|
| |
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online October 17, 2008
Journal of Experimental Biology 211, 3401-3408 (2008)
Published by The Company of Biologists 2008
doi: 10.1242/jeb.022376
Molecular and biological characterization of the Amblyomma americanum organic anion transporter polypeptide
Texas A&M University, College of Agriculture and Life Sciences, Department of Entomology, 2475 TAMU, Minnie Belle Heep Center, College Station, TX 77843, USA
* Author for correspondence (e-mail: a-mulenga{at}tamu.edu)
Accepted 19 August 2008
 |
Summary |
|---|
 TOP Summary INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONReferences |
|---|
Key words: organic anion transporting polypeptide, RNAi gene silencing, Amblyomma americanum, tick feeding
|
INTRODUCTION |
|---|
|
TOPSummaryINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONReferences |
|---|
). They
transmit the highest number of pathogens of all known vector arthropods and
are considered second only to mosquitoes in terms of the importance of the
vectored human pathogens they carry
(Sonenshine, 1993). In the
livestock industry, annual monetary losses due to ticks and tick-borne
diseases amount to millions of dollars
(Jongejan and Uilenberg, 2004;
Guerrero et al., 2006). The
control of ticks and tick-borne diseases has primarily been achieved by
acaricide application, which has led to the selection of resistant tick
populations, and contamination of the environment and of animal products
(de la Fuente and Kocan, 2006).
To forestall the possibility of failed tick control programs, development of a
new generation of tick control methods has been advocated
(Willadsen, 1990). The
limiting step to this has been the lack of effective targets that, if
disrupted alone or in a cocktail with others, will impede tick feeding success
and/or pathogen acquisition and transmission. Our laboratory is investigating
the molecular basis of how ticks begin to feed as a means of discovering new
targets for rational design of novel tick control methods. We recently
identified a putative Amblyomma americanum tick organic anion
transporter polypeptide among genes that are induced or differentially
upregulated in ticks that have attained appetence and/or been exposed to
feeding stimuli (Mulenga et al.,
2007).
The organic anion transporting polypeptides [abbreviated as `Oatp' in
non-human organisms and `OATP' in humans
(Meier-Abt et al., 2005;
Konig et al., 2006;
Hagenbuch and Meir, 2004)] are
gene products of the recently recognized solute carrier gene superfamily
[non-human, Slco; human, SLCO
(Meier-Abt et al., 2005)].
Oatp/OATP proteins have been identified in a broad range of organisms,
including rodents, humans, chickens, zebrafish, frog and insects
(Hagenbuch and Meier, 2004).
They are multi-specific Na+-independent transmembrane transporters
that are found in a wide spectrum of endogenous and xenobiotic amphipathic
substrates, such as bile acids, bilirubin, thyroid hormones, prostanoids
(prostaglandins and leukotrienes), neutral steroids (such as cardiac
glycosides, ouabain and digoxin) and numerous other drugs
(Meier-Abt et al., 2004;
Konig et al., 2006;
Niemi, 2007;
Pizzagalli et al., 2002). In
humans, one of the important physiological functions of the Oatp/OATP proteins
is their role as components of the detoxifying mechanism of the body
(Kasuhara and Sugiyama, 2005;
Naud et al., 2007). Liver-,
kidney- or the blood–brain barrier-expressed Oatp/OATP proteins mediate
uptake of potentially toxic amphipathic substances from blood circulation into
cells of these organs, where they are inactivated and then excreted as
harmless by-products (Kasuhara and
Sugiyma, 2005; Naud et al.,
2007). Similarly, a recent study
(Torrie et al., 2004) suggests
that Oatp proteins may be part of the detoxification mechanism in insects.
These authors recently explained the paradox of why ouabain, a cardiac
glycoside and potent inhibitor of Na+, K+ and ATPase,
fails to inhibit fluid secretion by Malpighian tubules in many insects, by
linking its clearance from the basolateral folding of Drosophila
renal tubules to expression of Oatp58Db.
The aim of this study was to characterize the full sequence of AamOatp and validate its importance in tick feeding. We have provided evidence showing that AamOatp is constitutively and ubiquitously expressed, and that changing physiological needs during the tick feeding process influence its transcription patterns. Our data also show that RNAi mediated suppression of the AamOatp caused ticks to obtain smaller blood meals and consequently to lay fewer eggs.
|
MATERIALS AND METHODS |
|---|
|
TOPSummaryINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONReferences |
|---|
). Ticks
partially fed for 24, 48, 72, 96, 120 and 168 hours were detached and rinsed
in 70% ethanol and then washed in sterile 0.1% diethyl pyrocarbonate (DEPC)
treated water. Washed ticks were placed onto a glass slide with a pair of soft
tissue forceps and their edges were trimmed off using a sharp and sterile
razor blade. After trimming, the tick was transferred onto the concavity of a
hanging drop slide filled with 200 µl of DEPC treated water. Under a
dissection microscope, the dorsal cuticle flap was lifted and tick organs:
salivary glands (SG), midgut (MG) and ovary (OV) were teased out using an
18-gauge needle and a soft tissue forceps. All dissected tissues, including
the carcass (CA), which represents the tick remnant after removal of SG, MG
and OV, were homogenized in Trizol (Invitrogen, Carlsbad, CA, USA), the total
RNA extraction reagent, and then stored at –80°C until needed. Prior
to RNA extraction, whole ticks were rinsed in 70% ethanol, air dried,
pulverized in liquid nitrogen and immediately transferred to the Trizol
reagent. Total RNA was isolated by isopropanol precipitation and reconstituted
in RNAse free water. Subsequently, mRNA was isolated from purified total RNA
of unfed ticks using the Poly (A) Purist kit (Ambion, Austin, TX, USA)
according to instructions provided by the manufacturer.
Cloning of full-length A. americanum (Aam) organic anion transporter polypeptide (Oatp)
To clone the full-length AamOatp cDNA, 2 µg of mRNA was used to
synthesize the 3' and 5' adapter-linked cDNA templates according
to instructions in the RLM rapid amplification of cDNA ends (RACE) protocol
(Ambion). 3' and 5' RACE PCR primers that were synthesized based
on a previously cloned AamOATP cDNA fragment
(Mulenga et al., 2007).
Subsequently, these primers were used to amplify and clone the full-length
cDNA using high-fidelity Taq polymerase (Applied Biosystems, Foster City, CA,
USA) for long-distance PCR. PCR amplicons were routinely cloned in the TOPO
PCR4 plasmid (Invitrogen) and sequencing was accomplished using the Bigdye
terminator (Applied Biosystems), M13 forward and reverse primers, and internal
primers were necessary. DNA sequence analysis was routinely carried out using
the VectorNTI software (Invitrogen academic license).
Identification of AamOatp homologs in Ixodes scapularis genome
To identify homologs in the Ixodes scapularis Say genome, the
FASTA3 software version 3.4 (Pearson and
Lipman, 1988) was used to perform a local BLASTX scan of
supercontig downloads from vector base
(Lawson et al., 2007)
(http://iscapularis.vectorbase.org/
GetData/Downloads) using the deduced AamOatp as query. To identify
coding exons, the retrieved I. scapularis supercontigs were scanned
against Drosophila sequences using BLASTX analysis. Subsequently,
best matches from the BLASTX scan and the AamOatp deduced protein
were aligned with I. scapularis supercontigs using GenomeScan
(Burge and Karlin, 1998) or the
NetGene2 (Hebsgaard et al.,
1996) servers to delineate introns and exons regions boundaries.
The predicted exon regions marked by the `AT' acceptor and `GT' donor splice
sites were manually assembled and translated using VectorNTI (Invitrogen).
Multiple sequence alignments and phylogeny analysis
Identity and similarity comparison with other sequences was accomplished
using the BLASTX analysis at the NCBI. the levels of identical amino acids
between AamOatp and other Oatp/OATP sequences were determined by
pairwise alignment analyses using the VectorNTI software. The guide phylogeny
tree was constructed from the dataset of Oatp/OATP protein sequence download
from GenBank and four tick Oatp sequences (one from this study and three from
the I. scapularis genome project) using the `neighbor joining'
method. Specifications were set for bootstrap values at 1000 replications with
gaps proportionately distributed and correction for distance set to a `Poisson
distribution'.
Tissue distribution analyses
To determine spatial and temporal expression profiles, DNAse-treated total
RNA from SG, MG, OV and CA dissected from partially fed ticks (24, 48, 96, 120
and 168 h) was subjected to two-step semi-quantitative RT-PCR. Approximately 5
µg of total RNA was used to synthesize the first-strand cDNA template using
the Verso cDNA kit (Thermo Fisher Scientific, Pittsburgh, PA, USA). 1 µl of
the first strand cDNA was used as template in a PCR reaction with
AamOatp specific primers. A 15 µl aliquot of the PCR product was
electrophoresed on a 2% agarose gel containing 1 µg ethidium bromide.
To determine AamOatp mRNA abundance, densitograms of amplified PCR
bands were determined using the web-based ImageJ image analyzer software
(http://rsb.info.nih.gov/ij/).
To correct for any differences resulting from variations between template
concentrations, densities of detected PCR bands were normalized according to
the following formula:
 |
RNA interference (RNAi) gene silencing
RNAi gene silencing was carried out according to previously published
methods (Nijhof et al., 2007;
de la Fuente et al., 2006;
Decrem et al., 2008;
Hatta et al., 2007). Using the
cloned AamOatp plasmid DNA as template and PCR primers (forward,
5'TAA TAC GAC TCA CTA TAG GGG GAC CCG GCA AGC ACT TGC TAG
TT3'; reverse, 5'TAA TAC GAC TCA CTA TAG GGT GTT CTT GGA
GAC CGC GTC CTC C3') with added T7 promoter sequence (in bold),
were used to amplify the template for AamOatp double-stranded RNA
(dsRNA). For negative control dsRNA, the green fluorescent protein (GFP) PCR
primers with added T7 promoter sequence (forward, 5'TAA TAC GAC TCA
CTA TAG GGTGGCCGCTTTACTTGTACAGC3'; reverse 5'TAA TAC GAC
TCA CTA TAG GG ACCGGTCGCCACCATGGT3') were used to amplify the
amplicon. Subsequently, dsRNA was synthesized in vitro using the
MegaScript RNAi kit according to instructions provided by the manufacturer
(Ambion). After purification of dsRNA, 20 unfed female ticks were
microinjected with 
1 µl (3 µg µl–1 in TE
buffer, pH 8.0) of AamOatp or GFP dsRNA via the groove between the
basis capituli and the scutum using half-inch 33-gauge needles attached to a
10µl gastight syringe (Hamilton, Reno, NV, USA). Injected ticks were kept
overnight at 22°C to observe any mortality resulting from injection
injury. Subsequently AamOatp- and GFP-dsRNA-injected and non-injected
control ticks (N=20) were put in cells that were secured on the back
of the calf using livestock identification cement (Nasco, Fort Atkinson, WI).
Ticks were allowed to feed until detachment.
|
To assess the effect of silencing AamOatp on tick-feeding success, tick-feeding parameters, including numbers of attached ticks 24 h post-attachment, mortality, time of feeding to repletion, survival and engorgement masses (EM, measure of amount of blood imbibed) were evaluated. To assess the effects of AamOatp silencing on fecundity, the egg mass conversion ratios (EMCR) were compared between treatment and control ticks. This was accomplished by incubating engorged ticks at 25°C for 20 days to allow them to lay eggs and then the egg masses were weighed. The EMCR was calculated by mass of the egg mass as a fraction of the EM. A web-based unpaired Student's t-test (GraphPad t-test calculator, www.graphpad.com/quickcalcs/ttest1.cfm) was used to test the statistical significance of the differences that were observed between AamOatp-dsRNA-injected ticks and control groups.
|
|
RESULTS |
|---|
|
TOPSummaryINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONReferences |
|---|
) was based on its similarity to previously characterized
proteins (data not shown). When scanned against known protein entries in
GenBank, the top 20 best matches to AamOatp were arthropod, including
fruit flies (Drosophila spp), the jewel wasp (Nansonia
vetripennis), the red flower beetle (Tribolium castaneum),
mosquitoes (Aedes and Anopheles spp) and honeybee (Apis
melifera) (data not shown). Hydropathy and bioinformatics analyses,
revealed that AamOatp contains the Kazal type serine proteinase
inhibitor domain in addition to all typical features of Oatp/OATP proteins: 12
transmembrane (TM) domains, a 13 amino acid signature motif,
D-X-RW-(I,V)-GAWW-X-G-(F,L replaced by Y)-L (replaced by I) and a large
extracellular region (ER) between the ninth and tenth TM domains
(Fig. 1). Consistent with other
sequences, 11 consensus cysteine residues that are present in the large ER of
all Oatp/OATP proteins (Meier-Abt et al.,
2005; Hagenbuch and Meier,
2003; Hagenbuch and Meier,
2004) are 100% conserved in AamOatp
(Fig. 1). Visual analysis of
the AamOatp deduced amino acid sequence revealed that, unlike most
known vertebrate Oatp/OATP protein sequences, which posses two putative
N-glycosylation sites, in the second and fifth ER
(Meier-Abt et al., 2005;
Hagenbuch and Meier, 2004) the
AamOatp protein posses one putative N-glycosylation site in its fifth
ER (Fig. 1). It is interesting
that the AamOatp protein also contains two additional putative
N-glycosylation sites. However, these may not be functional as they are
located within the second and fifth intracellular domains
(Fig. 1). When scanned against supercontigs of the I. scapularis genome, AamOatp produced hits to eight supercontigs (not shown), which were determined to contain 11 different I. scapularis (Isc) Oatp sequences. Because of gaps in supercontig sequences, eight of the 11 IscOatp sequences are partial and the rest could be assembled into complete open reading frames. Among the three complete sequences, AamOatp show 50/67% identity/similarity to IscOatp-1 (Fig. 1), 26/41% to IscOatp-2 and 21/42% to IscOatp-3 (not shown). Consistent with our multiple sequence alignment data in Fig. 1, phylogenetic analysis revealed that AamOatp sequence was closely related to IscOatp-1 (Fig. 2). From the phylogeny tree in Fig. 2, it is interesting to note that IscOatp-2 is distantly related to other arthropod sequences, but it is closely related to human OATP4A1. At the time of preparing this manuscript, the annotation of the I. scapularis genome had not been completed. Thus accession numbers of the primary sequences that were used to assemble ORFs, ABJB010623253.1, ABJB010665419.1 and ABJB010386346.1 for IscOatp-1, ABJB011035923.1 for IscOatp-2 and ABJB010326688.1 for IscOatp-3 are indicated.
Changing physiological needs during tick feeding influences transcriptional regulation of AamOatp
To assess temporal and spatial expression profiles of AamOatp mRNA
in tick organs (SG, MG, OV and CA) during tick feeding, total RNA of organs
from ticks that fed from 1–7 days, was subjected to semi-quantitative
RT-PCR analysis (Fig. 3).
Results summarized in Fig. 3A
show that AamOatp mRNA is ubiquitously expressed, as revealed by its
being amplified from cDNA of all tick organs. Analysis of the normalized
transcript abundance shown in Fig.
3B revealed that from day 1 to 5 of feeding, AamOatp mRNA
in the MG was 60–80-fold higher than levels found in SG, OV and CA.
By contrast, by day 7 of feeding, the AamOatp mRNA was
60–80-fold more strongly expressed in the OV than the SG, MG and CA
(Fig. 3B).
|
Silencing of AamOatp caused ticks to obtain significantly smaller blood meals and diminish their egg mass conversion ratio
Qualitative two-step RT-PCR expression analysis summarized in
Fig. 4 was used to validate the
RNAi-mediated silencing of AamOatp mRNA. On the basis of detectable
PCR bands amplified by 40 PCR cycles, complete silencing of AamOatp
was confirmed in two out of the three ticks tested
(Fig. 4). In order to assess
the effect of silencing on tick-feeding efficiency, feeding parameters were
compared between ticks that were injected with AamOatp-dsRNA and
those injected with GFP-dsRNA. Silencing of AamOatp did not affect
the ability of ticks to attach onto host skin, initiate and continue to feed
(results not shown). We also found that silencing of AamOatp did not
cause any mortality (results not shown).
|
|
|
|
DISCUSSION |
|---|
|
TOPSummaryINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONReferences |
|---|
).
This study describes the first report on biological and bioinformatics
characterization of an Oatp protein from a blood-feeding organism. Based on
data in this study, we are unable to determine conclusively whether or not the
AamOatp protein is functional. However, based on our bioinformatics
analyses, we believe that the AamOatp protein is likely to be a
functional transporter because of the high conservation of sequence structures
that are thought to be important for the transport function of Oatp/OATP
proteins (Meier-Abt et al.,
2005; Hänggi et al.,
2006). In a recent study, Hanggi et al.
(Hanggi et al., 2006) showed a
single mutation among the 11 consensus cysteine residues in the large ER
between TM9 and TM10 was enough to destroy the transport function of the
OATP2B1 protein. Given that these cysteine residues are 100% conserved in the
AamOatp, it is a good indicator that this protein is likely to be
functional.
In humans, mice and rats, at least 39 Oatp/OATP proteins were described by
2005 (Meier-Abt et al., 2005).
Given that the A. americanum genome has not been sequenced, the full
repertoire of Oatp proteins in this tick will remain unknown. However, based
on our analysis of supercontigs of the I. scapularis genome, ticks
may encode at least 11 different Oatp proteins. In a recent study, Hagenbuch
and Meir (Hagenbuch and Meir,
2004) suggested a new classification system of Oatp/OATP proteins,
where sequences that show 
40% identity belonged into the same family and
those showing 60% identity being further classified into a subfamily. On
the basis of this classification system, the four tick Oatp proteins in this
study (three IscOatp and the AamOatp proteins) may be
classified into at least three families: AamOatp and
IscOatp-1, which are 56% identical belonging to the same family; with
IscOatp-2 and -3, which showed <40% identity to any of the
sequences, belonging to distinct families. From our phylogenetic analysis
data, it was interesting that IscOatp-3 was more closely related to
the human OATP4A1 protein than to other arthropod sequences. OATP4A1 is a
known transporter of prostaglandin, among other substrates
(Gao et al., 2005). Ticks do
synthesize prostaglandins (PGs), which are thought to play a role in
facilitation of tick–host interactions
(Bowman et al., 1996). The
in vivo transport of tick PGs has not been studied. It will be
interesting to investigate whether IscOatp-3, similar to OATP4A1, is
also involved in transport of PGs.
An important component of this study was to gain insight on the potential of AamOatp as a druggable or an anti-tick vaccine target. Our RNAi data suggest that AamOatp represents an important anti-tick target, as its silencing caused ticks to obtain significantly smaller blood meals. Although, silencing of AamOatp did not prevent ticks from attaching and starting to feed, these findings suggest that AamOatp may play a role in the processing of host blood meal. It is noteworthy that, although silencing of AamOatp did not prevent egg laying, it reduced the ability of these ticks to convert their blood meals into eggs. A potential limitation to our approach is that we could not account for the actions of the pre-existing AamOatp protein prior to silencing. Our speculation is that, after silencing of the AamOatp mRNA, the pre-existing AamOatp protein will still be viable and thus the effects of silencing would not be immediate. This might explain the seemingly lack of impact of AamOatp silencing on early tick-feeding parameters, attachment onto host skin and beginning to feed.
Consistent with vertebrate Oatp/OATP genes that show multiple tissue
expression patterns (St-Pierre et al.,
2002; Gao et al.,
2005; Choudhuri et al.,
2003), our RT-PCR expression analyses data revealed that
AamOatp mRNA is both constitutively and ubiquitously expressed, as it
was it is expressed in all tested organs of ticks that fed for 1–7 days.
Transcriptional regulation of tick genes has been shown in response to blood
meal feeding, being either shut down or induced, up- or down regulated
(Leboule et al., 2002a;
Leboule et al., 2002b;
Mulenga et al., 2001;
Rudenko et al., 2005). In the
case of AamOatp, the switch in expression pattern, from being
predominant in the midgut during the first 5 days of feeding and the ovary, by
day 7 of feeding suggest that AamOatp is transcriptionally regulated
in response to changing physiological needs as tick feeding progresses. The
first 5 days of feeding, when AamOatp is strongly expressed in the
MG, correspond to the slow feeding phase (SFP) of the tick feeding cycle. This
phase prepares the tick for the rapid feeding phase (RFP), during which it
feeds to repletion (Sonenshine,
1993; Bowman et al.,
1996; Reuben,
2007). Day 7 of tick feeding corresponds to the beginning of the
RFP, and is when predominant expression of AamOatp switches to the
ovary. Assuming that the AamOatp protein expression profiles are
correlated with transcript production, we speculate that during the first 5
days of feeding, AamOatp is involved in transport of key nutrients
(s) from host blood into tick hemolymph. Subsequently, as the tick feeds to
repletion, AamOatp could be involved in transporting nutrients from
hemolymph into the ovary for egg development. It is interesting that the
thyroid hormone derivatives thyroxine and triidothyronine, which are
transported across cell membranes by Oatp/OATP proteins
(Hagenbuch and Meir, 2004;
Pizzagalli et al., 2002), have
been linked to embryo development in birds (Willson and McNabb, 1997). Whether
or not this is the case in ticks is not known. However, if it were the case,
it will be interesting to investigate whether the biological functions of the
AamOatp protein are related to egg development. Whether or not the
silencing of AamOatp reduces the efficiency of the tick to convert
its blood meal to eggs is an indication of this possibility is not currently
known.
Because of their ubiquitous distribution and their wide activity range as
transporters of several drugs, the role of Oatp/OATP proteins in drug
disposition, bio-distribution and absorption is emerging
(van Montfoort et al., 2003;
Faber et al., 2003;
Mizuno et al., 2003;
Gerloff, 2004;
Niemi, 2007;
Bachmakov et al., 2008). This
study presents a framework for similar studies to be carried out in ticks.
Although only a single study has linked the Oatp transmembrane transport
function to the detoxification mechanisms in arthropods
(Torrie et al., 2004), these
proteins represent significant druggable or anti-tick vaccine targets as their
blockade could prevent ticks from excreting important chemical compounds. As
anti-tick vaccine targets, another attractive feature of these proteins is
that they are mostly localized on cell surfaces
(St-Pierre et al., 2002),
which will make them accessible to host antibodies. The next phase of this
research will be to characterize the transport functions of AamOatp
and whether or they could be targeted for tick control.
|
Acknowledgments |
|---|
|
References |
|---|
|
TOPSummaryINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONReferences |
|---|
Bachmakov, I., Glaeser, H., Fromm, M. F. and König, J.
(2008). Interaction of oral antidiabetic drugs with hepatic
uptake transporters: focus on OATPs and OCT1. Diabetes
57,1463
-1469.
Bowman, A. S., Dillwith, J. W. and Sauer, J. R. (1996). Tick salivary prostaglandins: presence, origin and significance. Parasitol. Today 12,388 -396.[CrossRef][Medline]
Burge, C. B. and Karlin, S. (1998). Finding the genes in genomic DNA. Curr. Opin. Struct. Biol. 8, 346-354.[CrossRef][Medline]
Choudhuri, S., Cherrington, N. J., Li, N. and Klaassen, C.
D. (2003). Constitutive expression of various xenobiotic and
endobiotic transporter mRNAs in the choroid plexus of rats. Drug
Metab Dispos. 31,1337
-1345.
de la Fuente, J. and Kocan, K. M. (2006). Strategies for development of vaccines for control of ixodid tick species. Parasite Immunol. 28,275 -283.[CrossRef][Medline]
de la Fuente, J., Almazán, C., Blas-Machado, U., Naranjo, V., Mangold, A. J., Blouin, E. F., Gortazar, C. and Kocan, K. M. (2006). The tick protective antigen, 4D8, is a conserved protein involved in modulation of tick blood ingestion and reproduction. Vaccine 24,4082 -4095.[CrossRef][Medline]
Decrem, Y., Mariller, M., Lahaye, K., Blasioli, V., Beaufays, J., Zouaoui, B. K., Vanhaeverbeek, M., Cérutti, M., Brossard, M., Vanhamme, L. et al. (2008). The impact of gene knock-down and vaccination against salivary metalloproteases on blood feeding and egg laying by Ixodes ricinus. Int. J. Parasitol. 38,549 -560.[CrossRef][Medline]
Faber, K. N., Müller, M. and Jansen, P. L. (2003). Drug transport proteins in the liver. Adv. Drug Deliv. Rev. 55,107 -124.[CrossRef][Medline]
Gao, B., Huber, R. D., Wenzel, A., Vavricka, S. R., Ismair, M. G., Remé, C. and Meier, P. J. (2005). Localization of organic anion transporting polypeptides in the rat and human ciliary body epithelium. Exp. Eye Res. 80, 61-72.[CrossRef][Medline]
Gerloff, T. (2004). Impact of genetic polymorphisms in transmembrane carrier-systems on drug and xenobiotic distribution. Naunyn Schmiedebergs Arch. Pharmacol. 369, 69-77.[CrossRef][Medline]
Guerrero, F. D., Nene, V. M., George, J. E., Barker, S. C. and Willadsen, P. (2006). Sequencing a new target genome: the Boophilus microplus (Acari: Ixodidae) genome project. J. Med. Entomol. 43,9 -16.[CrossRef][Medline]
Hagenbuch, B. and Meier, P. J. (2003). The superfamily of organic anion transporting polypeptides. Biochim. Biophys. Acta 1609,1 -18.[Medline]
Hagenbuch, B. and Meier, P. J. (2004). Organic anion transporting polypeptides of the OATP/SLC21 family: phylogenetic classification as OATP/SLCO superfamily, new nomenclature and molecular/functional properties. Pflugers Arch. 447,653 -665.[CrossRef][Medline]
Hänggi, E., Grundschober, A. F., Leuthold, S., Meier, P. J.
and St-Pierre, M. V. (2006). Functional analysis of the
extracellular cysteine residues in the human organic anion transporting
polypeptide, OATP2B1. Mol. Pharmacol.
70,806
-817.
Hatta, T., Umemiya, R., Liao, M., Gong, H., Harnnoi, T., Tanaka, M., Miyoshi, T., Boldbaatar, D., Battsetseg, B., Zhou, J. et al. (2007). RNA interference of cytosolic leucine aminopeptidase reduces fecundity in the hard tick, Haemaphysalis longicornis. Parasitol Res. 100,847 -854.[CrossRef][Medline]
Hebsgaard, S. M., Korning, P. G., Tolstrup, N., Engelbrecht, J.,
Rouze, P. and Brunak, S. (1996). Splice site prediction in
Arabidopsis thaliana DNA by combining local and global sequence information.
Nucleic Acids Res. 24,3439
-3452.
Jongejan, F. and Uilenberg, G. (2004). The global importance of ticks. Parasitology 129,S3 -S14.[CrossRef][Medline]
König, J., Seithel, A., Gradhand, U. and Fromm, M. F. (2006). Pharmacogenomics of human OATP transporters. Naunyn Schmiedebergs Arch. Pharmacol. 372,432 -443.[CrossRef][Medline]
Kusuhara, H. and Sugiyama, Y. (2005). Active
efflux across the blood-brain barrier: role of the solute carrier family.
NeuroRx 2,73
-85.
Lawson, D., Arensburger, P., Atkinson, P., Besansky, N. J.,
Bruggner, R. V., Butler, R., Campbell, K. S., Christophides, G. K., Christley,
S., Dialynas, E. et al. (2007). VectorBase: a home for
invertebrate vectors of human pathogens. Nucleic Acids
Res. 35 (Database issue),D503
-505.
Leboule, G., Crippa, M., Decrem, Y., Meijri, N., Brossard, M.,
Bollen, A. and Godfroid, E. (2002a). Characterization of a
novel salivay immuno suppressive protein from Ixodes ricinus ticks.
J. Biol. Chem. 277,10083
-10089.
Leboule, G., Rochez, C., Louahed, J., Rutti, B., Brossard, M., Bollen, A. and Godfroid, E. (2002b). Iolation of Ixodes ricinus salivary gland mRNAs encoding factors induced during the blood feeding. Am. J. Trop. Med. Hyg. 66,225 -233.[Abstract]
Meier-Abt, F., Faulstich, H. and Hagenbuch, B. (2004). Identification of phalloidin uptake systems of rat and human liver. Biochim. Biophys. Acta 1664,64 -69.[Medline]
Meier-Abt, F., Mokrab, Y. and Mizuguchi, K. (2005). Organic anion transporting polypeptides of the OATP/SLCO superfamily: identification of new members in nonmammalian species, comparative modeling and a potential transport mode. J. Membr. Biol. 208,213 -227.[CrossRef][Medline]
Mizuno, N., Niwa, T., Yotsumoto, Y. and Sugiyama, Y.
(2003). Impact of drug transporter studies on drug discovery and
development. Pharmacol. Rev.
55,425
-461.
Mulenga, A., Sugimoto, C., Ingram, G., Ohashi, K. and Onuma, M. (2001). Characterization of two cDNAs encoding serine proteinases from the hard tick Haemaphysalis longicornis. Insect Biochem. Mol. Biol. 31,817 -825.[CrossRef][Medline]
Mulenga, A., Macaluso, K. R., Simser, J. A. and Azad, A. F. (2003). The American dog tick, Dermacentor variabilis, encodes a functional histamine release factor homolog. Insect Biochem. Mol. Biol. 33,911 -919.[CrossRef][Medline]
Mulenga, A., Blandon, M. and Khumthong, R. (2007). The molecular basis of the Amblyomma americanum tick attachment phase. Exp. Appl. Acarol. 41,267 -287.[CrossRef][Medline]
Naud, J., Michaud, J., Leblond, F. A., Lefrancois, S., Bonnardeaux, A. and Pichette, V. (2007). Effects of chronic renal failure on liver drug transporters. Drug Metab. Dispos. 36,124 -128.[CrossRef][Medline]
Niemi, M. (2007). Role of OATP transporters in the disposition of drugs. Pharmacogenomics 28,787 -802.
Nijhof, A. M., Taoufik, A., de la Fuente, J., Kocan, K. M., de Vries, E. and Jongejan, F. (2007). Gene silencing of the tick protective antigens, Bm86, Bm91 and subolesin, in the one-host tick Boophilus microplus by RNA interference. Int. J. Parasitol. 37,653 -662.[CrossRef][Medline]
Pearson, W. R. and Lipman, D. J. (1988).
Improved tools for biological sequence comparison. Proc. Natl Acad.
Sci. USA 85,2444
-2448.
Pizzagalli, F., Hagenbuch, B., Stieger, B., Klenk, U., Folkers,
G. and Meier, P. J. (2002). Identification of a novel human
organic anion transporting polypeptide as a high affinity thyroxine
transporter. Mol. Endocrinol.
16,2283
-2296.
Reuben, K. W. (2007). Gluttony and sex in female ixodid ticks: how do they compare to other blood-sucking arthropods? J. Insect Physiol. 53,264 -273.[CrossRef][Medline]
Rudenko, N., Golovchenko, M., Edwards, M. J. and Grubhoffer, L. (2005). Differential expression of Ixodes ricinus tick genes induced by blood feeding or Borrelia burgdorferi infection. J. Med. Entomol. 42,36 -41.[CrossRef][Medline]
Sonenshine, D. E. (1993). Biology of Ticks. Oxford: Oxford University Press.
St-Pierre, M. V., Hagenbuch, B., Ugele, B. P. J., Meier, P. J.
and Stallmach, T. (2002). Characterization of an Organic
Anion-Transporting Polypeptide (OATP-B) in human placenta. J. Clin.
Endocrinol. Metab. 87,1856
-1863.
Torrie, L. S., Radford, J. C., Southall, T. D., Kean, L.,
Dinsmore, A. J., Davies, S. A. and Dow, J. A. (2004).
Resolution of the insect ouabain paradox. Proc. Natl. Acad. Sci.
USA 101,13689
-13693.
van Montfoort, J. E., Hagenbuch, B., Groothuis, G. M., Koepsell, H., Meier, P. J. and Meijer, D. K. (2003). Drug uptake systems in liver and kidney. Curr. Drug Metab. 4, 185-211.[CrossRef][Medline]
Willadsen, P. (1990). Perspectives for subunit vaccines for the control of ticks. Parassitologia 32,195 -200.[Medline]
Wilson, C. M. and McNabb, F. M. (1997). Maternal thyroid hormones in Japanese quail eggs and their influence on embryonic development. Gen. Comp. Endocrinol. 107,153 -165.[CrossRef][Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
