp. Biochem. Physiol. 135A,489 -497.
Lin, Y. M., Chen, C. N., Yoshinaga, T., Tsai, S. C., Shen, I. D. and Lee, T. H. (2006). Short-term effects of hyposmotic shock on Na+/K+-ATPase expression in gills of the euryhaline milkfish, Chanos chanos. Comp. Biochem. Physiol. 143A,406 -415.
Lindzen, M., Aizman, R., Lifshitz, Y., Lubarski, I., Karlish, S.
J. and Garty, H. (2003). Structure-function relations of
interactions between Na, K-ATPase, the
subunit, and corticosteroid
hormone-induced factor. J. Biol. Chem.
278,18738
-18743.
Lubarski, I., Pihakaski-Maunsbach, K., Karlish, S. J.,
Maunsbach, A. B. and Garty, H. (2005). Interaction with the
Na,K-ATPase and tissue distribution of FXYD5 (related to ion channel).
J. Biol. Chem. 280,37717
-37724.
Mahmmoud, Y. A., Vorum, H. and Cornelius, F.
(2000). Identification of a phospholemman-like protein from shark
rectal glands: evidence for indirect regulation of Na, K-ATPase by protein
kinase C via a novel member of the FXYD family. J. Biol.
Chem. 275,35969
-35977.
Mahmmoud, Y. A., Cramb, G., Maunsbach, A. B., Cutler, C. P.,
Meischke, L. and Cornelius, F. (2003). Regulation of Na,
K-ATPase by PLMS, the phospholemman-like protein from shark: molecular
cloning, sequence, expression, cellular distribution, and functional effects
of PLMS. J. Biol. Chem.
278,37427
-37438.
Mahmmoud, Y. A., Vorum, H. and Cornelius, F.
(2005). Interaction of FXYD10 (PLMS) with Na, K-ATPase from shark
rectal glands: close proximity of Cys74 of FXYD10 to Cys254 in the a domain of
the
-subunit revealed by intermolecular thiol cross-linking.
J. Biol. Chem. 280,27776
-27782.
Marshall, W. S. (2002). Na+, Cl–, Ca2+ and Zn2+ transport by fish gills: retrospective review and prospective synthesis. J. Exp. Zool. 293,264 -283.[CrossRef][Medline]
Mercer, R. W., Biemesderfer, D., Bliss, D. P., Jr, Collins, J.
H. and Forbush, B., 3rd (1993). Molecular cloning and
immunological characterization of the gamma polypeptide, a small protein
associated with the Na, K-ATPase. J. Cell Biol.
121,579
-586.
Morrison, B. W., Moorman, J. R., Kowdley, G. C., Kobayashi, Y.
M., Jones, L. R. and Leder, P. (1995). Mat-8, a novel
phospholemman-like protein expressed in human breast tumors, induces a
chloride conductance in Xenopus oocytes. J. Biol.
Chem. 270,2176
-2182.
Palmer, C. J., Scott, B. T. and Jones, L. R.
(1991). Purification and complete sequence determination of the
major plasma membrane substrate for cAMP-dependent protein kinase and protein
kinase C in myocardium. J. Biol. Chem.
266,11126
-11130.
Pu, H. X., Cluzeaud, F., Goldshleger, R., Karlish, S. J. D.,
Farman, N. and Blostein, R. (2001). Functional role and
immunocytochemical localization of the
a and
b forms of the Na,
K-ATPase
subunit. J. Biol. Chem.
276,20370
-20378.
Rainboth, W. J. (1996). Fishes of the Cambodian Mekong. In FAO Species Identification Field Guide for Fishery Purposes, pp. 265. Rome: FAO.
Sakamoto, T., Uchida, K. and Yokota, S. (2001). Regulation of the ion-transporting mitochondrion-rich cell during adaptation of teleost fishes to different salinities. Zool. Sci. 18,1163 -1174.[CrossRef][Medline]
Scott, G. R., Richards, J. G., Forbush, B., Isenring, P. and Schulte, P. M. (2004). Changes in gene expression in gills of the euryhaline killifish Fundulus heteroclitus after abrupt salinity transfer. Am. J. Physiol. 287,C300 -C309.[CrossRef]
Seidelin, M., Madsen, S. S., Cutler, C. P. and Cramb, G.
(2001). Expression of gill vacuolar-type H+-ATPase
β subunit, and Na+, K+-ATPase
1 and β1
subunit messenger RNAs in smolting Salmo salar. Zool.
Sci. 18,315
-324.[CrossRef]
Shi, H., Levy-Holzman, R., Cluzeaud, F., Farman, N. and Garty, H. (2001). Membrane topology and immunolocalization of CHIF in kidney and intestine. Am. J. Physiol. 280,F505 -F512.
Silverman, B. Z., Fuller, W., Eaton, P., Deng, J., Moorman, J.
R., Cheung, J. Y., James, A. F. and Shattock, M. J. (2005).
Serine 68 phosphorylation of phospholemman: acute isoform-specific activation
of cardiac Na/K ATPase. Cardiovasc. Res.
65, 93-103.
Singer, T. D., Clements, K. M., Semple, J. W., Schulte, P. M., Bystriansky, J. S., Finstad, B., Fleming, I. A. and McKinley, R. S. (2002). Seawater tolerance and gene expression in two strains of Atlantic salmon smolts. Can. J. Fish. Aquat. Sci. 59,125 -135.[CrossRef]
Stanwell, C., Gescher, A., Bradshaw, T. D. and Pettit, G. R. (1994). The role of protein kinase C isoenzymes in the growth inhibition caused by bryostatin 1 in human A549 lung and MCF-7 breast carcinoma cells. Int. J. Cancer 56,585 -592.[Medline]
Sweadner, K. J. and Rael, E. (2000). The FXYD gene family of small ion transport regulators or channels: cDNA sequence, protein signature sequence, and expression. Genomics 68, 41-56.[CrossRef][Medline]
Takeyasu, K., Tamkun, M. M., Renaud, K. J. and Fambrough, D.
M. (1988). Ouabain-sensitive (Na+ +
K+)-ATPase activity expressed in mouse L cells by transfection with
DNA encoding the
-subunit of an avian sodium pump. J. Biol.
Chem. 263,4347
-4354.
Therien, A. G. and Blostein, R. (2000). Mechanisms of sodium pump regulation. Am. J. Physiol. 279,C541 -C566.
Therien, A. G., Pu, H. X., Karlish, S. J. and Blostein, R. (2001). Molecular and functional studies of the gamma subunit of the sodium pump. J. Bioenerg. Biomembr. 33,407 -414.[CrossRef][Medline]
Tipsmark, C. K. (2008). Identification of FXYD protein genes in a teleost: tissue-specific expression and response to salinity change. Am. J. Physiol. 294,R1367 -R1378.
Tipsmark, C. K., Madsen, S. S., Seidelin, M., Christensen, A. S., Cutler, C. P. and Cramb, G. (2002). Dynamics of Na+, K+, 2Cl- cotransporter and Na+, K+-ATPase expression in the branchial epithelium of brown trout (Salmo trutta) and Atlantic salmon (Salmo salar). J. Exp. Zool. 293,106 -118.[CrossRef][Medline]
Tipsmark, C. K., Madsen, S. S. and Borski, R. J. (2004). Effect of salinity on expression of branchial ion transporters in striped bass (Morone saxatilis). J. Exp. Zool. A 301,979 -991.
Uchida, K., Kaneko, T., Miyazaki, H., Hasegawa, S. and Hirano, T. (2000). Excellent salinity tolerance of Mozambique tilapia (Oreochromis mossambicus): elevated chloride cell activity in the branchial and opercular epithelia of the fish adapted to concentrated seawater. Zool. Sci. 17,149 -160.[CrossRef]
Wetzel, R. K. and Sweadner, K. J. (2001).
Immunocytochemical localization of Na-K-ATPase
- and
-subunits
in rat kidney. Am. J. Physiol.
281,F531
-F545.
Wetzel, R. K. and Sweadner, K. J. (2003). Phospholemman expression in extraglomerular mesangium and afferent arteriole of the juxtaglomerular apparatus. Am. J. Physiol. 285,F121 -F129.
Wu, Y. C., Lin, L. Y. and Lee, T. H. (2003). Na,K,2Cl-cotransporter: a novel marker for identifying freshwater- and seawater-type mitochondria-rich cells in gills of euryhaline tilapia, Oreochromis mossambicus. Zool. Stud. 42,186 -192.
Yamaguchi, F., Yamaguchi, K., Tai, Y., Sugimoto, K. and Tokuda, M. (2001). Molecular cloning and characterization of a novel phospholemman-like protein from rat hippocampus. Mol. Brain Res. 86,189 -192.[Medline]
Zhang, X. Q., Qureshi, A., Song, J., Carl, L. L., Tian, Q., Stahl, R. C., Carey, D. J., Rothblum, L. I. and Cheung, J. Y. (2003). Phospholemman modulates Na+/Ca2+ exchange in adult rat cardiac myocytes. Am. J. Physiol. 284,H225 -H233.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||