|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online November 2, 2007
Journal of Experimental Biology 210, 3919-3930 (2007)
Published by The Company of Biologists 2007
doi: 10.1242/jeb.008342
Cloning and characterization of AgCA9, a novel
-carbonic anhydrase from Anopheles gambiae Giles sensu stricto (Diptera: Culicidae) larvae
The Whitney Laboratory for Marine Biology, University of Florida, 9505 Ocean Shore Boulevard, Saint Augustine, FL 32080, USA
* Author for correspondence (e-mail: pjl{at}whitney.ufl.edu)
Accepted 16 August 2007
| Summary |
|---|
|
|
|---|
-CA from the larval
An. gambiae alimentary canal. Antibody immunolocalization reveals a
unique protein distribution pattern that includes the ectoperitrophic fluid,
`transitional region' of the alimentary canal, Malpighian tubules and a subset
of cells in the dorsal anterior region of the rectum. Localization of this CA
within the lumen of the alimentary canal may be a key to larval pH regulation,
while detection within the rectum reveals a novel subset of cells in An.
gambiae not described to date. Phylogenetic analysis of members of the
-CA family from the Homo sapiens, Drosophila
melanogaster, Aedes aegypti and An. gambiae genomes
shows a clustering of the novel CA with Homo sapiens CAs but not with
other insect CAs. Finally, a universal system for naming newly cloned An.
gambiae CAs is suggested.
Key words: carbonic anhydrase, mosquito larvae, ectoperitrophic space, rectum, pH regulation, midgut alkalization
| Introduction |
|---|
|
|
|---|
pH 1.0) in certain situations. This high pH
is thought to have a role in the dissociation of tannin–protein
complexes that are found in the phytophagous diet of caterpillars and other
insect larvae (Berenbaum,
1980
The larval alimentary canal can be divided into six main sections: gastric
caeca (GC), anterior midgut (AMG), posterior midgut (PMG), Malpighian tubules
(MT), ileum and rectum. The highly alkaline pH is restricted to the AMG lumen
and exists in the absence of any morphological barriers between it and the
near-neutral pH values of the GC and PMG lumina. Currently, a detailed
understanding of the mechanisms driving digestion and pH/ion regulation in
these regions of the alimentary canal is lacking; however, there is evidence
supporting a role for the enzyme carbonic anhydrase (CA)
(Corena et al., 2002
;
Seron et al., 2004
) (T. J.
Seron, personal communication).
Multiple CAs have been cloned from, and immunolocalized to, the
Anopheles gambiae (Seron et al.,
2004
) (T. J. Seron, personal communication; K.E.S., unpublished
data) and Aedes aegypti (Corena
et al., 2002
; Seron et al.,
2004
) midguts and it has been shown that inhibition of CA in
mosquito larvae blocks alkalization
(Corena et al., 2002
). CA
catalyzes the reversible conversion of
H2O+CO2
H++HCO3–
and can generate HCO3– (bicarbonate) within midgut
epithelial cells. Living larvae actively excrete bicarbonate, resulting in a
net alkalization of their surrounding media
(Stobbart, 1971
). Moreover,
addition of the global CA inhibitor, methazolamide, inhibits this alkalization
(Corena et al., 2002
). These
data implicate CA as a key player in midgut alkalization.
A current view of larval midgut alkalization assumes that CA in the
epithelial cells catalyzes the formation of bicarbonate, which is then
translocated into the lumen by an as yet unidentified plasma membrane anion
exchanger. Bicarbonate can then be deprotonated to carbonate
(pKa2=10.32) (Dow,
1984
). Together with a strong cation such as a potassium or sodium
ion, carbonate could serve as the buffer in the highly alkaline AMG lumen.
Despite numerous attempts, an anion exchanger has not been detected in the
apical membrane of the midgut epithelium. This anion exchanger is necessary
for the translocation of bicarbonate from the epithelial cells into the lumen,
where it is needed to buffer the alkaline contents. We hypothesize an
alternative mechanism for supplying the lumen with bicarbonate: an
extracellular CA within the actual lumen of the alimentary canal may obviate
the need for membrane anion exchange and would supply the lumen directly with
bicarbonate, as will be described in this paper.
Here, we report the cloning and characterization of a novel cytosolic-like
-CA (GenBank accession no. DQ518576), henceforth referred to as AgCA9,
from the alimentary canal of An. gambiae mosquito larvae. The protein
has been localized to the ectoperitrophic fluid, the epithelial cells in the
region where the alimentary canal transitions from the AMG to the PMG
(transitional region; TR) (Clark et al.,
2005
), the principal cells of the MT, and the cells of the dorsal
anterior region of the rectum. A CA within the ectoperitrophic space of the
alimentary canal could be involved in the production of a constant supply of
bicarbonate within the lumen, the ion thought to regulate alkalization.
Additionally, the localization of this protein to a subset of cells in the
rectum challenges an established paradigm of mosquito cell biology. The rectum
of freshwater mosquitoes has traditionally been described as being uniform in
function and structure (Meredith and
Phillips, 1973
). The differential expression of this CA raises the
question of whether the rectum of the freshwater breeder, An.
gambiae, differs from this model by having two distinct regions. This
would be the first description of a freshwater mosquito larva with this
characteristic. We report the phylogenetic analysis of members of the
-CA family from the Homo sapiens, Drosophila melanogaster, Ae.
aegypti and An. gambiae genomes and show that AgCA9 clusters
with H. sapiens cytoplasmic CAs. We also suggest a uniform naming
system for newly cloned An. gambiae CAs, which to date does not
exist.
| Materials and methods |
|---|
|
|
|---|
Cloning of AgCA9
Primers were designed to an internal region of AgCA9 (ENSANGG00000016723)
as predicted by ensembl
(www.ensembl.org):
forward primer, GGGATACACGCAAATGAAC; reverse primer, GCTATCGACTTCACGCAG. These
primers were used in a PCR reaction to amplify the CA from cDNA collections
made to include the entire larval alimentary canal. cDNA collections were
generated as described in Matz, (Matz,
2003
). Once amplified, the PCR product was sequenced using the ABI
Prism Big Dye Terminator Cycle Sequencing Kit (PE Biosystems, Foster City, CA,
USA), and the reaction products were analyzed on an ABI Prism 310 Genetic
Analyzer. This known sequence was used to design gene-specific primers for the
rapid amplification of cDNA ends (RACE). RACE was used to determine the
3' and 5' ends (Zhang and
Frohman, 1997
) [modified by Matz et al.
(Matz et al., 1999
)] using
cDNA generated as described above. Once the full-length sequence was obtained,
gene-specific primers were designed to amplify the full-length AgCA9 DNA.
Forward primer, ATGTCTGTCACTTGGGGATACAC; reverse primer,
TTAGTAGCTATCGACTTCACGCAG. The full-length gene was ligated into pCR4-TOPO
(Invitrogen, Carlsbad, CA, USA) and transformed into Top10 chemically
competent bacterial cells (Invitrogen) for sequence confirmation as described
above.
Quantitative PCR (QPCR)
RNA was extracted (TRI reagent®–RNA/DNA/Protein isolation
reagent; Molecular Research Center, Inc., Cincinnati, OH, USA) from whole
alimentary canal, GC, AMG, PMG, MT and rectum from early 4th-instar
An. gambiae mosquito larvae. Superscript II Reverse Transcriptase kit
(Invitrogen) was used to generate cDNA from RNA using manufacturer's
instructions. Primers were designed to both AgCA9 and an 18s ribosomal RNA
endogenous control using ABI primer express software. AgCA9 forward primer,
GAGCTTTTCCGCGAAATGC; AgCA9 reverse primer, CTCGTCGCAGGGACACTCTT. 18s forward
primer, GCGACCTCGTCGGTCAAG; 18s reverse primer, ATGGTGCCCGGGAACTCT. Primers
were not designed to span an intron, as is generally suggested to minimize
genomic DNA contamination, but RNA samples that were treated with DNAseI to
eliminate genomic DNA produced identical results. QPCR was performed using the
Applied Biosystems (ABI, Foster City, CA, USA) 7000 Sequence Detection system,
and data were analyzed using the method described in Pfaffl
(Pfaffl, 2001
). Each reaction
was run in triplicate.
In situ hybridization
Digitoxin-labeled RNA probes were designed to the full-length AgCA9 using
the DIG RNA labeling kit (Roche, Nutely, NJ, USA). Ten early
4th-instar An. gambiae midguts were dissected, five for
sense and five for antisense detection. To dissect the gut, the heads of the
cold-immobilized larvae were pinned down using fine stainless-steel pins to a
Sylgard layer at the bottom of a Petri dish containing 4% paraformaldehyde in
phosphate-buffered saline (PBS). The anal segment and the saddle papillae were
removed using ultra-fine scissors and forceps, and an incision was made
longitudinally along the thorax. The carcass, including the fat body, central
nervous system, trachea and muscle, was separated from the gut. AgCA9 RNA was
detected according to the in situ hybridization protocol outlined in
Meleshkevitch et al. (Meleshkevitch et
al., 2006
).
Antibody production
Chicken antibodies against AgCA9 were generated by Aves Labs, Inc. (Tigard,
OR, USA) for use in western blotting and immunohistochemistry. Antibody 5340
was generated against the BSA-conjugated peptide CZELGNRQLREVDSY and was used
as purified IgY. Additionally, antibody 5563 was generated against the
BSA-conjugated peptide KEPIEVSHEQLELFREMRC and was affinity purified before
use using the immunogen peptide.
To localize Na+/K+-ATPase, monoclonal antibodies that
had been raised against the
-subunit of avian P-type
Na+/K+-ATPase in mice were obtained from the
Developmental Studies Hybridoma Bank
(Lebovitz et al., 1989
).
Blocking assay
To determine specificity, antibody was pre-incubated with peptide prior to
detection of protein. First, the amount of antibody to be used in milligrams
(mg) was calculated based on a 1:1000 dilution. Peptide was reconstituted in
Milli-Q (Millipore, Billerica, MA, USA) water to 2 mg ml–1
and was added in 40% excess by mass. This was calculated by multiplying mg of
antibody by 0.4. The reconstituted peptide was combined with diluted antibody
and incubated for 45 min at 37°C prior to use.
Western blot
Protein was extracted from whole An. gambiae 4th-instar
larvae using TriZol® (Molecular Research Center, Inc.) according to
manufacturer's instructions. Protein samples were prepared and run on a gel
according to manufacturer's instructions (NuPage 4–12% Bis-Tris gel, 1.0
mmx12 well; Invitrogen). The protein was transferred to nitrocellulose
in transfer buffer (849 µl Milli-Q water, 50 ml 20x NuPAGE transfer
buffer, 1 ml NuPAGE antioxidant and 100 ml methanol) at 24 V for 4 h at
4°C. The nitrocellulose was stained with Fast Green (Sigma-Aldrich Corp.,
St Louis, MO, USA) (40 ml acetic acid, 100 ml methanol, 0.24 g Fast Green, 100
ml water) for approximately 15 min, destained (5:1:5
methanol:HOAc:H2O) for 15 min and rinsed with deionized water. The
individual lanes were separated and blocked with blotto (400 ml TBS, 10 g dry
milk, 800 µl Tween-20) for 1 h at room temperature. The primary antibody
5563 was added at a 1:1000 dilution in blotto and rocked at 37°C for 1 h.
The blot was washed three times in TBS at room temperature for 5 min each. The
secondary antibody [alkaline phosphatase (AP)-conjugated donkey anti-chicken;
Jackson ImmunoResearch; West Grove, PA, USA] was added at a 1:250 dilution in
blotto and incubated at 37°C for 1 h. The blot was again washed with TBS
at room temperature for 3x5 min. The labeled bands were detected using
an AP-conjugate substrate kit (Bio-Rad, Hercules, CA, USA) according to
manufacturer's instructions.
Immunolocalization
Early 4th-instar mosquito larvae were dissected to separate the
gut (including GC, AMG, PMG, MT, ileum and rectum) from the rest of the
larvae. The dissected tissue was fixed in a 1:1 solution of hemolymph
substitute solution (Clark et al.,
1999
) and 4% paraformaldehyde in 0.1 mol l–1
sodium cacodylate buffer overnight at 4°C. The tissue was then washed
twice with TBS for 30 min each at room temperature and incubated in
pre-incubation buffer (pre-inc; 1% BSA, 1% normal goat serum, 0.1% Triton
X-100 in TBS) for 1–2 h at room temperature. The tissue was incubated
with primary chicken antibodies 5340 or 5563 diluted 1:1000 and
Na+/K+-ATPase mouse monoclonal antibody hybridoma
supernatant diluted 1:10 in pre-inc at 4°C overnight. The following day,
the tissue was washed approximately 15 times in pre-inc for 30 min each at
room temperature. Secondary antibodies (FITC-conjugated donkey anti-chicken
and TRITC-conjugated goat anti-mouse; Jackson ImmunoResearch) were diluted
1:250 in pre-inc and incubated with the tissue overnight at 4°C. The
tissue was then rinsed twice with pre-inc at room temperature for 30 min each
and once with TBS for 30 min at room temperature. To detect muscle,
TRITC-conjugated phalloidin (Sigma-Aldrich Corp) was added to the tissue,
diluted 1:250 in pre-inc and incubated for 30 min at room temperature. To
detect nuclei, the tissue was incubated in the nuclear stain DRAQ-5
(Biostatus, Shepshed, Leicestershire, UK), diluted 1:1000 in pre-inc and
incubated for 30 min at room temperature. The tissue was then washed twice
with TBS for 30 min each at room temperature and mounted in 60% glycerol in
TBS with added phenylenediamine (Sigma-Aldrich Corp.) to diminish signal
fading. Signal was visualized using laser scanning confocal microscopy.
Phylogenetic analysis
CA protein alignments were created using ClustalX
(http://bips.u-strasbg.fr/fr/Documentation/ClustalX/).
Predicted sequences were obtained from the ensembl database (February 2007
release). The alignments were created using ClustalX and trimmed and
visualized using GeneDoc
(http://www.nrbsc.org/gfx/genedoc/index.html).
The phylogeny was prepared using MrBayes
(http://mrbayes.csit.fsu.edu/)
with the JTT amino acid substitution model and 1.5 million iterations. Trees
were visualized using TreeView
(http://taxonomy.zoology.gla.ac.uk/rod/treeview.html).
All nodes are supported with >0.95 posterior probability.
| Results |
|---|
|
|
|---|
-CAs were named sequentially starting with AgCA1.
The ß-CA was named AgCAb. Also recorded are the GenBank accession numbers
of those CAs that our laboratory has fully cloned and sequence confirmed,
including AgCA-RP2, which has not yet been submitted to NCBI.
|
Cloning of full-length AgCA9 from An. gambiae midgut
An 811 base pair (bp) internal fragment was cloned from the An.
gambiae larval midgut using primers designed according to the partial
cDNA sequence predicted by ensembl. Using gene-specific sequences from this
fragment, rapid amplification of cDNA ends (RACE) was used to amplify and
sequence the 3' and 5' ends. The cDNA spanned both the start and
stop codons and was determined to be full length by the presence of a stop
codon in the 5' UTR and the presence of a 3' poly-A tail. The
full-length cDNA was determined to be 831 bp, corresponding to a protein
product of 276 amino acids with a molecular mass of 31.5 kDa (as determined by
http://bioinformatics.org/sms/).
This was submitted to the GenBank database and allocated the accession number
DQ518576. The clone belongs to the
-CA family and is located on
chromosome 3R
(www.vectorbase.org).
A protein alignment between AgCA9 and several other An. gambiae
-CAs cloned by the Linser laboratory as well as H. sapiens
CAII and D. melanogaster CAH1 demonstrated that AgCA9 has significant
homology at the
-CA active site
(Fig. 1). Specifically, note
the conserved histidine residues essential for
-CA activity: His-94,
His-96 and His-119 (numbering is relative to HCAII).
|
Detection of RNA expression in alimentary canal regions
Quantitative PCR (qPCR) and in situ hybridization were used to
detect mRNA within the mosquito larval alimentary canal. AgCA9 mRNA expression
was evaluated using qPCR from cDNA derived from whole larval alimentary canal,
GC, AMG, PMG, MT and rectum. The results were normalized to the An.
gambiae 18s ribosomal RNA gene and reported relative to whole larval
alimentary canal (Fig. 2). qPCR
detected RNA expression in every region tested; however, the rectum was the
region that expressed AgCA9 significantly above whole larval alimentary canal
levels.
|
In situ hybridization was performed using full-length DIG-labeled RNA probes to detect AgCA9 RNA in the early 4th-instar whole-mount An. gambiae larval guts and carcass (including all remaining tissues of the mosquito after the alimentary canal is removed) (Fig. 3). Full-length probes were shown to generate a more specific representation of mRNA expression than cleaved probes (E. Meleshkavich, personal communication). The most intense AgCA9-specific staining of the alimentary canal was seen throughout the cytoplasm of the cells of the GC, TR and rectum, with weaker staining seen in the cells of the PMG. Currently, there is no method of morphologically discriminating the TR in the dissection of alimentary canal regions without electron microscopy. Therefore, RNA from this region is diluted into AMG and PMG samples and cannot be distinguished using qPCR. The most abundant staining of the carcass was seen in the fat body and muscle. No staining was seen in the alimentary canal or carcass using the sense probe.
|
|
|
|
Ectoperitrophic fluid
While detection of AgCA9 protein on a western blot indicated significant
protein levels in the GC, immunohistochemical results within the cells of the
GC were variable. In most preparations, AgCA9 was detected in the
proteinaceous matrix that occupied the lumen of the GC and lined the
alimentary canal (from the GC through the PMG) within the ectoperitrophic
space but was not detected in the food bolus
(Fig. 6A). AgCA9 protein is
indeed within the ectoperitrophic space and not in the peritrophic matrix
(PM). The proteinaceous matrix expressing AgCA9 was measured to be 10–27
µm thick in both longitudinal and cross-sections of whole larvae embedded
in paraffin (e.g. Fig. 6A),
making it 10–30 times thicker than the PM in Ae. aegypti
(Clements, 1992
). This
proteinaceous matrix is clearly non-cellular and most likely comprises the
ectoperitrophic fluid, which is known to have an important role in insect
digestion (Terra and Ferreira,
1981
; Terra et al.,
1979
). Both vitally and as a result of fixation, there are areas
along the midgut where the PM lies very close to the epithelial cells. This
results in a very thin ectoperitrophic space where the ectoperitrophic fluid
is immediately adjacent to the apical membrane of the epithelial cells. Based
on numerous immunolocalization experiments, we do not believe that AgCA9
protein is located on the apical membrane of any midgut epithelial cells but
is confined to the ectoperitrophic fluid.
Transitional region
The cells of the TR clearly express AgCA9 mRNA as demonstrated by in
situ hybridization; however, protein detection was variable. In many
preparations, AgCA9 protein was observed in association with the periphery of
the nucleus (Fig. 6B).
Na+/K+-ATPase was found by others to have regionally
specific membrane localization in Ae. Aegypti, with a switch in
polarity from the apical membrane in the AMG to the basal membrane in the PMG
(Patrick et al., 2006
). This
polarity switch is also evident in An. gambiae (B. A. Okech, personal
communication) and can be used to identify the AMG and PMG regions. The
beginning of the TR is marked by the switch in localization of
Na+/K+-ATPase to the basal membrane
(Fig. 6C, arrowhead). The AgCA9
protein was restricted to the nuclei of the cells of the TR and did not extend
into the AMG. No marker for the end of the TR and beginning of the PMG is
known at this time. Counterstaining with the nuclear stain DRAQ-5 confirmed
that CA protein was confined to the periphery of the nucleus but was absent
from the center region of the structure
(Fig. 6D).
Malpighian tubules
AgCA9 protein was detected in a punctate pattern within the principal cells
of the MT, with stellate cells appearing devoid of protein
(Fig. 7). The protein appeared
to associate with cytoplasmic inclusions throughout the MT and did not
localize to either the membrane or nucleus.
|
|
Phylogenetic analysis
A phylogenetic tree comparing predicted and cloned CA transcripts from
H. sapiens, D. melanogaster, Ae. aegypti and An. gambiae
showed a general segregation of human and insect CAs
(Fig. 9). This separation was
not seen in the case of the CA-RPs, proteins that have lost an essential
histidine residue at the active site and are no longer active. Interestingly,
AgCA9 was the sole An. gambiae CA that clustered with H.
sapiens CAs, along with its D. melanogaster and Ae.
aegypti homologues. Within the H. sapiens CAs, clustering
occurred between proteins with the same or similar subcellular localizations.
There was a distinct separation between the secreted, membrane-bound and
transmembrane CAs. Cytosolic and mitochondrial CAs formed a fourth
cluster.
|
| Discussion |
|---|
|
|
|---|
-CA genes and one
ß-CA gene to be present in the An. gambiae genome, six of which
have already been fully cloned by the Linser laboratory (e.g.
Table 1)
(Linser et al., 2003
-carbonic anhydrase family and is located on
chromosome 3R
(www.vectorbase.org).
Together, qPCR and in situ hybridization revealed that AgCA9 mRNA
is most abundant in the GC, the TR and the rectum. These data were supported
by data generated from microarrays performed using mRNA from the various
regions of the An. gambiae alimentary canal [GC, AMG, PMG, hindgut
(HG)] (Neira et al., in
press
). Separate data were not available for MT and rectum but
were combined into one sample labeled `HG'. The microarray compared the
expression levels of approximately 14 000 An. gambiae genes
(Affymetrix GeneChip® Plasmodium/Anopheles Genome Array;
Affymetrix Inc., Santa Clara, CA, USA) in each region of the alimentary canal
as compared with whole insect. The microarray detected a higher expression of
AgCA9 in the GC and HG than that of whole insect (Neira et al., 2006).
To test the theory of an extracellular CA, antibody probes against AgCA9 were used to determine protein distribution within the alimentary canal. AgCA9 was detected in the proteinaceous matrix that occupies the GC lumina as well as the length of the midgut in the ectoperitrophic space. Additionally, AgCA9 protein was found in the cells of the TR and MT and in the cytoplasm of the DAR cells within the rectum.
There are obvious discrepancies between the determination of AgCA9 mRNA and protein localization. These can be explained simply by recalling that protein localization does not necessarily mirror mRNA transcription. For example, MT were found to have very little AgCA9 mRNA; however, we consistently saw protein in MTs of paraffin sections. A developmental shift in mRNA and protein production could account for these differences. All experiments were performed on early 4th-instar larvae. It is possible that AgCA9 mRNA is expressed in the MT of earlier larval stages and then wanes as the larvae near pupation; if AgCA9 has a slow protein turnover rate, this would lead to the presence of protein in the absence of mRNA expression.
Ectoperitrophic fluid
According to one view of pH regulation in the mosquito alimentary canal, CA
catalyzes the production of bicarbonate in the cells of the midgut, which is
then translocated into the lumen by a plasma membrane anion exchanger. Our
failure to locate this anion exchanger led us to hypothesize the existence of
an extracellular CA in the lumen of the alimentary canal. Indeed,
immunohistochemistry revealed AgCA9 protein in the proteinaceous matrix
(ectoperitrophic fluid) of the ectoperitrophic space within the GC lumina and
down the length of the alimentary canal, including the AMG, TR and PMG.
AgCA9 protein in the GC and along the length of the midgut may serve as a
source of bicarbonate and carbonate ions with a maximum buffer capacity at
both pHs 8.2 and 10.5, respectively. Mosquito alimentary canal epithelial
cells are metabolically active, producing carbon dioxide (CO2).
CO2 can diffuse freely across the cellular membrane and into the
ectoperitrophic space, where CA can catalyze its conversion to bicarbonate.
Bicarbonate can buffer the lumina of the GC and PMG to a pH around 8.0.
Moreover, in the AMG epithelium, a basally located V-ATPase is positioned to
move H+ ions vectorally out of the cells
(Zhuang et al., 1999
),
resulting in a transepithelial potential that is lumen-negative
(Clark et al., 1999
). This
likely results from the combined activities of the V-ATPase and a
K+/2H+ antiporter
(Lepier et al., 1995
), which
produce a net movement of protons into the hemolymph in the AMG. This loss of
luminal H+ should result in the deprotonation of bicarbonate,
forming carbonate. This, combined with a strong cation such as a potassium or
sodium ion, would then provide the basis for buffering at a pH near 10.5.
Thus, the control of luminal midgut pH is not specifically based on the
physical disposition of CA but on the proton gradient generated within the
lumen. In caterpillars, the ectoperitrophic space was found to be equal in pH
to the endoperitrophic space (Gringorten
et al., 1993
). Thus, the same pH gradient exists in both
compartments of the lumen, and bicarbonate/carbonate in the ectoperitrophic
space could lead to a buffering of the entire lumen.
How does a cytoplasmic-like protein, one that is not predicted to have a
signal sequence, end up in the extracellular ectoperitrophic fluid? We suggest
AgCA9 protein is produced in the cells of the GC (recall that the GC was found
to be enriched in AgCA9 mRNA) and secreted into the ectoperitrophic space by a
type of exocytosis. There are several methods of secretion that do not require
a signal sequence that are often utilized to export digestive enzymes in the
cells of insect midguts. Merocrine secretion is a classic form of exocytosis,
occurring when membrane-bound vesicles containing soluble proteins open onto
the surface of the cell, allowing the proteins to be secreted into the lumen
(Hung et al., 2000
).
Alternatively, apocrine release occurs when a portion of the plasma membrane
buds off the cell, containing the proteins (ibid).
Notably, there is an unexpected lack of accumulation of AgCA9 protein
within the food bolus. The peritrophic matrix of An. gambiae larvae
is permeable to 148 kDa particles (Edwards
and Jacobs-Lorena, 2000
) and would be expected to allow 31.5 kDa
AgCA9 to freely diffuse into the food bolus. However, the native enzyme
conformation of AgCA9 is unknown at this time and could be oligomeric.
Additionally, the enzyme may be complexed with other enzymes, making it
larger, or may associate with the peritrophic matrix and accumulate at this
junction without passing through to the food bolus.
Transitional region
AgCA9 mRNA clearly localized to the TR using in situ
hybridization; however, the protein localization was not as clear, appearing
to localize to the periphery of the nuclei of the cells in this area. The
unusual localization of AgCA9 to the nuclei is not unprecedented. There are
many papers that have noted CA in the nucleus using both immuno- and
enzyme-histochemical methods (Hansson,
1967
; Lutjen-Drecoll and
Lonnerholm, 1981
; Anderson et
al., 1982
; Brown et al.,
1983
; Brown and Kumpulainen,
1985
; Toyosawa et al.,
1996
). These papers make no claims as to the validity of these
findings and most relate enzyme histochemical detection to the fact that the
nuclei act as crystallization centers for the reaction products of Hansson's
cobalt precipitation method (Ridderstråle, 1991). We observed AgCA9
nuclear localization using immunohistochemical analyses that are not based on
enzymatic activity, and hence nuclear CA remains a physiological mystery.
The TR has recently been described as a unique region in the alimentary
canal that was previously thought to be part of the PMG. This region is
described as having a continuous morphological change between the AMG and PMG
in contrast to a mixture of cells from each region
(Clark et al., 2005
). The
cells of this region have long microvilli and a high density of mitochondria
(Clark et al., 2005
),
suggesting a transport role involving a high rate of ATPase activity in
Ae. aegypti. A distinct band of GPI-linked CA mRNA has previously
been described in the anterior end of the PMG as well as an increased mRNA
expression of an anion exchanger, AgAE1, in this region
(Seron et al., 2004
) (T. J.
Seron, personal communication). This localization to the nuclei of the TR
identifies a differential quality of these cells compared with the rest of the
alimentary canal. The beginning of the TR demarcates the area at which the
highly alkaline pH of the AMG drops to near-neutral values within the lumen of
the alimentary canal. We predict that these cells have an important role in
the de-alkalization of the alimentary canal. At this time, no explanation is
evident for the association of AgCA9 with the nuclei of these cells.
Malpighian tubules
MTs are important components of the mosquito osmoregulatory system,
maintaining hemolymph volume and composition
(Bradley, 1987
). An.
gambiae larvae are equipped with five MT, which are composed of two cell
types: principal cells and stellate cells. The larger principal cells
contained AgCA9 protein associated with membranes of vesicular cytoplasmic
inclusions, while no such protein was detected in the smaller stellate cells.
Palatroni et al. localized CA activity to vesicular cytoplasmic inclusions
within the MT of Culex pipiens using Hansson's method for
histochemical localization (Palatroni et
al., 1981
). They noted that CA activity was only evident at the
level of the membranes of these inclusions and was lacking on the cellular
membrane, nucleus and other cytoplasmic structures. The cytoplasm of principal
cells is densely packed with membrane-limited vesicles containing concretion
bodies – metallo-organic aggregates of Ca2+, Mg2+
and K+ that have roles in metal ion storage as well as
transepithelial transport. Stellate cells notably lack these concretion bodies
(Beyenbach, 2003
;
Clements, 1992
). AgCA9 protein
detection mirrors the enzymatic pattern shown by Palatroni et al.
(Palatroni et al., 1981
) and
possibly represents association with concretion bodies.
DAR cells
Meredith and Phillips analyzed the ultrastructure of freshwater vs
saltwater mosquito larvae, using Ae. aegypti and Aedes
campestris, respectively, as representative mosquitoes. They specifically
stated that, whereas saltwater mosquito larvae possess a rectum that is
divided into two regions, the rectum of freshwater mosquito larvae is uniform
in structure and function, similar to the anterior rectum of saltwater
breeders (Meredith and Phillips,
1973
). This has been supported by light microscopy of two other
species of mosquito, Aedes albopictus
(Asakura, 1970
) and Aedes
detritus (Ramsay, 1950
),
as well as with hemipteran larvae, Hydrometra stagnorum and
Halosalada lateralis (Goodchild,
1969
). Meredith and Phillips hypothesized that the posterior
region of the rectum is unique to saltwater breeders and is used for
generating hyperosmotic urine as a way of regulating the high salt intake. The
anterior portion of the rectum is thought to selectively resorb ions, water
and metabolites produced by the MTs
(Meredith and Phillips, 1973
).
As primarily a freshwater breeder, An. gambiae larvae would be
expected to have a uniform rectum. However, AgCA9 clearly localized solely to
a subset of cells in the anterior region of the An. gambiae rectum,
suggesting distinctive functions of these cells in the rectum. The protein was
not detected in the entire anterior rectum but was localized to cells on the
dorsal side (DAR cells). This cellular pattern is reminiscent of insect
`rectal glands' – specialized groups of rectal epithelial cells that
have a major role in water absorption
(Wigglesworth, 1932
). Although
rectal glands are thought to be absent from nearly all larvae (ibid),
this possibility cannot be excluded.
The DAR cells also differentially expressed other pH- and ion-regulatory proteins such as Na+/K+-ATPase, V-ATPase (B. A. Okech, personal communication) and an An. gambiae cytoplasmic CA (AgCA11; accession number AY280613) (T. J. Seron, personal communication). This suggests a highly regulated system of pH and ion regulation within the rectum. Clearly, the rectum of this particular freshwater breeder is not uniform, as originally thought, but the specific roles of the DAR cells remain to be determined. Most of the work on the mosquito larval rectum has been performed on members of the subfamily Culicinae, with no information available on the rectum of Anophelinae larvae, including An. gambiae. The DAR cells may be unique to the larvae of Anopheline mosquitoes.
Our data suggest that the regions of the An. gambiae rectum may
have similar roles to the anterior and posterior regions of the rectum in
saltwater breeders. The rectum is an important site of pH and
HCO3– regulation in the larvae of Aedes
dorsalis, a saltwater mosquito capable of inhabiting hypersaline lakes
(HCO3– and CO32–
concentrations as high as 1–2.4 mol l–1 and pH values
exceeding 10) (Strange et al.,
1982
). Using microperfused rectum preparations, it was reported
that the anterior rectum is a site of CO2 secretion in the form of
a Cl–/HCO3– exchange.
Additionally, the authors predicted the involvement of a basolateral 1:1
Cl–/HCO3– exchanger and a CA,
based on data obtained using inhibitory compounds. The posterior rectum was
found to secrete a hyperosmotic fluid containing Na+,
Cl– and HCO3–, as originally
suggested by Meredith and Phillips
(Meredith and Phillips, 1973
;
Strange et al., 1984
). Our
data suggest similar roles for the rectum in An. gambiae, with the
DAR cells acting as the anterior rectum. The role of the anterior rectum of
saltwater species in CO2 secretion was demonstrated, but a full
explanation of the mechanism was not available at the time. Our data
complement the work of Strange et al.
(Strange et al., 1984
) by
demonstrating the existence of a CA in the DAR cells. AgCA9 within these cells
can catalyze the conversion of CO2 to
HCO3–, which can then be transported into the
lumen by an as yet unidentified anion exchanger and excreted. Supporting this
hypothesis, it is known that mosquito larvae alkalize their rearing media by
excreting bicarbonate (Stobbart,
1971
) and it has been shown that this alkalization can be blocked
using global CA inhibitors (Corena et al.,
2002
). The remainder of the cells of the rectum express
Na+/K+-ATPase, a protein capable of transporting one of
the three main ions secreted by the posterior rectum of saltwater
mosquitoes.
Phylogeny
A phylogenetic analysis was performed to examine the relationship between
CAs in the H. sapiens, D. melanogaster, Ae. aegypti and
An. gambiae genomes. Alignments were made between known and predicted
protein sequences as reported by the ensembl February 2007 release, and a tree
was generated. A distinct separation was seen between insect and human CAs.
However, CA-RPs showed no such distinction and clustered together. This
suggests that the CA-RPs are conserved between protostomes and deuterostomes
and that active CA amplification took place after their divergence. Although
CA-RPs lack CA activity, they are known to be highly conserved proteins,
indicating that they serve a critical cellular function
(Tashian et al., 2000
).
Interestingly, AgCA9 and its Drosophila and Aedes
counterparts were the sole insect CAs that cluster with human CAs. This
association suggests that AgCA9 is closer to the primal protein from which
other CAs branched. In fact, AgCA9 was closely associated with CAVII, the
H. sapiens CA, which is the most highly conserved of the active CA
isozymes and thought to resemble most closely the ancestral state
(Hewett-Emmett and Tashian,
1996
; Chegwidden and Carter,
2000
). This implies that AgCA9 is a highly conserved protein and
likely to play a role in similarly conserved functionalities.
Conclusions
The cloning and characterization of the cytosolic-like
-CA, AgCA9,
and its extracellular localization to the ectoperitrophic fluid support the
hypothesis that bicarbonate production in the lumen is mediated by
CO2 diffusion followed by the action of an extracellular CA. If
AgCA9 actively catalyzes the production of bicarbonate within the midgut
lumen, it would suggest that it is a key player in AMG alkalization and
therefore is key to survival. The protein was also detected in the cells of
the TR, MT and DAR, a previously undescribed region of the rectum. We have
shown differential localization of the ionoregulatory protein
Na+/K+-ATPase in addition to AgCA9 in this region. The
fact that DAR cells differentially express a number of pH/ion regulatory
proteins suggests an overlooked and important role for these cells in larval
pH regulation in Anopheline mosquito larvae. A phylogenetic analysis revealed
AgCA9 to cluster with H. sapiens CAs and to closely associate with
CAVII, the most basal H. sapiens CA, implying a highly conserved, and
thus important, physiological role. Further studies will be performed to
investigate the function of AgCA9, specifically focusing on its role in pH-
and ion-regulation.
List of abbreviations
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Anderson, R. E., Gay, C. V. and Schraer, H. (1982). Carbonic anhydrase localization by light and electron microscopy. J. Histochem. Cytochem. 30,1135 -1145.[Abstract]
Asakura, K. (1970). Studies on the structural basis for ion- and water-transport by the osmoregulatory organs of mosquitoes. I. Fine structure of the rectal epithelium of Aedes albopictus larvae. Sci. Rep. Kanazawa Univ. 1, 37-55.
Berenbaum, M. (1980). Adaptive significance of midgut pH in larval Lepidoptera. Am. Nat. 115,138 -146.[CrossRef]
Beyenbach, K. W. (2003). Transport mechanisms
of diuresis in Malpighian tubules of insects. J. Exp.
Biol. 206,3845
-3856.
Bradley, T. J. (1987). Physiology of osmoregulation in mosquitoes. Annu. Rev. Entomol. 32,439 -462.[Medline]
Brown, D. and Kumpulainen, T. (1985). Immunocytochemical localization of carbonic anhydrase on ultrathin frozen sections with protein A-gold. Histochemistry 83,153 -158.[CrossRef][Medline]
Brown, D., Kumpulainen, T., Roth, J. and Orci, L. (1983). Immunohistochemical localization of carbonic anhydrase in postnatal and adult rat kidney. Am. J. Physiol. 245,F110 -F118.[Medline]
Chegwidden, R. W. and Carter, N. D. (2000). Introduction to the carbonic anhydrases. In The Carbonic Anhydrases: New Horizons (ed. W. R. Chegwidden, N. D. Carter and Y. H. Edwards), pp. 13-28. Basel: Birkhäuser.
Clark, T. M., Koch, A. and Moffet, D. F. (1999). The anterior and posterior `stomach' regions of larval Aedes aegypti midgut: regional specialization of ion transport and stimulation by 5-hydroxytryptamine. J. Exp. Biol. 202,247 -252.[Abstract]
Clark, T. M., Hutchinson, M. J., Huegel, K. L., Moffett, S. B. and Moffett, D. F. (2005). Additional morphological and physiological heterogeneity within the midgut of larval Aedes aegypti (Diptera: Culicidae) revealed by histology, electrophysiology, and effects of Bacillus thuringiensis endotoxin. Tissue Cell 37,457 -468.[CrossRef][Medline]
Clements, A. N. (1992). The Biology of Mosquitoes, Vol. 1 (ed. A. N. Clements). London: Chapman and Hall.
Corena, M. P., Seron, T. J., Lehman, H. K., Ochrietor, J. D.,
Kohn, A., Tu, C. and Linser, P. J. (2002). Carbonic anhydrase
in the midgut of larval Aedes aegypti: cloning, localization and
inhibition. J. Exp. Biol.
205,591
-602.
Dadd, R. H. (1975). Alkalinity within the midgut of mosquito larvae with alkaline-active digestive enzymes. J. Insect Physiol. 21,1847 -1853.[CrossRef][Medline]
Dow, J. A. T. (1984). Extremely high pH in the biological systems: a model for carbonate transport. Am. J. Physiol. 246,R633 -R635.[Medline]
Edwards, M. J. and Jacobs-Lorena, M. (2000). Permeability and disruption of the peritrophic matrix and caecal membrane from Aedes aegypti and Anopheles gambiae mosquito larvae. J. Insect Physiol. 46,1313 -1320.[CrossRef][Medline]
Goodchild, A. J. P. (1969). The rectal glands of Halosalada lateralis (Fallen) (Hemiptera: Saldidae) and Hydrometra stagnoum (L.) (Hemiptera: Hydrometridae). Proc. R. Entomol. Soc. Lond. A 44,62 -70.
Gringorten, J. L., Crawford, D. N. and Harvey, W. R. (1993). High pH in the ectoperitrophic space of the larval lepidopteran midgut. J. Exp Biol. 183,353 -359.[Medline]
Hansson, H. P. J. (1967). Histochemical demonstration of carbonic anhydrase activity. Histochemie 11,112 -128.[CrossRef][Medline]
Hewett-Emmett, D. and Tashian, R. E. (1996). Functional diversity, conservation and convergence in the evolution of the alpha-, beta-, and gamma-carbonic anhydrase gene families. Mol. Phylogenet. Evol. 5,50 -77.[CrossRef][Medline]
Hung, C., Lin, T. and Lee, W. (2000). Morphology and ultrastructure of the alimentary canal of the oriental fruit fly, Bactrocera dorsalis (Hendel) (Dipteria: Tephritidae) (2): The structure of the midgut. Zool. Stud. 39,387 -394.
Lebovitz, R. M., Takeyasu, K. and Fambrough, D. M. (1989). Molecular characterization and expression of the (Na[+]+K[+])-ATPase alpha-subunit in Drosophila melanogaster. EMBO J. 8,193 -202.[Medline]
Lepier, A., Azuma, M., Harvey, W. R. and Wieczorek, H. (1995). K+/H+ antiport in the tobacco hornworm midgut: the K+-transporting component of the K+ pump. J. Exp. Biol. 196,361 -373.
Linser, P. J., Seron, T. J., Hill, J. and Lehman, H. K. (2003). Characterization of novel carbonic anhydrases in larval mosquitoes. Am. J. Trop. Med. Hyg. 69, 335.
Lutjen-Drecoll, E. and Lonnerholm, G. (1981).
Carbonic anhydrase distribution in the rabbit eye by light and electron
microscopy. Invest. Ophthalmol. Vis. Sci.
21,782
-797.
Matz, M. (2003). Amplification of representative amounts of cDNA pools from microscopic amounts of animal tissue. Methods Mol. Biol. 221,103 -116.[Medline]
Matz, M., Shagin, D., Bogdanova, E., Britanova, O., Lukyanov,
S., Diatchenko, L. and Chenchik, A. (1999). Amplification of
cDNA ends based on template-switching effect and step-out PCR.
Nucleic Acids Res. 27,1558
-1560.
Meleshkevitch, E. A., Assis-Nascimento, P., Popova, L. B.,
Miller, M. M., Kohn, A. B., Phung, E. N., Mandal, A., Harvey, W. R. and
Boudko, D. Y. (2006). Molecular characterization of the first
aromatic nutrient transporter from the sodium neurotransmitter symporter
family. J. Exp. Biol.
209,3183
-3198.
Meredith, J. and Phillips, J. E. (1973). Rectal ultrastructure in salt- and freshwater mosquito larvae in relation to physiological state. Z. Zellforsch. Mikrosk. Anat. 138, 1-22.[CrossRef][Medline]
Neira, M. O., VanEkeris, L., Corena Mc-Leod, M. P. D. and Linser, P. J. (in press). A micro-array based analysis of transcriptional compartmentalization in the alimentary canal of Anopheles gambiae (Diptera: Culicidae) larvae. J. Ins. Mol. Biol., in press.
Palatroni, P., Gabrielli, M. G. and Scattolini, B. (1981). Histochemical localization of carbonic anhydrase in Malpighian tubules of Culex pipiens. Experientia 37,409 -411.[CrossRef]
Patrick, M. L., Aimanova, K., Sanders, H. R. and Gill, S. S.
(2006). P-type Na+/K+-ATPase and V-type
H+-ATPase expression patterns in the osmoregulatory organs of
larval and adult mosquito Aedes aegypti. J. Exp. Biol.
209,4638
-4651.
Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29,2002 -2007.
Ramsay, J. A. (1950). Osmotic regulation in
mosquito larvae. J. Exp. Biol.
27,145
-157.
Ridderstårle, Y. (1991). Localization of carbonic anhydrase by chemical reactions. In The Carbonic Anhydrases: Cellular Physiology and Molecular Genetics (ed. S. J. Dodgson, R. E. Tashian, G. Gros and N. D. Carter), pp.133 -144. New York: Plenum Press.
Seron, T. J., Hill, J. and Linser, P. J.
(2004). A GPI-linked carbonic anhydrase expressed in the larval
mosquito midgut. J. Exp. Biol.
207,4559
-4572.
Stobbart, R. H. (1971). Evidence of
Na+/H+ and
Cl–/HCO3– exchanges during
independent sodium and chloride uptake by the larvae of the mosquito Aedes
aegypti. J. Exp. Biol. 54,19
-27.
Strange, K., Phillips, J. E. and Quamme, G. A.
(1982). Active HCO3– secretion in the
rectal salt gland of a mosquito larva inhabiting
NaHCO3-CO3 lakes. J. Exp. Biol.
101,171
-186.
Strange, K., Phillips, J. E. and Quamme, G. A. (1984). Mechanisms of CO2 transport in rectal salt gland of Aedes. II. Site of Cl–HCO3– exchange. J. Exp. Biol. 246,R735 -R740.
Tashian, R. E., Hewett-Emmett, D., Carter, N. D. and Bergenhem, N. C. H. (2000). Carbonic anhydrase (CA)-related proteins (CA-RPs), and transmembrane proteins with CA or CA-RP domains. In The Carbonic Anhydrases: New Horizons (ed. W. R. Chegwidden, N. D. Carter and Y. H. Edwards), pp.105 -120. Basel: Birkhäuser.
Terra, W. R. and Ferreira, C. (1981). The physiological role of the peritrophic membrane and trehalase: digestive enzymes in the midgut and excreta of starved larvae of Rhynchosciara.J. Insect Physiol. 27,325 -331.[CrossRef]
Terra, W. R., Ferreira, C. and Bianchi, A. G. (1979). Distribution of digestive enzymes among the endo- and ectoperitrophic spaces and midgut cells of Rhynchosciara and its physiological significance. J. Insect Physiol. 25,487 -494.[CrossRef]
Toyosawa, S., Ogawa, Y., Inagaki, T. and Ijuhin, N. (1996). Immunohistochemical localization of carbonic anhydrase II in rat incisor epithelial cells at various stages of amelogenesis. Cell Tissue Res. 285,217 -225.[CrossRef][Medline]
Wigglesworth, V. B. (1932). On the function of the so called `rectal glands' of insects. J. Cell Sci. 75,131 -150.
Zhang, Y. and Frohman, M. A. (1997). Using rapid amplification of cDNA ends (RACE) to obtain full-length cDNAs. Methods Mol. Biol. 69,61 -87.[Medline]
Zhuang, Z., Linser, P. J. and Harvey, W. R. (1999). Antibody to H+ V-ATPase subunit E colocalizes with portasomes in alkaline larval midgut of a freshwater mosquito (Aedes aegypti L.). J. Exp. Biol. 202,2449 -2460.[Abstract]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
P. J. Linser, K. E. Smith, T. J. Seron, and M. Neira Oviedo Carbonic anhydrases and anion transport in mosquito midgut pH regulation J. Exp. Biol., June 1, 2009; 212(11): 1662 - 1671. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shanbhag and S. Tripathi Epithelial ultrastructure and cellular mechanisms of acid and base transport in the Drosophila midgut J. Exp. Biol., June 1, 2009; 212(11): 1731 - 1744. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Onken and D. F. Moffett Revisiting the cellular mechanisms of strong luminal alkalinization in the anterior midgut of larval mosquitoes J. Exp. Biol., February 1, 2009; 212(3): 373 - 377. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Smith, L. A. VanEkeris, B. A. Okech, W. R. Harvey, and P. J. Linser Larval anopheline mosquito recta exhibit a dramatic change in localization patterns of ion transport proteins in response to shifting salinity: a comparison between anopheline and culicine larvae J. Exp. Biol., October 1, 2008; 211(19): 3067 - 3076. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Okech, E. A. Meleshkevitch, M. M. Miller, L. B. Popova, W. R. Harvey, and D. Y. Boudko Synergy and specificity of two Na+-aromatic amino acid symporters in the model alimentary canal of mosquito larvae J. Exp. Biol., May 15, 2008; 211(10): 1594 - 1602. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Okech, D. Y. Boudko, P. J. Linser, and W. R. Harvey Cationic pathway of pH regulation in larvae of Anopheles gambiae J. Exp. Biol., March 15, 2008; 211(6): 957 - 968. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||