|
| |
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online August 31, 2007
Journal of Experimental Biology 210, 3295-3300 (2007)
Published by The Company of Biologists 2007
doi: 10.1242/jeb.006536
p38 MAPK is a likely component of the signal transduction pathway triggering rapid cold hardening in the flesh fly Sarcophaga crassipalpis
Department of Entomology, Ohio State University, 400 Aronoff Laboratory, 318 West 12th Avenue, Columbus, OH 43210, USA
* Author for correspondence (e-mail: fujiwara.6{at}osu.edu)
Accepted 11 July 2007
 |
Summary |
|---|
 TOP Summary IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Key words: cold stress, diapause, signal transduction, MAP kinase, phosphorylation
|
Introduction |
|---|
|
TOPSummaryIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
;
Lee et al., 1987a;
Denlinger and Lee, 1998). For
example, nondiapausing pharate adults of the flesh fly Sarcophaga
crassipalpis that have been reared at 25°C cannot survive direct
exposure to –10°C, but if they first receive a brief exposure of a
few minutes or hours at 0°C they readily survive –10°C
(Chen et al., 1987;
Lee et al., 1987a). The RCH
response has been documented in diverse insect species and appears to be a
mechanism used to track daily changes in temperature
(Kelty and Lee, 2001).
Currently, there are several biochemical and molecular events known to be
associated with RCH. Glycerol, a classic cryoprotectant, increases during RCH
(Lee et al., 1987a), but this
increase is rather modest and is unlikely to be the sole agent rendering
protection. More recently, changes in composition of cell membranes have been
implicated in RCH (Overgaard et al.,
2005; Michaud and Denlinger,
2006), and studies based on microarrays
(Qin et al., 2005) and
metabolomics (Michaud and Denlinger,
2007) suggest that numerous gene networks and metabolic pathways
are involved in this response.
One of the major outstanding questions associated with RCH is identifying
the signaling system responsible for induction. Somehow, the environmental
signal of a decrease in temperature activates the physiological mechanisms
associated with RCH. Based on characteristics of the RCH response in S.
crassipalpis, we know that a candidate signaling agent for this fly would
have the following characteristics: maximum responsiveness at temperatures
around 0°C (Chen et al.,
1991), the capacity to be activated within 10 min and retention of
activity for several hours (Chen et al.,
1987; Lee et al.,
1987a), decay of activation quickly upon return to higher
temperature (Chen et al.,
1991), developmental loss of activation capacity in developmental
stages that are already cold hardy, e.g. diapause
(Chen et al., 1987), and a
non-dependence on the brain for activation
(Yi and Lee, 2004).
In the present study, we propose that phosphorylation of p38
mitogen-activated protein kinase (p38 MAPK) meets the criteria of a candidate
signaling molecule. The MAPK family is well known for its role in transmitting
stress signals from the environment to the cell nucleus. MAPKs are
serine/threonine kinases that, when phosphorylated, enter the nucleus and
phosphorylate various transcription factors, enzymes and other proteins that
modulate cellular activity (Martin-Blanco,
2000; Ono and Han,
2000; Cowan and Storey,
2003). Activation of the MAPKs involves phosphorylation at both
the serine/threonine and tyrosine residues. Previous experiments demonstrating
a role for the MAPK family in insect diapause and cold acclimation
(Iwata et al., 2005;
Fujiwara et al., 2006a;
Fujiwara and Shiomi, 2006;
Fujiwara et al., 2006b;
Kidokoro et al., 2006a;
Kidokoro et al., 2006b)
suggest that members of this family of signaling molecules may also be
involved in RCH.
To establish the validity of using antibodies directed against mammalian members of the MAPK family, we first cloned p38 MAPK from S. crassipalpis and determined that flesh fly p38 MAPK has high identity to mammalian p38 MAPK. Antibodies directed against p38 MAPK and the phosphorylated form of p38 MAPK, along with those directed against other members of the MAPK family, were then used to determine the environmental conditions that elicit activation (phosphorylation) and subsequent inactivation. Additional experiments evaluate the responsiveness of different tissues to activation, developmental changes that affect activation, and the potential role of the brain in mediating this response.
|
Materials and methods |
|---|
|
TOPSummaryIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
). The anterior
caps of the puparia were removed to observe development. To initiate diapause
termination, 5 µl hexane was applied to the head of diapausing individuals
(Denlinger et al., 1980). For RCH experiments, a single larva, pupa or pharate adult was placed in a thin-walled glass test tube (1.5x10 cm) that was capped with a cotton plug. The tubes were placed in a low-temperature bath filled with 50% glycerol.
For experiments utilizing ligated abdomens, the pupae were first punctured
in the head to prevent rupture of the abdomen following ligation. Ligation
between the head and thorax was performed using nylon thread
(Yoder et al., 2006).
Tissue dissections were performed in phosphate-buffered saline (50 mmol l–1 sodium phosphate, pH 7.5 and 150 mmol l–1 NaCl) with 10 mmol l–1 EDTA under a dissection microscope.
Chemicals
Anti-phospho-p38, anti-phospho-JNK and anti-phospho-ERK MAPK rabbit
antibodies and peroxidase-conjugated anti-rabbit IgG goat antibody (used at
1:1000 dilutions) were from Cell Signaling Technology (Beverly, MA, USA). A
goat antibody against the N-terminal sequence of Drosophila p38 MAPK
(anti-total-p38 MAPK antibody; used at 1:400 dilutions) and
peroxidase-conjugated anti-goat IgG donkey antibody (used at 1:5000 dilutions)
were from Santa Cruz Biotechnology (Santa Cruz, CA, USA).
Western blotting
Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE)
and western blotting were described previously
(Iwata et al., 2005). A single
animal was used for each sample. Whole bodies were homogenized in 10 volumes
of SDS-PAGE sample buffer. For experiments using dissected tissues, five
brains, head epidermis from four individuals, three midguts or fat body from
the head of one pupa were homogenized in 100 µl SDS-PAGE sample buffer.
Protein samples were boiled for 5 min, and 5 µl was applied to each lane.
Proteins were separated by SDS-PAGE, and gels were then transferred to
polyvinylidine difluoride membranes (Immobilon; Millipore, Bedford, MA, USA).
Membranes were incubated with primary antibodies and a peroxidase conjugated
secondary antibody and were visualized on X-ray film using LumiGLO
chemiluminescent reagent (KPL; Gaithersberg, MD, USA). Each treatment was
replicated at least three times.
cDNA cloning
Total RNA was isolated from the brain and optic lobes of nondiapausing
pupae of S. crassipalpis using TRizol reagent (Invitrogen, Carlsbad,
CA, USA). cDNA was synthesized using SuperScript II reverse transcriptase
(Invitrogen). The p38 MAPK cDNA was amplified using degenerate PCR primers
p38-1 (GTNAAYGARGAYTGYGA) and p38-2 (TGRTYRTARTGCATCCARTT) (where Y=T or C;
R=A or G; N=A, C, G or T) using Platinum Taq DNA Polymerase High Fidelity
(Invitrogen). The PCR conditions were described previously
(Ijiro et al., 2004;
Fujiwara et al., 2006a). The
amplified DNA fragments were subcloned into plasmids and sequenced. The
5' and 3' regions of the p38 MAPK cDNA were obtained using a SMART
RACE cDNA amplification kit (Clontech Laboratory, Mountain View, CA, USA)
according to the manufacturer's instructions with primers p38-6
(ATCACGACGTTTCATGGGTGGCAA) and p38-3 (TTGGATTTCGGTTTGGCACGTC) for 5' and
3' RACE, respectively. Finally, the whole coding region of the
Sarcophaga p38 MAPK was amplified using PCR primers p38-7
(AAACGAACGAGTCAGAACGTAGATAAACA) and p38-14 (TGTGCGCTGAATGAACATTATTGTTTCTAA) at
the 5' and 3' untranslated regions, respectively.
|
Results |
|---|
|
TOPSummaryIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
|
p38 MAPK is activated by low temperature
To examine the roles of MAPKs in temperature stress responses in S.
crassipalpis, we analyzed the phosphorylated state of MAPKs in
nondiapausing red-eye pharate adults incubated for 2 h at temperatures ranging
from –10 to 40°C (Fig.
2). Both anti-phospho and anti-total p38MAPK antibodies
specifically recognized a single 42 kDa band. Increases of phospho-p38 MAPK
were observed in the low-temperature range from –5 to 10°C, with the
strongest increase observed at 0°C
(Fig. 2). No increase of
phospho-p38 MAPK was observed by heat shock. Although some fluctuations can be
seen, no major changes were observed in levels of phospho-ERK or phospho-JNK
by either high or low temperature. The total p38 MAPK protein level was
unchanged at all temperatures, indicating that changes in the levels of
phosphorylated p38 MAPK were due to phosphorylation rather than protein
synthesis. The close congruence between the temperature range inducing RCH
(Chen et al., 1991) and the
phosphorylation of p38 MAPK noted here suggests a causal link.
|
|
Another group of pharate adults was held at 0°C for 2 h and then transferred to 25 or –10°C for 2 h or held for an additional 2 h at 0°C (Fig. 3C). The signal was nearly completely lost at 25 and –10°C but persisted at the same level in individuals held at 0°C. To analyze the temporal profile of decay, pharate adults held for 2 h at 0°C were transferred to 25°C, and protein samples were prepared at various intervals thereafter (Fig. 3D). A decrease in the level of phospho-p38 MAPK was observed 15 min after transfer, and the levels decreased to trace amounts by 3 h (Fig. 3D).
Diapause- and developmental-stage-dependent activation of p38 MAPK
We analyzed phospho-p38 MAPK levels in various developmental stages of
diapausing and nondiapausing individuals. In nondiapausing flies reared at
25°C, the phospho-p38 MAPK levels in feeding and wandering third-instar
larvae and in day 0 puparia were greatly increased by exposure to 0°C
(Fig. 4A). The phospho-p38 MAPK
response gradually decreased after pupariation but recovered by day 9 (red-eye
pharate adult stage) (Fig. 4A).
When nondiapausing flies were reared at 20°C, phospho-p38 MAPK levels in
feeding and wandering larvae were greatly increased by exposure to 0°C,
but reduced levels of activation at 0°C were observed in day 0 and 6
puparia. The response was again evident by day 12, when the flies reached the
red-eye pharate adult stage (Fig.
4B).
|
In diapause-inducing conditions, phospho-p38 MAPK levels were activated by 0°C during the prediapause larval period, but the responsiveness suddenly dropped to trace levels at pupariation (Fig. 5A) and remained low throughout the cold-hardy pupal diapause stage (Fig. 5B). Responsiveness returned following termination of diapause (Fig. 5C), by which time the flies had lost much of their diapause-associated cold hardiness.
|
Tissue-specific and brain-independent activation of p38 MAPK
To determine whether specific tissues respond differently to p38 MAPK
phosphorylation, red-eye pharate adults were held at 0°C for 2 h, and
phospho-p38 MAPK levels were examined in different tissues
(Fig. 6A). Pronounced increases
were observed in the fat body and midgut. No change was observed in the brain,
and only a slight increase was observed in the optic lobes. p38 MAPK protein
was not detected in the epidermis.
|
|
Discussion |
|---|
|
TOPSummaryIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
), and
0°C is required not only to activate p38 MAPK but also to maintain the
activated phospho-p38 MAPK levels (Fig.
3C). The most striking feature of RCH is the rapidity of its
induction. A 10 min chilling at 0°C is sufficient for both p38 MAPK
activation (Fig. 3B) and RCH
induction (Chen et al., 1987;
Lee et al., 1987a). The
temporal profiles for the induction and the decay responses of RCH
(Chen et al., 1987) clearly
mirror the changes in levels of phospho-p38 MAPK that we noted in the current
study (Fig. 3A,D).
Developmentally, p38 MAPK activation is most robust in life stages where
the RCH response is most pronounced, i.e. in life stages that are inherently
less cold tolerant. For example, nondiapausing flies reared at 25°C are
less cold tolerant than those reared at 20°C
(Adedokun and Denlinger, 1984),
and in this study we see higher phospho-p38 MAPK activation in flies reared at
25 than at 20°C (Fig. 4).
Also, mid-pupal stages of nondiapausing flies reared at 25°C have higher
cold tolerance than other stages (Chen et
al., 1987; Lee et al.,
1987b), and during this period p38 MAPK is activated less strongly
by 0°C (Fig. 4). Diapausing
pupae, which have the highest level of cold tolerance
(Chen et al., 1987;
Lee et al., 1987b), showed
almost no p38 MAPK activation (Fig.
5), but when diapause is terminated, cold hardiness gradually
decreases (Lee and Denlinger,
1985; Lee et al.,
1987b), and the flies concurrently show increased p38 MAPK
responsiveness (Fig. 5). Thus,
there is a consistent relationship showing high p38 MAPK responsiveness in
stages with low inherent cold tolerance. It is these stages that can most
benefit from RCH. The other extreme is diapause, a stage that is already
developmentally programmed for cold hardiness and thus has no further need for
RCH. We thus suggest that p38 MAPK plays a key role in regulating RCH and is
likely to be a component of the signal transduction pathway that switches on
the RCH response.
The speed of p38 MAPK activation suggests that the low-temperature signal
directly activates p38 MAPK rather than being activated by cellular damage
caused by cold stress. p38 MAPK activation is specific to low temperature
(Fig. 2), thus heat shock
elicitation of RCH (Chen et al.,
1987) would necessitate the use of a different switch.
Regulation of glycerol production is a candidate target for p38 MAPK. The
ontogeny of cold tolerance in flesh flies correlates with the pattern of
glycerol synthesis (Lee et al.,
1987b). Glycerol concentrations are increased by exposure to
0°C (Lee et al., 1987a),
and injection of glycerol increases cold tolerance
(Yoder et al., 2006).
Possibly, p38 MAPK regulates glycerol synthesis in the fat body of S.
crassipalpis during RCH. Glycogen phosphorylase, which is activated
rapidly at 0°C, is a key enzyme for glycerol production
(Ziegler and Wyatt, 1975;
Chen and Denlinger, 1990).
Activation profiles of glycogen phosphorylase correspond to some extent with
those of p38 MAPK. Glycogen phosphorylase can be activated within 30 min at
0°C. Both glycogen phosphorylase and p38 MAPK show higher levels of
activation in nondiapausing than in diapausing flies. However, there are some
discrepancies as well: glycogen phosphorylase also can be activated by heat
stress, and no activation of glycogen phosphorylase was observed in larvae and
young pupae (Chen and Denlinger,
1990), despite the fact that p38 MAPK activations at 0°C can
be observed in these stages (Figs
4 and
5).
Synthesis of heat shock proteins (Hsps) is activated by both cold as well
as heat stress, but they are unlikely targets of p38 MAPK because Hsp
expression in this fly requires –10°C, not 0°C, and the Hsps are
synthesized during the recovery phase rather than during the actual cold
stress (Joplin et al., 1990;
Yocum et al., 1998;
Rinehart and Denlinger, 2000;
Rinehart et al., 2000). By
contrast, p38 MAPK is activated by 0°C, not –10°C, and it is not
activated during the recovery period from cold stress (Figs
2 and
3).
Recent studies indicate that proteins besides Hsps and compounds in
addition to glycerol may increase in response to RCH. RCH elevates the
expression of many genes, including stress proteins and membrane-associated
protein genes, in Drosophila melanogaster
(Qin et al., 2005). Chilling
increases oleic acid, which in turn can stabilize the structure of the cell
membrane in S. crassipalpis
(Michaud and Denlinger, 2006),
and a recent metabolomics study has also revealed RCH-induced changes in the
levels of carbohydrates, polyols and amino acids
(Michaud and Denlinger, 2007).
Numerous changes in gene expression and metabolic shifts are thus elicited
during RCH, and we are not yet able to link p38 MAPK to one specific
pathway.
There are two seemingly contrasting opinions concerning the role of the
brain in regulating the RCH reaction. Yi and Lee reported that isolated cells
and tissue can undergo RCH (Yi and Lee,
2004), while Yoder et al. reported that the presence of the brain
enhances the accumulation of glycerol during RCH
(Yoder et al., 2006). Both are
likely to be correct. While the tissues can display an RCH response
independent of the brain (Yi and Lee,
2004), the response is more robust when the brain is present
(Yoder et al., 2006). In the
present study, we show that p38 MAPK is activated by 0°C in a limited
number of tissues, most notably the fat body and midgut
(Fig. 6A), and it can be
activated in an isolated abdomen that lacks a brain
(Fig. 6B). These results
suggest that p38 MAPK is activated autonomously in specific tissues rather
than regulated remotely by nervous or endocrine systems.
We thus conclude that the phosphorylation of p38 MAPK has all of the
attributes of a switch that could initiate the RCH response. This hypothesis
is further supported by the widespread use of MAPKs as environmental signaling
molecules in other eukaryotes (Kyriakis
and Avruch, 1996; Cowan and
Storey, 2003), including temperature responses in other insects
(Stronach and Perrimon, 1999;
Iwata et al., 2005;
Fujiwara et al., 2006a;
Fujiwara and Shiomi, 2006;
Kidokoro et al., 2006a;
Kidokoro et al., 2006b).
|
Acknowledgments |
|---|
|
References |
|---|
|
TOPSummaryIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Adedokun, T. A. and Denlinger, D. L. (1984). Cold-hardiness: a component of the diapause syndrome in pupae of the flesh flies, Sarcophaga crassipalpis and S. bullata. Physiol. Entomol. 9,361 -364.
Chen, C.-P. and Denlinger, D. L. (1990). Activation of phosphorylase in response to cold and heat stress in the flesh fly, Sarcophaga crassipalpis. J. Insect Physiol. 36,549 -553.[CrossRef]
Chen, C.-P., Denlinger, D. and Lee, R. E. (1987). Cold-shock injury and rapid cold hardening in the flesh fly Sarcophaga crassipalpis. Physiol. Entomol. 60,297 -304.
Chen, C.-P., Lee, R. E. and Denlinger, D. L. (1991). Cold shock and heat shock: a comparison of the protection generated by brief pretreatment at less severe temperatures. Physiol. Entomol. 16,19 -26.
Cowan, K. J. and Storey, K. B. (2003).
Mitogen-activated protein kinases: new signaling pathways functioning in
cellular responses to environmental stress. J. Exp.
Biol. 206,1107
-1115.
Denlinger, D. L. (1972). Induction and
termination of pupal diapause in Sarcophaga (Diptera: Sarcopagidae).
Biol. Bull. 142,11
-24.
Denlinger, D. L. and Lee, R. E. (1998). Physiology of cold sensitivity. In Temperature Sensitivity in Insects and Application in Integrated Pest Management (ed. G. J. Hallman and D. L. Denlinger), pp. 55-95. Boulder, CO: Westview Press.
Denlinger, D. L., Campbell, J. J. and Bradfield, J. Y. (1980). Stimulatory effect of organic solvents on initiating development in diapausing pupae of the flesh fly, Sarcophaga crassipalpis, and the tobacco hornworm, Manduca sexta.Physiol. Entomol. 5,7 -15.
Fujiwara, Y. and Shiomi, K. (2006). Distinct effects of different temperatures on diapause termination, yolk morphology and MAPK phosphorylation in the silkworm, Bombyx mori. J. Insect Physiol. 52,1194 -1201.[CrossRef][Medline]
Fujiwara, Y., Shindome, C., Takeda, M. and Shiomi, K. (2006a). The roles of ERK and P38 MAPK signaling cascades on embryonic diapause initiation and termination of the silkworm, Bombyx mori. Insect Biochem. Mol. Biol. 36, 47-53.[CrossRef][Medline]
Fujiwara, Y., Tanaka, Y., Iwata, K., Rubio, R. O., Yaginuma, T., Yamashita, O. and Shiomi, K. (2006b). ERK/MAPK regulates ecdysteroid and sorbitol metabolism for embryonic diapause termination in the silkworm, Bombyx mori. J. Insect Physiol. 52,569 -575.[CrossRef][Medline]
Ijiro, T., Urakawa, H., Yasukochi, Y., Takeda, M. and Fujiwara, Y. (2004). cDNA cloning, gene structure, and expression of Broad-Complex (BR-C) genes in the silkworm, Bombyx mori. Insect Biochem. Mol. Biol. 34,963 -969.[CrossRef][Medline]
Iwata, K., Shindome, C., Kobayashi, Y., Takeda, M., Yamashita, O., Shiomi, K. and Fujiwara, Y. (2005). Temperature-dependent activation of ERK/MAPK in yolk cells and its role in embryonic diapause termination in the silkworm Bombyx mori. J. Insect Physiol. 51,1306 -1312.[CrossRef][Medline]
Joplin, K. H., Yocum, G. D. and Denlinger, D. L. (1990). Cold shock elicits expression on heat shock proteins in the flesh fly, Sarcophaga crassipalpis. J. Insect Physiol. 36,825 -834.[CrossRef]
Kelty, J. D. and Lee, R. E., Jr (2001). Rapid cold-hardening of Drosophila melanogaster (Diptera: Drosophiladae) during ecologically based thermoperiodic cycles. J. Exp. Biol. 204,1659 -1666.[Abstract]
Kidokoro, K., Iwata, K., Fujiwara, Y. and Takeda, M. (2006a). Effects of juvenile hormone analogs and 20-hydroxyecdysone on diapause termination in eggs of Locusta migratoria and Oxya yezoensis. J. Insect Physiol. 52,473 -479.[CrossRef][Medline]
Kidokoro, K., Iwata, K., Takeda, M. and Fujiwara, Y. (2006b). Involvement of ERK/MAPK in regulation of diapause intensity in the false melon beetle, Atrachya menetriesi. J. Insect Physiol. 52,1189 -1193.[CrossRef][Medline]
Kyriakis, J. M. and Avruch, J. (1996). Sounding
the alarm: protein kinase cascades activated by stress and inflammation.
J. Biol. Chem. 271,24313
-24316.
Lee, R. E. and Denlinger, D. L. (1985). Cold tolerance in diapausing and non-diapausing stages of the flesh fly, Sarcophaga crassipalpis. Physiol. Entomol. 10,309 -315.
Lee, R. E., Chen, C.-P. and Denlinger, D.
(1987a). A rapid cold-hardening process in insects.
Science 238,1415
-1417.
Lee, R. E., Chen, C.-P., Meacham, M. H. and Denlinger, D. L. (1987b). Ontogenic patterns of cold-hardiness and glycerol production in Sarcophaga crassipalpis. J. Insect Physiol. 33,587 -592.[CrossRef]
Martin-Blanco, E. (2000). p38 MAPK signaling cascades: ancient roles and new functions. BioEssays 22,637 -645.[CrossRef][Medline]
Michaud, M. R. and Denlinger, D. L. (2006). Oleic acid is elevated in cell membranes during rapid cold-hardening and pupal diapause in the flesh fly, Sarcophaga crassipalpis. J. Insect Physiol. 52,1073 -1082.[CrossRef][Medline]
Michaud, M. R. and Denlinger, D. L. (2007). Shifts in the carbohydrate, polyol, and amino acid pools during rapid cold-hardening and diapause-associated cold hardening in flesh flies (Sarcophaga crassipalpis): a metabolic comparison. J. Comp. Physiol. B In press.
Ono, K. and Han, J. (2000). The p38 signal transduction pathway: activation and function. Cell. Signal. 12,1 -13.[CrossRef][Medline]
Overgaard, J., Sorensen, J. G., Petersen, S. O., Loeschcke, V. and Holmstrup, M. (2005). Changes in membrane lipid composition following rapid cold hardening in Drosophila melanogaster.J. Insect Physiol. 51,1173 -1182.[CrossRef][Medline]
Qin, W., Neal, S. J., Robertson, R. M., Westwood, J. T. and Walker, V. K. (2005). Cold hardening and transcriptional change in Drosophila melanogaster. Insect Mol. Biol. 14,607 -613.[CrossRef][Medline]
Rinehart, J. P. and Denlinger, D. L. (2000). Heat-shock protein 90 is down-regulated during pupal diapause in the flesh fly, Sarcophaga crassipalpis, but remains responsive to thermal stress. Insect Mol. Biol. 9, 641-645.[CrossRef][Medline]
Rinehart, J. P., Yocum, G. D. and Denlinger, D. L. (2000). Developmental upregulation of inducible hsp70 transcripts, but not the cognate form, during pupal diapause in the flesh fly, Sarcophaga crassipalpis. Insect Biochem. Mol. Biol. 30,515 -521.[CrossRef][Medline]
Stronach, B. E. and Perrimon, N. (1999). Stress signaling in Drosophila. Oncogene 18,6172 -6182.[CrossRef][Medline]
Yi, S. X. and Lee, R. E., Jr (2004). In vivo and in vitro rapid cold-hardening protects cells from cold-shock injury in the flesh fly. J. Comp. Physiol. B 174,611 -615.[CrossRef][Medline]
Yocum, G. D., Joplin, K. H. and Denlinger, D. L. (1998). Upregulation of a 23 kDa small heat shock protein transcript during pupal diapause in the flesh fly, Sarcophaga, crassipalpis. Insect Biochem. Mol. Biol. 28,677 -682.[CrossRef][Medline]
Yoder, J. A., Benoit, J. B., Denlinger, D. L. and Rivers, D. B. (2006). Stress-induced accumulation of glycerol in the flesh fly, Sarcophaga bullata: evidence indicating anti-desiccant and cryoprotectant functions of this polyol and a role for the brain in coordinating the response. J. Insect Physiol. 52,202 -214.[CrossRef][Medline]
Ziegler, R. and Wyatt, G. R. (1975). Phosphorylase and glycerol production activated by cold in diapausing silkmoth pupae. Nature 254,622 -623.[CrossRef][Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  N. M. Teets, M. A. Elnitsky, J. B. Benoit, G. Lopez-Martinez, D. L. Denlinger, and R. E. Lee Jr. Rapid cold-hardening in larvae of the Antarctic midge Belgica antarctica: cellular cold-sensing and a role for calcium Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2008; 294(6): R1938 - R1946. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
