|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online May 30, 2008
Journal of Experimental Biology 211, 1919-1926 (2008)
Published by The Company of Biologists 2008
doi: 10.1242/jeb.013748
Evaluation of thyroid-mediated otolith growth of larval and juvenile tilapia

1 Institute of Oceanography, College of Science, National Taiwan University,
Taipei, Taiwan, Republic of China
2 Department of Aquatic Biosciences, College of Life Science, National Chiayi
University, Chiayi, Taiwan, Republic of China
3 St Martin De Porres Hospital, Chiayi, Taiwan, Republic of China
4 Institute of Cellular and Organismic Biology, Academia Sinica, Taipei, Taiwan,
Republic of China
Author for correspondence (e-mail:
pphwang{at}gate.sinica.edu.tw)
Accepted 1 April 2008
| Summary |
|---|
|
|
|---|
and TRβ) were cloned and only the expression
of TR
mRNA, quantified by real-time PCR, was similar to the
T3 profile. Variations in otolith growth showed median correlation
with the T3 profile and TR
mRNA expression pattern.
Hypothyroidism and hyperthyroidism were induced in tilapia juveniles and
larvae by administration of different concentrations of thiourea (TU) and
T3, respectively, for 13 days. T3 and TU had little
effect on otolith growth during the larval stage. However, T3
increased otolith growth and TU retarded, or stopped, otolith growth during
the juvenile stage. Furthermore, TU treatment caused permanent changes in
otolith shape in the ventral area. Otolith growth recovered slowly from
hypothyroidism, requiring 2 days to form an increment during the first week.
These results suggest that otolith growth, at least during the juvenile stage,
is regulated by the thyroid hormones and the process may be mediated by
TR
.
Key words: thyroid hormone, thyroid hormone receptor, thiourea, otolith, tilapia
| INTRODUCTION |
|---|
|
|
|---|
Otolith growth is influenced by exogenous factors, such as temperature
(Volk et al., 1999
) and
feeding (Baumann et al., 2005
)
as well as by endogenous factors, e.g. thyroid hormones
(Shiao and Hwang, 2004
) and
neuronal control (Anken et al., 2000). Among endogenous factors, hormones are
important in regulating numerous physiological process and developmental
events. Mugiya (Mugiya, 1990
)
demonstrated hormonal influence on otolith growth by hypophysectomizing
goldfish (Carassius auratus). Among the hormones, thyroid hormones
(THs) mainly function to control the growth, development, metabolism and
homeostasis of vertebrates (Brent,
1996
). Shiao and Hwang (Shiao
and Hwang, 2004
; Shiao and
Hwang, 2006
) further confirmed that thyroid hormones are necessary
for otolith growth during metamorphosis of leptocephalus tarpon (Megalops
cyprinoides). They suggested a positive correlation between thyroid
status and otolith growth based on the fact that hyperthyroidism increases
otolith growth while hypothyroidism retards or even stops otolith growth
during the metamorphosis of tarpons (Shiao
and Hwang, 2004
; Shiao and
Hwang, 2006
).
The spectacular metamorphosis of the tarpon, flounder and conger eel is
driven by a thyroxine surge (Miwa et al.,
1988
; Yamano et al.,
1991
), which is also presumably responsible for the abrupt
increase of otolith daily growth rate during leptocephalus metamorphosis
(Shiao and Hwang, 2004
;
Shiao and Hwang, 2006
). Most
teleosts do not show dramatic changes of morphology from larval to juvenile
stage. However, the metamorphosis of many teleostean larvae is also a
TH-dependent event, as shown in goldfish (Carassius auratus)
(Reddy and Lam, 1992
),
zebrafish (Danio rerio) (Brown,
1997
) and grouper (Epinephelus coioides)
(de Jesus et al., 1998
).
Furthermore, gonadal maturation and reproduction may also be mediated by
elevated thyroid status (Cyr and Eales,
1996
). Accordingly, otolith growth may change at certain
thyroid-mediated life history events. Otolith growth and its microstructure
are usually regarded as the proxy of fish growth and as the recorder of their
life histories. So far, the physiological basis, especially for
endocrine-mediated growth changes of the otolith is still poorly
understood.
Normal embryo development and fish growth depends on the programmed
secretion of thyroid hormones and the expression of thyroid hormone receptors
(TRs) (Yamano and Miwa, 1998
;
Liu and Chan, 2002
).
Disruption of thyroid hormonal secretion causes malformation of developing
organisms, including fish (Elsalini and
Rohr, 2003
). Furthermore, teleosts display unique and
characteristic otolith growth patterns, especially during the early stage of
development. How the programmed thyroid secretions affect the ontogenic
otolith growth is still unclear since no study has simultaneously examined the
TH content, TR expression and otolith growth. Therefore, this study aims to
evaluate (1) the relationship between otolith growth pattern and the
programmed secretion/expression of intrinsic TH and TR, (2) the effects of
abnormal thyroid secretion on otolith growth and morphology, (3) the recovery
of otolith growth from hypothyroidism. The experiments used tilapia larvae and
juveniles (Oreochromis mossambicus) under a manipulated laboratory
environment.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Chemicals
High concentrations of 3,5,3'-triiodothyronine (T3; 100
p.p.m.; Sigma) were dissolved in absolute ethanol then diluted to 10 p.p.b. or
25 p.p.b. in fresh water for use. Ethanol alone had no effect on fish growth
(data not shown). A stock solution of 10 000 p.p.m. thiourea (TU) was prepared
by dissolving 10 g TU powder in 1 l fresh water. TU is an anti-thyroid hormone
drug that inhibits the production of 3,5,3',5'-thyroxine
(T4) and T3 in the thyroid tissue. The stock solution
was diluted to 300, 600 and 900 p.p.m. for use.
Experiment 1
A batch of larvae from the same progenitors was reared in normal tap water
until 30 days post-hatching (d.p.h.). Every 2 days after hatching, five fish
were randomly picked for analysis and frozen in –80°C until
T3 quantification by radioimmunoassay (RIA; see below). Every 3
days after hatching, 8–10 fish were randomly selected for total RNA
extraction and their TR
and TRβ mRNA were
quantified by real-time PCR (see below). The remaining fish after 30 d.p.h.
were used to examine otolith growth.
Thyroid hormone and thiourea treatment of juvenile tilapia
Experiment 2
In order to evaluate the effects of T3 and TU administration on
thyroid hormone content of tilapia juveniles, the hatched larvae were reared
for 13 days to the juvenile stage, then fish were randomly transferred to one
of three aquaria that contained either normal tap water or tap water with 10
p.p.b. T3 or 300 p.p.m. TU for another 13 days. Then the fish were
stored at –80°C until T3 quantification.
Experiment 3
Hatched larvae were reared for 13 days to the juvenile stage. At 14 d.p.h.,
juveniles were immersed in 300 p.p.m. tetracycline solution (Sigma; pH
adjusted to 7.4) in the dark for 12 h to create a fluorescent mark in the
otolith. Fish were subjected to treatment the next day (15 d.p.h.). The
juveniles were reared in 0, 300, 600 and 900 p.p.m. thiourea (TU),
respectively for 13 days until 27 d.p.h. Before the otolith was removed for
observation, total length (from the tip of the mouth to the end of caudal fin)
was measured using a digital caliper (Mitutoyo, Kawasaki, Japan). Fish was
blotted on the Kimwipes tissue to remove the water on the body surface and wet
mass was measured using a digital balance.
Experiment 4
Another batch of larvae was also reared for 13 days and their otoliths were
marked with 300 p.p.m. tetracycline at 14 d.p.h. as described above. At 15
d.p.h. the fish were subjected to 0 p.p.b. T3, 0.1 p.p.b.
T3, 10 p.p.b. T3, 0.1 p.p.b. T3 + 300 p.p.m.
TU or 10 p.p.b. T3 + 300 p.p.m. TU for 13 days, until 27 d.p.h. All
the fish from experiments 4 and 5 were sacrificed at 28 d.p.h. for
morphological measurements i.e. total length (to 0.01 mm) and wet mass (to
0.01 mg), and for otolith examination.
Thyroid hormone and thiourea treatment of larval tilapia
Experiment 5
Fertilized eggs were incubated until hatching. Larvae at 3 d.p.h. were
immersed in 300 p.p.m. tetracycline solution for 12 h before the treatment.
Then fish were reared in normal tap water, 25 p.p.b. T3, 300 p.p.m.
TU or 25 p.p.b. T3 + 300 p.p.m. TU from 4–16 d.p.h. Fish were
sacrificed for measurement of total length, wet mass, otolith and
T3 contents on 17 d.p.h. However, otolith and T3
contents were not measured for the group treated with 25 p.p.b. T3
+ 300 p.p.m. TU because of the loss of the samples during preparation.
Recovery of otolith growth from hypothyroidism
Experiment 6
Tilapia juveniles at 14 d.p.h. were immersed in 300 p.p.m. tetracycline
solution for 12 h before being reared in 300 p.p.m. TU for 13 days. The fish
were transferred to water without TU at 28 d.p.h. and the fish were immersed
in 300 p.p.m. tetracycline solution for 12 h on 29, 31 and 33 d.p.h. (the
second, fourth and sixth days after recovery from TU treatment). The fish were
reared until 41 d.p.h. Total length and wet mass were measured and otoliths
were extracted for examination.
T3 quantification by radioimmunoassay (RIA)
Some of the juveniles that received the treatments described above were
used for T3 quantification using a commercial kit (DPC, Los
Angeles, CA, USA). Five individuals were pooled, weighed (wet mass), and
homogenized in a 99% methanol solution, vortexed for 1 min, then centrifuged
at 86 g at 4°C. The radius of the centrifuge rotor was 74
mm. The soluble layer was collected and oven dried at 37°C overnight.
Then, 200 µl EIA buffer (0.1 phosphate buffer, pH 7.4, 0.15 mol
l–1 NaCl) was added to dissolve the extracted thyroid
hormones. The extraction rate was 87.2%. Four plain 12x75 mm tubes for
total counts (T) and nonspecific binding (NSB) were prepared in duplicate, as
were 12 tubes for the standard (two for each), which contained T3
concentrations of 0, 0.2, 0.5, 1, 2 or 6 ng ml–1. These
control samples were used to generate the calibration curve. Then, 100 µl
of each control and extracted thyroid sample was mixed with
anti-T3, except for the T groups, and then mixed with 1 ml of
I125-T3 in the sealed tube. All tubes were incubated at
37°C for 2 h, with gentle shaking. After removing all visible moisture,
the immunoreactivity was read for 1 min using a gamma counter (MALLAC-1470,
Turku, Finland). Results were obtained in terms of concentration from a
logit-log representation of the calibration curve. Then the binding of each
pair of tube contents was determined as a percentage of maximum binding (MB),
with the NSB-corrected counts of the standards and samples taken as 100%:
![]() |
Cloning and quantification of thyroid hormone receptors
Total RNA was extracted from the whole juvenile tilapia following the
standard protocol using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Total
RNA (5 µg) was reverse-transcribed for cDNA synthesis using a kit (Qiagen,
Hilden, Germany). The resulting cDNA was amplified by PCR in a total volume of
50 µl with 2 µl cDNA template, 5 µl of 10x PCR buffer (100 mmol
l–1 Tris–HCl, 500 mmol l–1 KCl, 15
mmol l–1 MgCl2), 5 µl of 2.5 mmol
l–1 dNTP, 2 µl of forward and reverse primers, 0.5 µl
Taq DNA polymerase (5 i.u. µl–1) and 35.5 µl
distilled water. We used the same specific primer sequences as Marchand et al.
(Marchand et al., 2001
) for
the species Oreochromis niloticus. For the TR
amplification, the forward primer sequence was
5'-GCTGCATCATCGACAAGATC-3' and the reverse primer sequence was
5'GATCTGAGCTCATGAGAAGC3'. For TR
amplification,
the forward primer sequence was 5'AATGTGTTATTGACAAAGTG3' and the
reverse primer sequence was 5'-GATCGGATGAAAGCAGGATA-3'. The
amplified cDNA fragments were inserted into the pGEM-T easy vector (Promega,
Madison, WI, USA) and transformed into competent cells (ECOS9-5) for
amplification. The purified plasmids were subjected to DNA sequencing using an
automatic DNA sequencer (ABI 3700, Applied Biosystems, Wellesley, MA, USA).
Quantitative real-time PCR (qPCR) was carried out using a SYBR Green dye
(Qiagen, Hilden, Germany)-based assay with an ABI Prism 7000 Sequence
Detection System (Perkin-Elmer, Applied Biosystems, Wellesley, MA, USA)
according to the manufacturer's instructions. Primers targeting the
TR
and TRβ and the endogenous control gene,
β-actin, were designed using Primer Express 2.0 software (Applied
Biosystems). In each assay, 25 ng cDNA was amplified in a 20 µl reaction
containing 2xSYBR Green Master mix, 300 nmol l–1 of
forward and reverse primers, and nuclease-free water. The primers designed for
the consensus of TR
and TRβ isoforms were as
follows: TRβ-forward: 5'-GCTCAGGGCTCACAGTGGAA-3',
TR
-reverse: 5'-AACGACACGGGTGATGGC-3';
TRβ-forward: 5'-GGCAACCACTGGAAGCAGAA-3',
TRβ-reverse:
5'-TGATAATTTTTGTAAACTGACTGAAGGCT-3'.
Otolith preparation
Sagittal otoliths were removed under a stereomicroscope (Olympus SZX 12,
Tokyo, Japan), dried in air and embedded with Epofix resin (Struers,
Copenhagen, Denmark). The embedded otoliths were then sectioned using a
low-speed circular saw (Buehler Isomet, Evanston, IL, USA) to remove excess
resin. The otoliths were then ground and polished on a grinder-polisher
machine (Buehler Metaserv 2000, Evanston, IL, USA) at a speed of 300 r.p.m.
with wet-polisher paper of 2 000-grit for the initial grinding and 2 400-grit
for the final grinding until the core was exposed. The otolith was finally
polished with a polishing cloth and 0.05 µm alumina (Buehler) to smooth the
surface. During the grinding and polishing process, the otolith was
periodically checked under a compound light microscope. A fluorescence
microscope (Axioplan 2 Imaging MOT, Zeiss, Germany) with incident light from a
50 W mercury lamp and FITC filter sets was utilized to detect the fluorescent
ring on the ground surface of otoliths. Then, dilute HCl (0.05 mol
l–1) was used to etch the otolith for 20 s. Etching increased
the visibility of otolith increments by enhancing the contrast under a
compound light microscope. Images of fluorescent rings and the whole etched
otolith were recorded at 200x magnification under the light microscope
equipped with a digital camera (AxioCam HRm Zeiss). From the images,
measurements were made of otolith length and the width of individual
increments, as well as counts of daily growth increments and these were
processed on a personal computer using Image-Pro plus software (Media
Cybernetics Inc. 1994, Silver Spring, MD, USA). The measurements were made
along the maximum radius from the core to the posterior end of each otolith.
To observe the otolith topology, the sagittal otoliths were removed from the
fish, dried in the oven, and gold coated for observation by scanning electron
microscopy (FEI Quanta 200 SEM, FEI, Hillsboro, OR, USA).
|
mRNA expression patterns were
analyzed by Pearson product moment correlation. Statistical differences among
treatments were analyzed using one-way analysis of variance (ANOVA). Tukey's
pairwise comparison was used to identify groups that differed from others if
the data satisfactorily met the assumptions of normal distribution and equal
variance. Otherwise, the Kruskal–Wallis test on ranks and Dunn's
pairwise comparison were used to isolate the groups that differed from the
others. Statistical significance was set at
<0.05.
|
|
| RESULTS |
|---|
|
|
|---|
, TRβ mRNA expression and otolith growthThe trend of otolith growth was generally similar to the T3 profile. The width of the daily growth increment (DGI) slightly declined from 3 to 7 d.p.h., followed by a gradual increase to approximately 3 µm around 14 d.p.h. A high growth plateau was maintained until 22 d.p.h. then the daily otolith growth gradually decreased to approximately 1.3 µm by 29 to 31 d.p.h. (Fig. 1). A significant median correlation (correlation coefficient=0.681, P=0.021) occurred between the T3 and DGI profiles during the period from 3 to 25 d.p.h.
The partial DNA sequence of tilapia TR
and
TRβ genes were cloned and sequenced. The cloned sequences are
703 nucleotides and 730 nucleotides for TR
and
TRβ, respectively. The sequences were submitted to GenBank with
the accession no. EU048544 for TR
and EU048545 for
TRβ. The sequences were confirmed from the NCBI database and
phylogenetic tree analysis of the TR family from published species.
Quantitative analysis of the TR
mRNA expression suggested a
trend similar to the T3 contents and otolith growth; decreasing
from 3 to 9 d.p.h., followed by an increase until 15 d.p.h., then gradually
decreasing until 27 d.p.h. However, TRβ mRNA expression was low,
with no evident variation throughout the experimental period
(Fig. 2). A significant median
correlation was also observed for TR
and DGI profiles during
the period from 6 to 27 d.p.h. (correlation coefficient=0.63,
P=0.021).
|
Tilapia juveniles, immersed in 300, 600 and 900 p.p.m. TU for 13 days,
showed a retarded otolith growth in a dose-dependent manner
(Table 1). The new growth in
otolith radius was approximately 56%, 43% and 41% of the control group for the
300, 600 and 900 p.p.m. TU group, respectively. The newly formed otolith radii
of TU groups were significantly smaller than for the control group (all
P<0.05). Fish growth, i.e. TL and mass, was also significantly
retarded by TU treatment. By contrast, 10 p.p.b. T3 moderately
increased the TL and mass and significantly increased the DGI
(P<0.05), but 0.1 p.p.b. T3 did not promote fish growth
(Table 2). However, a high dose
of T3 (10 p.p.b.) compared with a low dose of T3 (0.1
p.p.b.), slightly, but not significantly, increased otolith growth in the
presence of 300 p.p.m. TU. This result was in general agreement with previous
observations of TU-induced effects on tilapia larvae yolk absorption, growth
and development (Reddy and Lam,
1992
). The smaller otolith growth was attributed to fewer newly
formed DGI (an average of two to four fewer rings;
Table 3) and a slower otolith
growth rate compared with the control group (see below).
|
|
|
Higher concentrations of TU, i.e. 600 p.p.m. and 900 p.p.m. evidently caused higher mortality of tilapia juveniles. Lower TU i.e. 300 p.p.m., 0.1 p.p.b. and 10 p.p.b.T3 have no evident effects on fish survival compared with the control treatment (Tables 1 and 2).
A prominent growth difference of normal tilapia juveniles between experiments 3 (Table 1) and 4 (Table 2) was noticed. The larvae in each of these experiments were produced from different adults. The condition of the progenitors – sizes, nutrient levels and health – may affect development of their embryos.
Effects of TU and T3 on tilapia larvae
For tilapia larvae, the simultaneous administration of 300 p.p.m. TU and 25
p.p.b. T3 had no significant effect on fish or otolith growth. TU
(300 p.p.m.) also had no negative effect on fish or otolith growth.
T3 of 25 p.p.b. significantly increased the otolith growth but not
the DGI number. T3 content of tilapia larvae were also
significantly increased (approximately threefold) by 25 p.p.b. T3
administration, but not significantly reduced by 300 p.p.m. TU
(Table 4). In preliminary
trials, 10 p.p.b. T3 had no effect on fish and otolith growth (data
not shown).
|
The mortality of larval tilapia was higher than that of juveniles. However, compared with the control group, 300 p.p.m. TU and 25 p.p.b. T3 have no evident effect on larval survival (Table 4).
Otolith growth during TU treatment and recovery
TU treatment retarded otolith growth and slightly changed otolith
morphology. After 13 days immersion in 300 p.p.m. TU, otolith growth was
severely retarded on the ventral area (Fig.
3C,D,F). In most samples, the ventral part of the otolith stopped
growing shortly after the beginning of the 300 p.p.m. TU treatment although
otolith growth in other directions continued for another 6–9 days
(Table 3). Otolith growth in
the ventral direction did not resume even after fish were returned to normal
water for 2 weeks. This indicated that TU treatment not only caused a
temporary inhibition but also permanent damage to this organ, at least in the
ventral area. The severe reduction of otolith growth in the ventral direction
resulted in a flat margin (Fig.
3F). The normal otolith showed the convex margin in both ventral
and dorsal directions. Furthermore, every tilapia larva and juvenile was
successfully marked by tetracycline. All fluorescent rings were very distinct
in the normal otolith (Fig. 3B)
but in the experimental group, however, the second, third and fourth
fluorescent rings, laid down during the recovery period, were less
discernible, faint or only partially visible compared with the first prominent
fluorescent ring laid down before exposure to 300 p.p.m. TU
(Fig. 3D). This result
indicated that CaCO3 mineralization in the inner ear had not
recovered to a normal level during the first week of recovery from
hypothyroidism.
TU-treated fish showed a slower otolith growth rate than their counterparts in normal water (Fig. 4). There were one, six, eight and nine fish whose otolith only had 9, 10, 11 and 12 newly deposited rings, respectively, during the 13 day TU treatment (23–27 d.p.h.). A probable explanation for this was that respective otoliths stopped growth after 9 (N=1), 10 (N=6), 11 (N=8) and 12 (N=9) days of TU treatment. After the TU-treated fish were returned to normal water, otolith growth was observed on the second day in all individuals, as determined by the tetracycline marking. It was unclear if the growth occurred on the first day during the recovery period since the fish was not marked by tetracycline on that day. Only three DGI were discernible among the three fluorescent rings deposited in the 5 day period. This indicated that otolith increase did not have a daily cycle during the approximately 1 week recovery from TU treatment. Furthermore, the otolith growth rate of the experimental group was only half that of the control group during the first 5 days of recovery. The otolith growth rate of TU-treated fish did not reach the same level as the control group after recovery for 1 week and remained approximately 2 µm day–1 slower than that of the control group. An otolith growth increment was not formed daily until approximately 1 week after recovery from the 300 p.p.m. TU treatment.
| DISCUSSION |
|---|
|
|
|---|
T3 and TU treatments have no evident effects on somatic and
otolith growth of tilapia larvae. As tilapia grows, T3 treatment
induces somatic growth and otolith growth during the juvenile stage, which can
be retarded by TU treatment. TU (300 p.p.m.) and T3 treatment does
not cause an acute stress to fish, which is supported by the absence of any
evident marks or checks in their otolith. We did not observe behavioral
differences in T3-treated fish compared with the control fish.
Hypothyroidism induced by TU inhibition of the synthesis of thyroid hormones
is progressive until the existing thyroid hormones are degraded. After TU
treatment for several days, tilapia juveniles, but not the larvae, clearly
show symptoms of hypothyroidism: less mobility, with stiff swimming behavior
near the bottom and slow response to disturbances. The appetite of tilapia
juveniles was also evidently affected after immersion in TU for several days.
Reduced feeding slows somatic and otolith growth, but this factor alone cannot
cause the cessation of otolith growth, particularly on the ventral side of the
otolith after a few days of TU treatment. Furthermore, the retarded somatic
and otolith growth is only partially counteracted by T3
administration, suggesting TU is toxic to tilapia juveniles. Extrathyroidal
effects of TU, although not fully understood, have been found in killifish
(Chambers, 1953
), rainbow
trout (Eales, 1981
) and
flounder (Schreiber and Specker,
1999
). Furthermore, TU-like goitrogenic phenythiourea evidently
delays the hatching of zebrafish (Elsalini
and Rohr, 2003
). TU was found to reduce protein synthesis in the
liver and muscle of freshwater catfish (Heteropneustes fossilis)
(Singh, 1979
). If TU also
inhibits protein secretions of otolith chambers, this would retard and change
the otolith shape during the process of biomineralization as observed here in
tilapia juveniles. Nevertheless, tilapia larvae (this study), metamorphosing
flounder (Miwa and Inui, 1987
)
and metamorphosing tarpon leptocephali
(Shiao and Hwang, 2006
) are
insensitive to TU, suggesting that the extrathyroidal effects of TU in
teleosts may vary in different species as well as developmental stages.
Experiments on salmon have suggested that otolith growth is more closely
correlated with metabolic rate than with somatic growth
(Wright, 1991
;
Yamamoto et al., 1998
). The
coupling of metabolic rate and otolith growth can be detected as early as the
embryonic stage of zebrafish (Bang and
Grønkjær, 2005
). At similar temperatures, developing
zebrafish embryos can show significant intraspecific variation in metabolic
rate (Bang et al., 2004
). The
relationship between metabolic rate and thyroid level are not fully known in
fish. Some studies suggested that thyroid hormones do not increase metabolic
rate in fish (Weirich et al.,
1987
; van Ginneken et al.,
2007
). Accordingly, thyroid hormones may increase otolith growth
by stimulating somatic growth and differentiation rather than by directly
enhancing the metabolic rate of the fish. Kobuke et al.
(Kobuke et al., 1987
) first
reported the presence of thyroid hormones in fish eggs, and their entry into
tilapia oocytes is probably via diffusion from the maternal plasma
(Tagawa and Brown, 2001
).
Maternal thyroid hormones are involved in the regulation of development and
growth of teleosts (Tagawa and Hirano,
1987
; Brown, 1997
).
However, T3 has no biological function without binding to thyroid
hormone receptors. Somatic T3 content and TR
mRNA
expression decrease during the larval stage in tilapia. The decrease in
TR
mRNA expression suggests a low demand for T3 by
tilapia larvae and this phenomenon may explain why the overdose of
T3 induced by 25 p.p.b. T3 administration has no
prominent effects on somatic growth of tilapia larvae
(Table 4). Differentiation of
the thyroid gland can be detected in tilapia larvae as early as 3 d.p.h. by
histological staining (S.-M.W., unpublished data), which is similar to the
observation in zebrafish (Elsalini and
Rohr, 2003
). Therefore, the thyroid gland may start to synthesize
T3 at an early stage in tilapia. In experiment 5, larval tilapia were reared
in the presence of 300 p.p.m. TU from 4–16 d.p.h. TU, like
phenylthiourea (Elsalini and Rohr,
2003
) can almost completely inhibit the new synthesis of thyroid
hormones. The measured thyroid content in TU-treated fish was 0.8±0.3
ng g–1 (Table
4), which is not significantly different from the normal fish
(1.4±0.4 ng g–1,
Table 4). This result suggests
that the maternal thyroid hormones in TU-treated fish may be still active, at
least until 16 d.p.h., and be sufficient to supply larval development. In
addition, the newly synthesized T3, if there is any, is limited in
larval tilapia since TU does not significantly reduce the somatic
T3 content of tilapia larvae
(Table 4). Although the
transition of tilapia larvae to juvenile does not involve a striking
morphological change, as observed in flounder and eel, a thyroid hormone surge
and increasing expression of TR
mRNA are found during larval
metamorphosis at 9–15 d.p.h. (Figs
1,
2). This indicates that thyroid
hormones have an evolutionarily conserved function in manipulating the
metamorphic process from larval to juvenile stage in teleosts. The coupling of
thyroid hormone surges and high TR
mRNA expression may
stimulate tilapia growth and development, which is reflected in faster otolith
growth. The disruption of T3 levels, either by hypothyroidism or
hyperthyroidism, at this stage can easily change somatic growth, and the
changes are recorded in otolith growth.
After removal of TU, synthesis of thyroid hormones is gradually resumed, so
that fish as well as otolith growth slowly recovers. There were only three
tetracycline-marked increments deposited in the otolith
(Fig. 3C,D) during an
approximate 6 day period. This result suggests that an otolith growth
increment is not deposited daily but in a 2 day cycle during the first week of
recovery. This suggests that fish age may be underestimated due to the
uncoupling of otolith growth increments and the real daily age of the fish
under conditions of hypothyroidism. Thyroid hormone levels take about a week
to return to normal based on observations of the otolith growth period. It is
worth noting that otolith growth on the ventral side is not resumed after TU
removal. The otolith grows by CaCO3 mineralization on the protein
matrix, which is directly regulated by the epithelial cells of the otolith sac
(Payan et al., 1997
;
Payan et al., 1999
;
Takagi, 2000
;
Tohse and Mugiya, 2001
).
Failure to grow indicates that the function of the otolith sac might be
permanently damaged on the ventral side when fish are exposed to 300 p.p.m. TU
for 13 days. Ionocytes on the otolith sac are the cells responsible for
transepithelial transport of HCO–3 and
Ca2+ into the endolymph (Mugiya
and Yoshida, 1995
; Shiao et
al., 2005
), although Payan et al.
(Payan et al., 2002
) suggested
a passive diffusion through a paracellular pathway for Ca2+
transportation. It is likely that TU treatment causes death or dysfunction to
some ionocytes, leading to severely retarded otolith growth in the ventral
direction. Disruption of ion and protein supplies from the plasma or cells
into the endolymph may also cause the allometric growth of the otolith during
hypothyroidism. These hypothetical explanations require further studies to
determine the effects of hypothyroidism on the otolith sac at the cellular and
molecular levels.
To our knowledge, this is the first study revealing consistent patterns
among T3 content, TR
expression, and otolith growth
during the early stages of fish development. Yamano and Miwa
(Yamano and Miwa, 1998
) found
ubiquitous expression of TR genes in the fish body, suggesting that
development of each tissue of the flounder is controlled by thyroid hormone at
the receptor level. Under TU-induced hypothyroidism, the slower otolith growth
rate could be attributed to the retarded somatic growth, whereas the permanent
changes on the ventral side of the otolith might be due to the cellular
toxicity of TU. Dramatic changes in otolith increment width often occur at
larval metamorphosis and settlement
(Victor, 1986
;
Sponaugle and Cowen, 1994
;
Shiao et al., 2002
). These
changes cannot simply be attributed to environmental factors. This study
demonstrates that otolith growth is influenced by T3, especially
during the larval to juvenile stages. To a certain extent, the characteristic
ontogeny of otolith growth for each species may be also determined by
programmed T3 secretion and TR
expression.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Anken, R. H., Kappel, T., Slenzka, K. and Rahmann, H. (1993). The early morphogenetic development of the chichlid fish, Oreochromis mossambicus (Perciformes, Teleostei). Zool. Anz. 231,1 -10.
Anken, R. H., Edelmann, E. and Rahmann, H. (2002). Fish inner ear otoliths stop calcium incorporation after vestibular nerve transection. Neuroreport 11,2981 -2983.
Bang, A. and Grønkjær, P. (2005). Otolith size-at-hatch reveals embryonic oxygen consumption in the zebrafish, Danio rerio. Mar. Biol. 147,1419 -1423.[CrossRef]
Bang, A., Grønkjær, P. and Malte, H. (2004). Individual variation in the rate of oxygen consumption by zebrafish (Danio rerio). J. Fish Biol. 64,1285 -1296.[CrossRef]
Baumann, H., Peck, M. A. and Herrmann, J. P. (2005). Short-term decoupling of otolith and somatic growth induced by food level changes in postlarval Baltic sprat, Sprattus sprattus. Mar. Freshw. Res. 56,539 -547.[CrossRef]
Begg, G. A., Campana, S. E., Fowler, A. J. and Suthers, I. M. (2005). Otolith research and application: current directions in innovation and implementation. Mar. Freshw. Res. 56,477 -483.[CrossRef]
Brent, G. A. (1996). Thyroid hormones (T4, T3). In Endocrinology: Basic and Clinical Principles (ed. P. M. Conn and S. Melmed), pp.291 -306. Totowa, NJ: Humana Press.
Brown, D. D. (1997). The role of thyroid
hormone in zebrafish and axolotl development. Proc. Natl. Acad.
Sci. USA 94,13011
-13016.
Campana, S. E. (2005). Otolith science entering the 21st century. Mar. Freshw. Res. 56,485 -495.[CrossRef]
Chambers, H. A. (1953). Toxic effects of thiourea on the liver of the adult male killifish, Fundulus heteroclitus.Biol. Bull. Bingham. Oceanogr. Coll. 14, 69-93.
Cyr, D. G. and Eales, J. G. (1996). Interelationships between thyroidal and reproductive endocrine systems in fish. Rev. Fish Biol. Fish. 6, 165-200.
de Jesus, E. G., Toledo, J. D. and Simpas, M. S. (1998). Thyroid hormones promote early metamorphosis in grouper (Epinephelus coioides) larvae. Gen. Comp. Endocrinol. 112,10 -16.[CrossRef][Medline]
Eales, J. G. (1981). Extrathyroidal effects of low concentrations of thiourea on rainbow trout, Salmo gairdneri.Can. J. Fish Aquat. Sci. 38,1283 -1285.
Elsalini, O. A. and Rohr, K. B. (2003). Phenylthiourea disrupts thyroid function in developing zebrafish. Dev. Genes Evol. 212,593 -598.[Medline]
Geyten, S. V., Byamungu, N., Reyns, G. E., Kühn, E. R. and
Darras, V. M. (2005). Iodothyronine deiodinases and the
control of plasma and tissue thyroid hormone levels in hyperthyroid tilapia
(Oreochromis niloticus). J. Endocrinol.
184,467
-479.
Holden, K. K. and Bruton, M. N. (1992). A life-history approach to the early ontogeny of the Mozambique tilapia Oreochromis mossambicus (Pisces, Cichlidae). S. Afr. Zool. 27,173 -191.
Kobuke, L., Specker, J. L. and Bern, H. A. (1987). Thyroxine content of eggs and larvae of coho salmon, Oncorhynchus kisutch. J. Exp. Zool. 242, 2-12.
Liu, Y. W. and Chan, W. K. (2002). Thyroid hormones are important for embryonic to larval transitory phase in zebrafish. Differentiation 70,36 -45.[CrossRef][Medline]
Marchand, O., Safi, R., Escriva, H., Rompaey, E. V., Prunet, P. and Laudet, V. (2001). Molecular cloning and characterization of thyroid hormone receptors in teleost fish. J. Mol. Endocrinol. 26,51 -65.[Abstract]
Miwa, S. and Inui, Y. (1987). Effects of various doses of thyroxine and triiodothyronine on the metamorphosis of flounder. Gen. Comp. Endocrinol. 67,356 -363.[CrossRef][Medline]
Miwa, S., Tagawa, M., Inui, Y. and Hirano, T. (1988). Thyroxine surge in metamorphosing flounder larvae. Gen. Comp. Endocrinol. 70,158 -163.[CrossRef][Medline]
Mugiya, Y. (1990). Long-term effects of hypophysectomy on the growth and calcification of otoliths and scales in the goldfish, Carassius auratus. Zool. Sci. 7, 273-279.
Mugiya, Y. and Yoshida, M. (1995). Effects of calcium antagonist and other metabolic modulators on in vitro calcium deposition on otoliths in the rainbow trout Oncorhynchus mykiss.Fish. Sci. 61,1026 -1030.
Payan, P., Kossmann, H., Watrin, A., Mayer-Gostan, N. and Boeuf, G. (1997). Ionic composition of endolymph in teleosts: origin and importance of endolymph alkalinity. J. Exp. Biol. 200,1905 -1912.[Abstract]
Payan, P., Edeyer, A., de Pontual, H., Borelli, G., Boeuf, G. and Mayer-Gostan, N. (1999). Chemical composition of saccular endolymph and otolith in fish inner ear: lack of spatial uniformity. Am. J. Physiol. 46,R123 -R131.
Payan, P., Borelli, G., Priouzeau, F., de Pontual, H., Boeuf, G.
and Mayer-Gostan, N. (2002). Otolith growth in trout
Oncorynchus mykiss; supply of Ca2+ and Sr2+ to
the saccular endolymph. J. Exp. Biol.
205,2687
-2695.
Peters, W. (1852). Diagnosen von neuen Flussfischen aus Mossambique. Monatsb. Akad. Wiss. Berlin 275-276,681 -685.
Reddy, P. K. and Lam, T. J. (1992). Role of thyroid hormones in tilapia larvae (Oreochromis mossambicus). I. Effects of the hormones and an antithyroid drug on yolk absorption, growth and development. Fish Physiol. Biochem. 9, 473-485.[CrossRef]
Schreiber, A. M. and Specker, J. L. (1999). Metamorphosis in the summer flounder, Paralichthys dentatus: thyroidal status influences salinity tolerance. J. Exp. Zool. 284,414 -424.[CrossRef][Medline]
Shiao, J. C. and Hwang, P. P. (2004). Thyroid hormones are necessary for teleostean otolith growth. Mar. Ecol. Prog. Ser. 278,271 -278.[CrossRef]
Shiao, J. C. and Hwang, P. P. (2006). Thyroid hormones are necessary for metamorphosis of tarpon Megalops cyprinoides leptocephali. J. Exp. Mar. Biol. Ecol. 331,121 -132.[CrossRef]
Shiao, J. C., Tzeng, W. N., Collins, A. and Iizuka, Y. (2002). Role of marine larval duration and growth rate of glass eels in determining the distribution of Anguilla reinhardtii and A. australis on Australian eastern coasts. Mar. Freshw. Res. 53,687 -695.[CrossRef]
Shiao, J. C., Lin, L. Y., Horng, J. L., Hwang, P. P. and Kaneko, T. (2005). How can teleostean inner ear hair cells maintain the proper association with the accreting otolith? J. Comp. Neurol. 488,331 -341.[CrossRef][Medline]
Singh, A. K. (1979). Effect of thyroxine and thiourea on liver and muscle energy stores in the freshwater catfish, Heteropneustes fossillis. Ann. Biol. Anim. Biochim. Biophys. 19,1669 -1676.[CrossRef]
Sponaugle, S. and Cowen, R. K. (1994). Larval durations and recruitment patterns of two Caribbean gobies (Gobiidae): contrasting early life histories in demersal spawners. Mar. Biol. 120,133 -143.
Tagawa, M. and Brown, C. L. (2001). Entry of thyroid hormones into tilapia oocytes. Comp. Biochem. Physiol. 129B,605 -611.[CrossRef][Medline]
Tagawa, M. and Hirano, T. (1987). Presence of thyroxine in eggs and changes in its content during early development of chum salmon, Oncorhynchus keta. Gen. Comp. Endocrinol. 68,129 -135.[CrossRef][Medline]
Takagi, Y. (2000). Ultrastructural immunolocalization of the otolith water soluble-matrix in the inner ear of rainbow trout just-hatched fry. Fish. Sci. 66, 71-77.[CrossRef]
Tohse, H. and Mugiya, Y. (2001). Effects of enzyme and anion transport inhibitors on in vitro incorporation of inorganic carbon and calcium into endolymph and otoliths in salmon Oncorhynchus masou. Comp. Biochem. Physiol. 128A,177 -184.
van Ginneken, V. J. T., Ballieux, B., Antonissen, E., van der Linden, R., Gluvers, A, van den Thillart, G. E. E. J. M. (2007). Direct calorimetry of free-moving eels with manipulated thyroid status. Naturwissenschaften 94,128 -133.[CrossRef][Medline]
Victor, B. C. (1986). Duration of the planktonic larval stage of one hundred species of Pacific and Atlantic wrasses (family Labridae). Mar. Biol. 90,317 -326.[CrossRef]
Volk, E. C., Schroder, S. L. and Grimm, J. J. (1999). Otolith thermal marking. Fish. Res. 43,205 -219.[CrossRef]
Weirich, R. T., Schwartz, H. L. and Oppenheimer, J. H.
(1987). An analysis of the interrelationship of nuclear and
plasma Triiodothyronine in the sea lamprey, lake trout, and rat: evolutionary
considerations. Endocrinology
120,664
-677.
Wright, P. J. (1991). The influence of metabolic rate on otolith increment width in Atlantic salmon parr, Salmo salar L. J. Fish Biol. 38,929 -933.[CrossRef]
Yamamoto, Y., Ueda, H. and Higashi, S. (1998). Correlation among dominance status, metabolic rate and otolith size in masu salmon. J. Fish Biol. 52,281 -290.[CrossRef]
Yamano, K. and Miwa, S. (1998). Differential
gene expression of thyroid hormone receptor
and β in fish
development. Gen. Comp. Endocrinol.
109, 75-85.[CrossRef][Medline]
Yamano, K., Tagawa, M., de Jesus, E. G., Hirano, T., Miwa, S. and Inui, Y. (1991). Changes in whole body concentrations of thyroid hormones and cortisol in metamorphosing conger eel. J. Comp. Physiol. B 161,371 -375.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||