|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online January 17, 2007
Journal of Experimental Biology 210, 403-412 (2007)
Published by The Company of Biologists 2007
doi: 10.1242/jeb.02666
Serotonin stimulates [Ca2+]i elevation in ciliary ectodermal cells of echinoplutei through a serotonin receptor cell network in the blastocoel
Research Center for Marine Biology, Graduate School of Life Sciences, Tohoku University, Asamushi, Aomori, Aomori 039-3501, Japan
* Author for correspondence (e-mail: hkatow{at}mail.tains.tohoku.ac.jp)
Accepted 23 November 2006
| Summary |
|---|
|
|
|---|
Key words: 5Hthpr, p-chlorophenylalanine, sea urchin
| Introduction |
|---|
|
|
|---|
In mammals, serotonergic neurons transmit signals through synapses or by
secretion to the target cells that have serotonin receptors (for a review, see
Deutch and Roth, 1999
). The
serotonin receptor is a seven-transmembrane G-protein coupled receptor
(Peroutka, 1995
), and
possesses multiple transmembrane domains as an extracellular signal receptor
in both vertebrates (e.g. Barnes and Sharp,
1999
) and invertebrates (e.g.
Tierney, 2001
). In
vertebrates, serotonin triggers the elevation of cytoplasmic Ca2+
concentration ([Ca2+]i) in target cells (e.g.
Jahnel et al., 1993
;
Saino et al., 2002
), probably
through the G-protein/adenylate cyclase signal transduction pathway
(Brown et al., 2001
). The
elevation of [Ca2+]i in ciliary epithelial cells results
in increased ciliary beating frequency in invertebrates such as pond snail
Helisoma trivolvis (Christopher et
al., 1999
; Doran et al.,
2004
), mussel Mytilus edulis and clam Spisula
solidissima (Stephens and Prior,
1992
), and in vertebrates
(Nguyen et al., 2001
).
Recently 5HThpr, a serotonin receptor, from plutei of the sea urchin
Hemicentrotus pulcherrimus, was partially sequenced
(Katow et al., 2004
). The
receptor is localized on the cells that form a network in the blastocoel, but
not on the ciliated ectodermal cells that contribute to larval swimming
(Katow et al., 2004
). Here, we
resolve this conundrum and elucidate the entire coding region of the
5HThpr gene. To resolve this issue, elevation of
[Ca2+]i was examined in larvae that had been
microinjected with Oregon Green dextran 10X, a Ca2+ indicator,
before fertilization. The larval blastocoel was then treated with serotonin to
examine whether such serotonin application transmits any signal that can be
detected by [Ca2+]i elevation. The potential role of the
serotonin receptor cell network (SRN) as a mediator of serotonin signaling to
the ciliary ectoderm was tested with pCPA treatment,
[Ca2+]i examination, and immunohistochemistry using
anti-5-HThpr antibodies.
| Materials and methods |
|---|
|
|
|---|
Sequencing of 5HThpr
Plutei at 60 h.p.f. were collected and dissolved with Isogen (Nippon Gene,
Tokyo, Japan) to obtain total RNA. Poly(A)+ RNA was extracted from
the total RNA by Oligotex dT-30 Super (Takara, Otsu, Japan). Single strand
cDNAs were made from the poly(A)+ RNA by reverse transcriptase,
Super Script II (Invitrogen, Tokyo, Japan), and oligo-d(T) primer
(Invitrogen). According to the amino acid sequences of serotonin receptors,
such as human 1A, Aplysia, and Lancelet, the following four
degenerate primers were prepared. SRf1; WSNYTNGCNGTNGCNGAYYT, SRf2;
YTNATGGTNGCNGTNYTNGT, SRr1; NSWRTTRAARTANCCNARCCA, SRr2; DATRAARAANGGNARCCARCA
(W; A/T, S; C/G, Y; C/T, N; A/G/C/T, R; A/G). SRf1 and SRr1 were used for
first PCR, and SRf2 and SRr2 were used for the nested PCR. After agarose gel
electrophoresis, a single band around 800 bp was excised, eluted from the gel,
and ligated to pGEM-T Easy Vector (Promega, Madison, WI, USA). Sequencing was
conducted using a BigDye terminator cycle sequencing kit with a DNA sequencer
model 310 (PE Applied Biosystems, Tokyo, Japan). Based on this sequence, the
following four primers were designed: SR 5'-1; GAGATCCACACATCACAGAGT, SR
5'-2; ACTACCACAATCTCTTTAGTC, SR 3'-2; TACCTGGTCAGATTCAGGAGA, SR
3'-3; AAGACTCTTGGGATTGTCACT.
To obtain the 5' and 3' termini of 5HThpr, the reverse transcription was carried out with SR 5'-1 and oligo-d(T) primer combined with Adaptor sequence (Invitrogen), respectively. SR 5'-2 for 5' termini, and SR 3'-2 and SR 3'-3 for 3' termini, were used for first and second PCR with Adaptor primer (Invitrogen).
The 5HThpr protein sequences of the seven transmembrane domains from Scallop (Mizuhopecten yessoensis, accession number, AB209935), Aplysia (Aplysia californica, accession number, AF372526), Fugu (Takifugu rubripes, accession number, CAA65175), and sea urchin (Strongylocentrotus purpuratus, protein id=`XP_780260.1) were aligned with the H. pulcherrimus 5HThpr using CLASTAL W. Domain structure, protein sorting signals and transmembrane structure of 5HThpr were analyzed by open database programs PROSITE (http://www.expasy.ch/prosite/), PSORT (http://psort.ims.u-tokyo.ac.jp/), and SOSUI (http://sosui.proteome.bio.tuat.ac.jp/sosuimenu0.html) or TMpred (http://www.ch.embnet.org/software/TMPRED_form.html, respectively.
Whole-mount immunohistochemistry
To examine the structural relationship of the serotonin receptor cell
network (SRN) with the ectoderm in 48 h.p.f. plutei, pCPA (Sigma, St
Louis, MO, USA) was applied at 2 µg ml1 to 17 h.p.f.
mesenchyme blastulae until the 48 h.p.f. pluteus stage. The larvae were then
fixed with 4% paraformaldehyde in FSW for 3 h for anti-5Hthpr antibodies or 15
min for 1E11, an anti-synaptotagmin monoclonal antibody
(Burke et al., 2006
). Embryos
were then dehydrated through a series of increasing concentrations of ethanol
from 30% to 70% and stored in 70% ethanol at 4°C. The samples were then
hydrated in a series of decreasing concentrations of ethanol and finally in
phosphate-buffered saline with 0.1% (v/v) Tween-20 (PBST), incubated with
mouse anti-5HThpr antibodies (Katow et
al., 2004
) diluted at 1:200 in PBST or with 1E11 monoclonal
antibody (hybridoma culture medium without dilution). After washing the
samples with PBST 3 times (10 min each), the primary antibodies were detected
with Alexa Fluor 488-conjugated goat anti-mouse IgG (H+L) or Alexa Fluor
594-conjugated goat anti-mouse IgG (H+L) antibodies (both from Molecular
Probes Inc., Eugene, OR, USA) diluted in PBST 1:500 for 2 h. The anti-5HThpr
antibodies were raised in mice against the synthetic peptide whose amino acid
sequence was deduced from 5HThpr DNA sequenced in our laboratory
(Katow et al., 2004
). After
washing the samples in PBST 3 times (10 min each), they were examined under a
Nikon epi-fluorescence microscope (Nikon, Tokyo, Japan). Aliquots of pluteus
samples were double stained with rabbit anti-serotonin antibodies (Sigma), as
stated above, after staining with anti-5HThpr antibodies. The anti-serotonin
antibody-binding sites were visualized with Alexa Fluor 488-conjugated goat
anti-rabbit IgG (H+L) or Alexa Fluor 594-conjugated goat anti-rabbit IgG (H+L)
antibodies (both from Molecular Probes Inc.).
Detection of cytoplasmic Ca2+ ([Ca2+]i) in plutei
To detect [Ca2+]i in larvae, unfertilized eggs were
microinjected with 5 mg ml1 Oregon Green dextran 10X
(Molecular Probes Inc.), a fluorescent Ca2+ indicator dye, at 2% of
the total volume of an egg, and raised at 18°C in a dark incubator until
the 48 h.p.f. pluteus stage. The plutei were then hooked to the tip of glass
needles to prevent movement during serotonin microinjection and detection of
[Ca2+]i-stimulated Oregon Green fluorescence excitation
under a fluorescent microscope. Serotonin was diluted in FSW at 10 mmol
l1 and positioned in the micropipette between two oil
droplets. Then, 64 pl of serotonin was microinjected into the blastocoel of
the plutei as described previously
(Kyozuka et al., 1998
). The
final concentration of serotonin microinjected into the blastocoel was about
250 µmol l1, based on a calculation that the average
volume of the blastocoel is about 2.5 nl. Fluorescence intensity was recorded
with a computer-controlled photomultiplier system (OSP-3, Olympus, Tokyo,
Japan). The microinjection of FSW without serotonin did not trigger excitation
of Oregon Green dextran 10X. Aliquots of embryos microinjected with Oregon
Green dextran 10X were treated with 2 µmol l1 of
pCPA from the 17 h.p.f. mesenchyme blastula stage until the 48 h.p.f.
pluteus stage, microinjected with serotonin, and examined for the occurrence
of Oregon Green dextran 10X excitation as stated above.
Fluorescence images of videotape were converted into digital images and processed using NIH Image (a public domain image processing software for the Macintosh computer). The sequential digitized images, each of which was an average of four successive images, were captured at intervals of 0.5 s. To examine transient elevation of [Ca2+]i near the surface of plutei, the values of average fluorescence intensities calculated in the region were normalized by dividing them by the resting value. To analyze the detailed spatio-temporal propagation of [Ca2+]i elevation in the larvae, sequential fluorescence images were normalized by dividing them by the resting image immediately before the injection in a pixel-to-pixel manner and expressing them with pseudo color images, with red for the highest [Ca2+]i followed by yellow, green, light blue and to the lowest [Ca2+]i with deep blue. Since the fluorescent Ca2+ indicator was introduced into unfertilized eggs and excited after 2 days in culture by microinjecting serotonin, the intensity was weaker in some larvae than in ordinary usage when Ca2+ excitatory stimulation is applied immediately after microinjection of the Ca2+ indicator. However, we confirmed that the dye was able to respond to Ca2+ stimulation with intensified fluorescence by application of 20 µmol l1 A23187 instead of serotonin (data not shown). The experiment was repeated with 11 larvae for control and 6 larvae for pCPA-treated. The number of ectodermal cells along the major [Ca2+]i wave propagation route was counted in 48 h.p.f. larvae that were stained with 4',6-diamidino-2-phenylindole.
| Results |
|---|
|
|
|---|
|
|
The number of predicted transmembrane domains by SOSUI analysis, however, was different among them. The serotonin receptors of Aplysia, Fugu and the 5HThpr each have seven transmembrane domains, while that of Scallop has eight. Although 5HT-1A of S. purpuratus showed the highest similarity to 5HThpr, unlike 5HThpr, it contains only five predicted transmembrane domains. SOSUI analysis did not predict the two C-terminal transmembrane domains in the S. purpuratus 5HT-1A, even though the amino acid sequence is very similar to the 6th and 7th transmembrane domains of 5HThpr (Fig. 2). However, SOSUI analysis of the S. purpuratus 5HT-1A, using only the C-terminal sequence (from Val361 to Phe463) predicted the region as two transmembrane domains (Fig. 2, open rectangles).
About 30 potential serotonin receptors were predicted in S.
purpuratus based on The Sea Urchin Genome Project using GLEAN3 (GOMS
Language Evaluation and Analysis,
http://www.ulb.ac.be/di/gom/mavvyve/goms.pdf#search=`GLEAN3').
However, they turned out to be shared by many non-serotonin receptor
transmembrane proteins, and BLAST search analysis using non-transmembrane
domains reduced this number to four serotonin receptor subtypes, including
those homologues to 5HT-1A (GLEAN3_18826), 5HT-1F (GLEAN3_25436), 5HT-2C
(GLEAN3_25436) and 5HT-7 (GLEAN3_05097). However, except for the S.
purpuratus 5HT-1A, that is the 5HThpr homologue, no RNA of any other
serotonin receptor homologue has been cloned to date, suggesting that three
serotonin receptors may be not transcribed during the larval period of the sea
urchin. According to computation of relative molecular mass based on the
present deduced amino acid sequence by ExPasy analysis
(http://us.expasy.org/tools/pi_tool.html),
the predicted relative molecular mass of 5HThpr was 51 889.08 Da, and was
similar to those of other animals (cf.
Katow et al., 2004
).
|
Elevation of cytoplasmic Ca2+ concentration ([Ca2+]i) in the ectoderm by serotonin
In sea urchin larvae, serotonin cells at the apical ganglion inserted
neurites into the ciliary band ectoderm and blastocoelar space (e.g.
Bisgrove and Burke, 1987
).
However, neither at the ciliary band ectoderm nor in the blastocoelar space,
did these nervous terminals constitute synapses
(Nakajima et al., 1993
),
suggesting that serotonin is secreted into the blastocoelar space from the
nerve ends. Thus, to mimic this manner of in vivo serotonin delivery,
the neurotransmitter was microinjected to the blastocoelar space.
Eggs injected with Oregon Green dextran 10X, fertilized and incubated in dark room, developed, at least, to 48 h.p.f. 2-arm pluteus larva stage. Microinjection of serotonin into the blastocoel stimulated [Ca2+]i elevation in the ectoderm immediately after the injection (16 s) in the region of the injection site (Fig. 4B, 16'', arrow 1), but not in the SRN. The major fluorescence triggered by the elevation of [Ca2+]i apparently propagated about 350 µm in 2 s that encompassed 27±5 ectodermal cells (N=5), initially toward the posterior end of the larval body and then anteriorly on the opposite side of the larval body within 20 s (Fig. 4B, 16'' to 20'', arrow 2; C, pink line). Although the intensity of the fluorescence at the injection site decreased rapidly in 1 s after the first elevation of [Ca2+]i (Fig. 4C, blue line), the leading edge of intensive fluorescence continued to propagate as a wave. Relatively high [Ca2+]i levels remained on the larval surface until it returned to the initial background level by 60 s (Fig. 4C). Propagation of a minor fluorescence wave also occurred from the injection site toward the anterior region of the larval body (Fig. 4B, 16'', ant). This anterior wave propagated about 50 µm, and diminished 1 s later than was seen earlier than the major posterior wave (Fig. 4B, 17''). The present study also detected an intrinsically high [Ca2+]i level around the stomach which, however, did not apparently respond to serotonin (Fig. 4B).
|
Calcium ions are known to activate ciliary beating in larval swimming. To
examine whether serotonin signals the elevation of
[Ca2+]i in the ciliary ectoderm, we used pCPA,
an inhibitor of serotonin synthesis. Levels of pCPA that severely
inhibit larval swimming activity (2 mmol l1)
(Yaguchi and Katow, 2003
) were
added to the culture medium of 17 h.p.f. mesenchyme blastulae, in which
differentiation of serotonin ganglion was not yet observed. In all
pCPA-treated larvae examined in this study, serotonin synthesis was
severely inhibited (Fig. 4E),
and the intrinsic high level of [Ca2+]i was not seen in
these larval stomachs (Fig. 4H)
whose size was characteristically smaller than that of control larvae
(Fig. 4A, black arrow, 4F,
white arrow). However, they crawled on the bottom of culture dishes as was
previously reported (Yaguchi and Katow,
2003
). Thus, the lack of intrinsically high
[Ca2+]i in the stomach does not affect viability. In
these embryos, the elevation of [Ca2+]i in the ectoderm
never occurred by microinjection of serotonin
(Fig. 4I,G,H). Immuno
histochemistry revealed astonishingly severely disrupted SRN conformation in
pCPA-treated larvae. In these larvae, considerably fewer serotonin
receptor cells were seen, and were scattered in the blastocoel with few
intercellular connections among them. Thus, most of the major SRN tracts were
not formed, and they comprised few detectible SRN-ectoderm connection sites
(Fig. 4E).
The echinolarvae also have another nervous system immediately beneath the ciliary band ectoderm. This system possesses synaptotagmin (Fig. 5A), and is implicated in participation of the nervous system for larval swimming. However, pCPA treatment did not affect the formation of this alternative nervous system (Fig. 5B), showing that this nervous system is not sensitive to serotonin deprivation and does not participate in larval swimming. Thus, the present observation strongly suggested that the transient elevation of [Ca2+]i in the ectoderm occurs in the presence of an intact SRN structure with sufficient SRN-ectoderm connection sites, and that the larval swimming activity needs intact SRN that transmits serotonin signaling to the ectoderm to stimulate [Ca2+]i elevation. Although we cannot exclude potential participation of another nervous system that deploys unspecified neurotransmitters other than serotonin and regulates the larval spatial swimming behavior, we do not have any observations to suggest such a possibility to date.
|
| Discussion |
|---|
|
|
|---|
Based upon the previous pharmacological studies, `pre-nervous' serotonin is
involved in early cleavage of sea urchin development
(Renaud et al., 1983
;
Shmukler, 1993
;
Shmukler and Tosti, 2001
), and
serotonin receptors have been suggested to be in the plasma membrane of
blastomeres during cleavage period
(Shmukler, 1993
;
Shmukler and Tosti, 2001
).
Serotonin is involved in ciliary beating regulation in embryos such as
gastrulae (Soliman, 1983
). Our
previous immunoblotting conducted using anti-5HThpr antibodies detects very
weak serotonin receptor expression soon after fertilization that further
weakens until the late gastrula stage before the serotonergic nervous system
morphologically emerges. At and after prism stage, however, distinctively
intensive immunoreaction of 5HThpr reappears, at least through the pluteus
stage (Katow et al., 2004
). On
the other hand, immunohistochemistry does not locate serotonin receptors at
any particular region of the egg or the embryos before the prism stage, but at
and after prism stage a part of secondary mesenchyme cells expresses 5HThpr
until, at least, the pluteus stage (Katow
et al., 2004
). These observations suggest that the subtype of
serotonin receptor participating in very early embryogenetic periods, such as
during cleavage, may be different from the 5-HThpr that we have studied in
larvae.
Nevertheless, when serotonin is released during the cleavage stages, the
sea urchin blastomeres respond to the neurotransmitter with elevation of
[Ca2+]i (Shmukler et
al., 1999
), as was reported in mammalian cells (e.g.
Jahnel et al., 1993
;
Saino et al., 2002
;
Ulrich et al., 2003
).
Serotonin is also suggested to activate contraction of the muscle that is
surrounding the esophagus of sea urchin larvae by stimulating a strong influx
of Ca2+ to the muscle cells
(Gustafson, 1991
). The present
observation of a serotonin-triggered transient elevation of
[Ca2+]i in the ectoderm is the first report in sea
urchin larvae and this signaling requires the presence of an intact SRN in the
blastocoel. Although SRN extends fibers around the muscle cells at the
esophagus (Katow et al.,
2004
), the present observation barely detected elevation of
[Ca2+]i in the muscle cells by microinjected serotonin
(Fig. 4B), suggesting that the
intensity of [Ca2+]i elevation in muscle cells, even if
it occurred, was below the level detectable by the present technique.
The characteristic property found in the present
[Ca2+]i elevation in the ectoderm was the propagation of
a [Ca2+]i wave beyond intercellular borders with a
velocity of 175 µm s1 in the posterior regions of the
larval body. The regions where initial elevation of
[Ca2+]i occurred were closely associated with the
presence of SRN-ectoderm connection sites, such as at the middle of posterior
ectoderm (Fig. 3E,H,
Fig. 4B). The present
observation showed that the propagation of [Ca2+]i
elevation was led by a high [Ca2+]i edge. The leading
edge of the present [Ca2+]i wave in the ectoderm was not
as sharp as those seen in eggs at fertilization. However, since ectodermal
cells are less than 1/10 of the diameter of an oocyte [about 110 µm and
often the subject of [Ca2+]i wave propagation studies
(e.g. Kyozuka et al., 1998
)],
the leading edge of the [Ca2+]i wave in the ectodermal
cells was considered to be distinctively sharp. This particular manner of
[Ca2+]i wave propagation in the ectoderm may implicate
the occurrence of `regeneration' of [Ca2+]i elevation at
each ectodermal cell. This could be triggered by an intensity of
[Ca2+]i-derived signal that surpasses a certain
threshold rather than simple diffusion of serotonin in the blastocoel which,
unlike the present observation, creates a decreasing gradient of
[Ca2+]i intensity from the initial elevation site to the
leading edge of [Ca2+]i wave, probably with weak
fluorescence. Diffusion of Ca2+ from the previous cell to the next
through gap junctions (Braet et al.,
2003
) also seems to be an unlikely mechanism in sea urchin larvae,
because gap junctions were not found in the ectoderm
(Katow and Solursh, 1980
), and
connexin-like proteins have not been found in the Sea Urchin Genome Resources
to date (Sea Urchin Genome Sequencing
Consortium, 2006
).
In Xenopus egg activation, the signal transmitter from
serotonin-activated SRN cells needs to activate the cytoplasmic signal
transduction pathways to elevate [Ca2+]i that are
augmented via Ca2+-stimulated formation of
inositol-1,4,5-trisphosphate, as was seen in the protein kinase C (PKC) wave
that follows the [Ca2+]i wave
(Larabell et al., 2004
).
PKC-related break down of inositol phospholipids occurs in association with
desmosomes (Kitajima et al.,
1992
), the intercellular junction also found in sea urchin
ectoderm (Katow and Solursh,
1980
). Thus, desmosomes could be involved in the present
intercellular propagation of [Ca2+]i elevation in the
ciliary epithelium.
Internal application of serotonin to pCPA-treated, and thus
SRN-perturbed, larvae did not stimulate [Ca2+]i
elevation in ectodermal cells, suggesting a role of SRN as a mediator of
serotonin signal from the apical ganglion to the ectodermal cells. This
pathway resembles serotonergic interneurons of mollusk Tritonia
diomedea (Sakurai and Katz,
2003
) or serotonergic sensory-motor neurons of the pond snail
Helisoma trivolvsi (Kuang et al.,
2002
). A study of the gastropod mollusks, Aplysia, has
also shown that the giant serotonergic cells can act as peripheral modulator
neurons, as well as interneurons, and in this way they can affect their target
organs at more than one level (Rozsa,
1984
). The abnormal morphology of the pCPA-treated larvae
included a smaller digestive organ with severely decreased intrinsic levels of
[Ca2+]i (Fig.
4G). This observation implicated the involvement of serotonin in
the morphogenetic process of digestive organs, as was suggested by the
previous observation that in the larvae under the presence of excess
concentration of serotonin the neurotransmitter not only prevents
pCPA-induced perturbation of SRN formation but also develops
hyper-branching of SRN (H.K., unpublished observation).
Although possible participation of other subtypes of serotonin receptors in
the ectodermal [Ca2+]i regulation in sea urchin larvae
is not excluded, and GLEAN3 predicated the presence of at least three other
types of 5HT receptors, there has been no report of their mRNA other than the
5HThpr homolog to date. It also possible to predict the involvement of other
non-serotonergic nervous systems in the regulation of larval spatial swimming
behavior and [Ca2+]i elevation in the ectoderm, such as
the nervous system that has synaptotagmin and appears about the same
developmental period in the larvae as the serotonergic system
(Burke et al., 2006
). The
present observation, however, indicated it was unlikely, because conformation
of the synaptotagmin-possessed nervous system was not affected by
pCPA (Fig. 5). Sea
urchin larvae also develop dopaminergic, GABAergic
(Bisgrove and Burke, 1986
;
Bisgrove and Burke, 1987
) and
peptidergic nervous systems (Beer et al.,
2001
). These nervous systems, however, appear in later larval
stages (after 4-arm larva stage), and thus are not present in the early 2-arm
larva stage, excluding possible participation of these nervous systems in the
present larval swimming behavior and [Ca2+]i elevation
in the ectoderm observed here.
The absence of 5HThpr on the ectodermal cells themselves may explain why
5HThpr-possessed SRN is required and the SRN-deprived larvae did not respond
to internally applied serotonin. The perturbation of SRN by pCPA was
prevented to some extent by simultaneous external application of serotonin,
implicating externally applied serotonin also stimulates larvae as has been
previously reported (Wada et al.,
1997
; Yaguchi and Katow,
2003
). This stimulation pathway may be carried out through SRN
fibers pierced through the ectoderm in places
(Fig. 3CH).
Although 5HThpr had been predicted to have a strong similarity in its
partial amino acid sequence to Aplysia 5-HT2
(Katow et al., 2004
), the
present homology search based on the entire ORF sequence showed that 5HThpr is
much more similar to S. purpuratus 5HT-1A than to Aplysia
5-HT2.
The present study thus strongly suggests that serotonin secreted from the
apical ganglion is received by 5HThpr on SRN cells, and then transmitted to
the ectoderm through SRN fibers inserted into the ectoderm. Unlike
intra-ectodermal signal transmission mechanism, intra-SRN signaling may not be
mediated by [Ca2+]i, and thus may involve signal
transduction pathways such as G-protein/CREB/CRE pathways
(Brown et al., 2001
). Such
conversion of signaling media may occur at the SRNectoderm connection
sites and have yet to be examined in detail. Furthermore, the mechanism of
intercellular propagation of high [Ca2+]i, area in
ectoderm ought to be addressed in near future.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Barnes, N. M. and Sharp, T. (1999). A review of central 5-HT receptors and their function. Neuropharmacology 38,1083 -1152.[CrossRef][Medline]
Beer, A. J., Moss, C. and Thorndyke, M. C.
(2001). Development of serotonin-like and SALMFamide-like
immunoreactivity in the nervous system of the sea urchin Psammechinus
miliaris. Biol. Bull. 200,268
-280.
Bisgrove, B. W. and Burke, R. D. (1986). Development of serotonergic neurons in embryos of the sea urchin, S. purpuratus. Dev. Growth Differ. 28,557 -569.
Bisgrove, B. W. and Burke, R. D. (1987). Development of the nervous system of the pluteus larva of Strongylocentrotus droebachiensis. Cell Tissue Res. 248,335 -343.
Braet, K., Vandamme, W., Martin, P. E., Evans, W. H. and Leybaert, L. (2003). Photoliberating inositol-1,4,5-trisphosphate triggers ATP release that is blocked by the connexin mimetic peptide gap 26. Cell Calcium 33, 37-48.[CrossRef][Medline]
Brown, M., Keynes, R. and Lumsden, A. (2001). The Developing Brain. New York: Oxford University Press.
Burke, R., Osborne, L., Wang, D., Murabe, N., Yaguchi, S. and Nakajima, Y. (2006). Neuron-specific expression of a synaptotagmin gene in the sea urchin, Strongylocentrotus purpuratus.J. Comp. Neurol. 496,244 -251.[CrossRef][Medline]
Christopher, K. J., Young, K. G., Chang, J. P. and Goldberg, J.
I. (1999). Involvement of protein kinase C in 5-HT-stimulated
ciliary activity in Helisoma trivolvis embryos. J.
Physiol. 515,511
-522.
Deutch, A. Y. and Roth, R. H. (1999). Neurotransmitters. In Fundamental Neuroscience (ed. M. J. Zigmond, F. E. Bloom, S. C. Landis, J. L. Roberts and L. R. Squire), pp.193 -234. San Diego: Academic Press.
Doran, S. A., Koss, R., Tran, C. H., Christopher, K. J., Gallin,
W. J. and Goldberg, J. I. (2004). Effect of serotonin on
ciliary beating and intracellular calcium concentration in identified
populations of embryonic ciliary cells. J. Exp. Biol.
207,1415
-1429.
Gal, E. M. and Whitacre, D. H. (1982). Mechanism of irreversible inactivation of phenylalanine-4- and tryptophan-5-hydroxylases by [4-36Cl, 2-14C]p-chlorophenylalanine: a revision. Neurochem. Res. 7, 13-26.[CrossRef][Medline]
Gustafson, T. (1991). Pharmacological control of muscular activity in the sea urchin larva-IV. Effects of monoamines and adenosine. Comp. Biochem. Physiol. 98C,307 -315.[CrossRef]
Hara, Y., Kuraishi, R., Uemura, I. and Katow, H. (2003). Asymmetric formation and possible function of the primary pore canal in plutei of Temnopleurus hardwicki. Dev. Growth Differ. 45,295 -308.[CrossRef][Medline]
Jahnel, U., Nawrath, H., Rupp, J. and Ochi, R. (1993). L-type calcium channel activity in human atrial myocytes as influenced by 5-HT. Naunyn Schmiedebergs Arch. Pharmacol. 348,396 -402.[Medline]
Katow, H. and Solursh, M. (1980). Ultrastructure of primary mesenchyme cell ingression in the sea urchin Lytechinus pictus. J. Exp. Zool. 213,231 -246.[CrossRef]
Katow, H., Yaguchi, S., Kiyomoto, M. and Washio, M. (2004). The 5-HT receptor cell is a new member of secondary mesenchyme cell descendants and forms a major blastocoelar network in sea urchin larvae. Mech. Dev. 121,325 -337.[CrossRef][Medline]
Kitajima, Y., Owaribe, K., Nishizawa, Y. and Yaoita, H. (1992). Control of the distribution of hemidesmosome components in cultured keratinocytes: Ca2+ and phorbol esters. J. Dermatol. 19,770 -773.[Medline]
Kuang, S., Doran, S. A., Wilson, R. J., Goss, G. G. and Goldberg, J. I. (2002). Serotonergic sensory-motor neurons mediate a behavioral response to hypoxia in pond snail embryos. J. Neurobiol. 52,73 -83.[CrossRef][Medline]
Kyozuka, K., Deguchi, R., Mohri, T. and Miyazaki, S. (1998). Injection of sperm extract mimics spatiotemporal dynamics of Ca2+ responses and progression of meiosis at fertilization of ascidian oocytes. Development 125,4099 -4105.[Abstract]
Larabell, C. A., Rowning, B. A. and Moon, R. T. (2004). A PKC wave follows the calcium wave after activation of Xenopus eggs. Differentiation 72, 41-47.[CrossRef][Medline]
Nakajima, Y., Noda, Y. and Burke, R. D. (1993). The structure and development of the apical ganglion in the sea urchin pluteus larvae of Strongylocentrotus droebachiensis and Mespilia globules. Dev. Growth Differ. 35,531 -538.[CrossRef]
Nguyen, T., Chin, W. C., O'Brien, J. A., Verdugo, P. and Berger,
A. J. (2001). Intracellular pathways regulating ciliary
beating of rat brain ependymal cells. J. Physiol.
531,131
-140.
Peroutka, S. J. (1995). 5HT receptors: past, present and future. Trends Neurosci. 18, 68-69.[CrossRef][Medline]
Renaud, F., Parisi, E., Capasso, A. and De Prisco, P. (1983). On the role of serotonin and 5-methoxy-tryptamine in the regulation of cell division in sea urchin eggs. Dev. Biol. 98,37 -46.[CrossRef][Medline]
Rozsa, K. S. (1984). The pharmacology of molluscan neurons. Prog. Neurobiol. 23, 79-150.[CrossRef][Medline]
Saino, T., Matsuura, M. and Satoh, Y. (2002). Application of real-time confocal microscopy to intracellular calcium ion dynamics in rat arterioles. Histochem. Cell Biol. 117,295 -305.[CrossRef][Medline]
Sakurai, A. and Katz, P. S. (2003). Spike
timing-dependent serotonergic neuromodulation of synaptic strength intrinsic
to a central pattern generator circuit. J. Neurosci.
23,10745
-10755.
Sea Urchin Genome Sequencing Consortium (2006).
The genome of the sea urchin Strongylocentrotus purpuratus.Science 314,941
-952.
Shmukler, Y. B. (1993). Possibility of membrane reception of neurotransmitter in sea urchin early embryos. Comp. Biochem. Physiol. 106C,269 -273.[CrossRef][Medline]
Shmukler, Y. B. and Tosti, E. (2001). Serotoninergic processes in cells of early embryos of the sea urchin Paracentrotus lividus. [Russian] Ross. Fiziol. Zh. Im. I. M. Sechenova 87,1557 -1564.[Medline]
Shmukler, Y. B., Buznikov, G. A. and Whitaker, M. J. (1999). Action of serotonin antagonists on cytoplasmic calcium levels in early embryos of sea urchin Lytechinus pictus. Int. J. Dev. Biol. 43,179 -182.[Medline]
Soliman, S. (1983). Pharmacological control of ciliary activity in the young sea urchin larva. Effects of monoaminergic agents. Comp. Biochem. Physiol. 76C,181 -191.[CrossRef]
Stephens, R. E. and Prior, G. (1992). Dynein
from serotonin-activated cilia and flagella: extraction characteristics and
distinct sites for cAMP-dependent protein phosphorylation. J. Cell
Sci. 103,999
-1012.
Tierney, A. J. (2001). Structure and function of invertebrate 5-HT receptors: a review. Comp. Biochem. Physiol. 128A,791 -804.
Ulrich, M. L., Rotzinger, S., Asghar, S. J., Jurasz, P., Tanay, V. A., Dunn, S. M., Radomski, M., Greenshaw, A. and Silverstone, P. H. (2003). Effects of dextroamphetamine, lithium chloride, sodium valproate and carbamazepine on intraplatelet Ca2+ levels. J. Psychiatry Neurosci. 28,115 -125.[Medline]
Wada, Y., Mogami, Y. and Naba, S. (1997). Modification of ciliary beating in sea urchin larvae induced by neurotransmitters: beat-plane rotation and control of frequency fluctuation. J. Exp. Biol. 200,9 -18.[Abstract]
Yaguchi, S. and Katow, H. (2003). Expression of tryptophan 5-hydroxylase gene during sea urchin neurogenesis and role of serotonergic nervous system in larval behavior. J. Comp. Neurol. 466,219 -229.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
L. Elia, P. Selvakumaraswamy, and M. Byrne Nervous System Development in Feeding and Nonfeeding Asteroid Larvae and the Early Juvenile Biol. Bull., June 1, 2009; 216(3): 322 - 334. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||