|
| ![]() |
|
||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online June 29, 2007
Journal of Experimental Biology 210, 2419-2429 (2007)
Published by The Company of Biologists 2007
doi: 10.1242/jeb.002568
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Rhesus glycoprotein gene expression in the mangrove killifish Kryptolebias marmoratus exposed to elevated environmental ammonia levels and air
1 Department of Integrative Biology, University of Guelph, Guelph, Ontario,
N1G 2W1, Canada
2 Department of Biology, McMaster University, 1280 Main Street West,
Hamilton, Ontario, L8S 4K1, Canada
3 Ecofisiologia CIMAR Rua dos Bragas 289, 4050-123, Porto,
Portugal
* Author for correspondence (e-mail: patwrigh{at}uoguelph.ca)
Accepted 25 April 2007
| Summary |
|---|
|
|
|---|
Key words: Kryptolebias marmoratus, ammonia excretion, gills, skin, ammonia transporter
| Introduction |
|---|
|
|
|---|
Fish survive in environments of elevated ammonia by one or more of the
following strategies: reducing endogenous ammonia production, converting
ammonia to less toxic molecules (e.g. urea, glutamine), or continuing to
excrete ammonia against the gradient (for a review, see
Chew et al., 2006
). Very little
is known about the latter possibility because it is very difficult to define
the true blood-to-water PNH3 and electrochemical gradients
(ENH4+)
(Wilson et al., 1994
). African
sharptooth catfish Clarias gariepinus is a species that appears to
excrete ammonia actively against high external ammonia, but the exact
mechanism of the excretion is currently unknown
(Ip et al., 2004
). Indeed,
only the mudskipper Periophthalmodon schlosseri has been reported to
actively excrete ammonia against an indisputable gradient (8 and 30 mmol
l1 NH4Cl in the water). The mechanism likely
involves basolateral Na+-K+(NH
+4)-ATPase coupled to an apical
Na+/H+ (NH +4) exchanger
(Randall et al., 1999
).
Another possible mechanism of NH3/NH +4
transport is via the Rhesus glycoproteins. The Rhesus glycoproteins
(Rh genes) represent members from the Amt/MEP/Rh superfamily found in
all three domains of living organisms: Bacteria, Archaea and Eukarya. Amt and
Rh proteins are distantly linked (Huang
and Liu, 2001
). The first ammonia transporter genes were
identified from yeast Saccharomyces cerevisiae (ScMep1) and
plant Arabidopsis thaliana (AtAmt1)
(Marini et al., 1994
;
Ninnemann et al., 1994
). In
mammals, three Rh genes are identified so far: RhAG, RhBG and
RhCG. RhAG expression is restricted to the erythrocyte membrane,
whereas RhBG and RhCG are expressed in various tissues in
the mammalian systems, including liver, kidney and gastrointestinal tract
(Handlogten et al., 2005
;
Liu et al., 2000
;
Liu et al., 2001
;
Weiner et al., 2003
;
Weiner and Verlander, 2003
).
Studies in mammalian and plant systems reveal that at least some of those
Rh genes encode proteins that mediate NH3/NH
+4 movement (Khademi
et al., 2004
; Zheng et al.,
2004
; Mayer et al.,
2006
), but the form of ammonia (NH3 gas or NH
+4 ion) being transported, and whether the transport is
active or passive, are still under much debate
(Bakouh et al., 2004
;
Khademi et al., 2004
;
Nakhoul et al., 2005
). A
full-length cDNA of Rh-like protein (Rh-CM) has been
identified recently from the gills of the aquatic crab Carcinus
maenas, which has a similar predicted transmembrane structure as the
mammalian Rh proteins (Weihrauch et al.,
2004
). However, the precise role of Rh-CM in crab ammonia
excretion awaits elucidation.
To date, there have been only two reports of Rh sequences in fish
(Huang and Peng, 2005
;
Nakada et al., 2007
).
RhAG, RhBG, RhCG1 and RhCG2 sequences have recently been
identified in the pufferfish Takifugu rubripes, with unique spatial
distribution within the fish gill, and these Rh genes mediate
movement of the ammonia analogue methylammonia when expressed in
Xenopus oocytes (Nakada et al.,
2007
). However, no physiological studies of Rh genes have
been conducted. This family of Rh transporters may be an important missing
link in our understanding of branchial ammonia excretion. The mangrove
killifish Kryptolebias marmoratus is very tolerant of elevated
external ammonia, surviving 48 h of 10 mmol l1
NH4Cl at pH 8.0 (Frick and
Wright, 2002a
). Remarkably, there was very little change in tissue
ammonia levels in K. marmoratus exposed to external ammonia, nor were
tissue urea or glutamine concentrations altered
(Frick and Wright, 2002a
).
During prolonged air exposure (11 days), K. marmoratus volatilize
NH3 (Frick and Wright,
2002b
) by elevating both NH +4 concentration
and pH on the cutaneous surface (Litwiller
et al., 2006
). Ammonia excretion during both elevated
environmental ammonia and air exposure may require specialized transport
mechanisms to move ammonia across cell membranes possibly against the
gradient, similar to the mudskipper P. schlosseri
(Randall et al., 1999
).
The first objective of this study was to isolate Rh genes from K. marmoratus and determine their tissue distribution, with a particular focus on the gill and skin. The second objective was to quantify changes in Rh mRNA expression in K. marmoratus in response to elevated external ammonia concentrations and aerial exposure. We have cloned three Rh genes from K. marmoratus and investigated the tissue expression pattern of each Rh gene, in control and ammonia-exposed fish. Using quantitative real time-PCR, we have also measured the relative mRNA expression of all three Rh genes in response to (i) high external ammonia in the gills and skin and (ii) aerial exposure in the skin. In addition, relative RhBG expression levels in brain, liver and muscle of control and ammonia-exposed K. marmoratus were also quantified.
| Materials and methods |
|---|
|
|
|---|
artificial seawater (made with distilled water and
Crystal Sea® Marinemix; Marine Enterprises International, Inc., Baltimore,
MA, USA), 25°C, pH 8.1. Water changes were performed every 2 weeks and
fish were fed Artemia five times per week. The experiments in this
study were approved by the University of Guelph Animal Care Committee.
Full-length cDNA cloning of the RhBG, RhCG1 and RhCG2 from killifish K. marmoratus
Two fish were used for Rh gene cloning. Fish were decapitated, the
gills removed and immediately frozen in liquid nitrogen. Total RNA was
extracted from killifish gill using Trizol (Invitrogen Canada Inc.,
Burlington, ON, Canada). First-strand cDNA was synthesized using Superscript
reverse transcriptase II (Invitrogen) with an adaptor oligodT primer (T17AP2:
GACTCGAGTCGACATCGAT17). A partial sequence (585 bp) was obtained
using F primer (GCACACTGTTCCTGTGGATG) and R primer (CAGCAGGATCTCCCCAGA), with
the thermal cycle (PTC-200, Peltier Thermal Cycler, MJ Research, Mississauga,
ON, Canada): 94°C, 2 min, 45 cycles of 94°C, 30 s; 51°C, 30 s;
68°C, 1 min and a final extension at 68°C, 5 min (Invitrogen Platinum
Taq). Sequence of this PCR product was confirmed to be a Rh
homologue. Thereafter, 3' RACE was conducted using the F primer and AP2
primer (GACTCGAGTCGACATCGA) with thermal cycles: 95°C, 5 min, 45 cycles of
94°C, 15 s; 56°C, 1 min; 68°C, 5 min and a final extension at
72°C, 10 min (QIAgen High Fidelity HotStar, Qiagen, Mississauga, ON,
Canada). Three PCR products (1.3 kb, 1.6 kb and 1.8 kb) were obtained,
gel-purified (QIAquick extraction kit), cloned into pGEM-T easy vectors
(Promega, Madison, WI, USA) and transformed into E. coli XL-Blue
strain. Plasmids from positive clones were extracted (QIAgen miniprep),
sequenced (Mobix sequencing facility, McMaster University) and confirmed to be
3' end sequences of RhBG, RhCG1 and RhCG2. 5'
RACE was then carried out with cloning primers
(Table 1) (Marathon cDNA
Amplification Kit, Clontech, Moutainview, CA, USA).
|
Full-length sequences submitted to GenBank have the following accession number: DQ995211 (RhBG), DQ995210 (RhCG1) and DQ423779 (RhCG2).
Ammonia exposure
Fish were fasted for 48 h prior to the onset of experiments to eliminate
the influence of diet on nitrogen metabolism and excretion. Three groups of
animals were studied. Control fish were exposed to 15
seawater (pH
8.1) containing no added NH4HCO3. Experimental fish were
exposed to either 1 or 2 mmol l1
NH4HCO3 (15
, pH 8.1). At the end of 5 days, fish
were decapitated. Fish dissections were conducted under a dissecting
microscope. Individual tissues (brain, eye, gill, gonad, gut, kidney, liver,
skeletal muscle and skin) were excised and immediately frozen in liquid
nitrogen and kept at 80°C for later RNA isolation within 2 weeks.
Identical groups of fish were treated in the same way, except at the end of
exposure, fish were decapitated and whole fish were frozen in liquid nitrogen,
and stored at 80°C for whole-body ammonia analysis within 1
week.
We attempted to measure ammonia excretion to the water in fish exposed to 1 and 2 mmol l1 NH4HCO3, however, due to the small size of the fish and the high background ammonia, this proved to be difficult. In preliminary experiments we extended the flux period from 4 to 24 h to increase the signal:noise ratio, but this introduced the confounding problem of significant microbial metabolism, which removed ammonia from solution. Hence ammonia excretion data were unreliable and are not presented.
Aerial exposure
Fish exposed to terrestrial conditions were placed in individual plastic
containers containing a moist paper of 15
seawater at 25°C, as
described previously (Ong et al.,
2007
). After 24 h, fish were decapitated and skins were dissected,
frozen immediately in liquid nitrogen and kept at 80°C until
analysis within 1 week.
Whole-body ammonia analysis
The frozen fish samples (including heads) were used for whole-body ammonia
content measurement. Each sample was powdered using a mortar and pestle under
liquid nitrogen, weighed and deproteinized in 10 vols of 10% trichloroacetic
acid (TCA) (Fisher Scientific). The homogenate was centrifuged (Sorvall Legend
RT, Mandel, ON, Canada) at 12 000 g at 4°C for 15 min. The
deproteinized samples were neutralized to pH 6.57.0 with 2 mol
l1 KHCO3 (Sigma-Aldrich). Ammonia content was
determined by the method of Kun and Kearney
(Kun and Kearney, 1974
). The
change in absorbance at 340 nm (25°C) was monitored using a Spectra Max 90
spectrophotometer (Molecular Devices, Woodbridge, ON, Canada). Freshly
prepared ammonium chloride (Sigma-Aldrich) was used as a standard.
Tissue expression
Reverse-transcription PCR (RT-PCR) was used to determine the mRNA
expression pattern of RhBG, RhCG1 and RhCG2 in control and
ammonia-exposed tissues. Total RNA extraction and cDNA synthesis were done as
described above. A DNase I (Invitrogen) digestion step was used (1 U per 1
µg RNA, 15 min at room temperature) to ensure there was no genomic DNA
contamination prior to cDNA synthesis. Three sets of gene-specific primers
(Table 2) were used to examine
the tissue-specific expression of RhBG, RhCG1 and RhCG2; and
elongation factor 1alpha (EF1a) was used as the control gene
to ensure that cDNA of individual samples were successfully synthesized.
|
|
|
Quantitative PCR analysis
Potential ammonia excretory organs, gill and skin, were used to test for
all three Rh gene expressions in control and experimental fish by
quantitative PCR (Q-PCR). Other internal organs, brain, liver and skeletal
muscle, were selected to analyze for the expression of RhBG. In this study,
two control genes, EF1a and 18S ribosomal RNA
(rRNA), were used as normalization factors; and the choice of which
normalization factor to use was dependent on which gene exhibited the most
consistent expression in control and ammonia-exposed or air-exposed tissues.
For each Q-PCR reaction, 5 µl of 5x diluted cDNA sample was used.
Q-PCR primers used are listed in Table
3.
|
Quantification of gene expression was done using Platinum SYBR green qPCR Super-mix-UDG (Invitrogen) with PCR thermal cycle (Mx3000P QPCR System, Stratagene, Cedar Creek, Texas, USA): 50°C for 2 min, 95°C for 2 min, followed by 40 cycles of 95°C for 15 s and 60°C for 15 s. Gel electrophoresis was performed to ensure that only a single PCR product of the desired size was obtained for each reaction. The Q-PCR product was purified (QIAquick PCR purification kit) and sequenced to confirm its identity.
Sequence analysis
Mammalian Rh homologues are predicted to be membrane proteins with
12 membrane spanning domains and cytoplasmic N- and C-terminals
(Huang and Liu, 2001
), but
nothing is known about fish Rh homologues. To predict the potential
localization of killifish Rh proteins, we characterized the primary and
secondary structure of the killifish Rh sequences by analyzing their
hydropathy profiles (Kyte-Doolittle scale) via webserver SDSC Biology
WorkBench 3.2 at
http://seqtool.sdsc.edu/CGI/BW.cgi.
To further confirm that these three Rh sequences encode for membrane
proteins, which consist of transmembrane (TM), intra- and extracellular
motifs, transmembrane domain organizations were predicted at TMHMM server,
version 2.0
(http://www.cbs.dtu.dk/services/TMHMM).
Furthermore, mammalian Rh homologues have been shown to be glycoproteins
(Quentin et al., 2003
) and
therefore, potential N-glycosylation sites on killifish Rh protein sequences
were predicted via NetNGlyc 1.0 Server at
http://www.cbs.dtu.dk/services/NetNGlyc.
|
Phylogenetic analysis
Phylogenetic and molecular evolutionary analyses were conducted using MEGA
version 3.1 downloaded at
http://www.megasoftware.net
(Kumar et al., 2004
).
Sequences were first aligned by ClustalW and subjected to a Neighbour-joining
(NJ) matrix for tree reconstruction and evaluated by means of a Bootstrap of
1000 replicates.
Statistical analysis
All data are expressed as mean ± the standard error of the mean
(s.e.m.) (N=68). Analysis of variance (ANOVA) was used to
compare means of relative Rh mRNA expression in the gill with
Statistix software (Analytical Software, Tallahassee, FL, USA), followed by
the Least Significant Difference (LSD) test to determine where significant
differences were present (P<0.05). For Rh mRNA expression
level between control (immersion) and air-exposed (emersed) fish, an unpaired
t-test was conducted to determine if expression was significantly
different (P<0.05; control: N=6; air-exposed:
N=4).
|
| Results |
|---|
|
|
|---|
RhBG
K. marmoratus RhBG is 76.284.8% identical to other known
fish RhBGs and 52.261.5% identical to known mammalian RhBGs. Sequence
alignment revealed that K. marmoratus RhBG is highly homologous to
other fish RhBGs, with no gap found between 55H and 388E
(TM2 to TM9 of K. marmoratus RhBG)
(Fig. 1A). The open reading
frame (ORF) of RhBG encodes a 462-amino acid polypeptide (50.5 kDa), with two
potential N-glycosylation sites (47NDSH50,
217NCSV220) (Fig.
1A). When K. marmoratus RhBG was aligned with all known
RhBG sequences from fish and mammals, it was found that variable regions of
fish RhBG sequences are located between amino acids 250300 and the
C-terminal sequences. However, these regions are rather conserved among the
mammalian RhBG sequences (data not shown).
Many fragments of the RhBG sequences appear to be class-specific. For example, RhBG amino acid regions 200MVTRIL(Y/H)RPNLD211 and 312SMIVGF(L/M)AG(I/T)ISV324 are highly conserved among fish sequences. However, the mammalian RhBG sequences of the same regions are highly conserved among themselves and are encoded as 200(V/F)LS(R/W)VLYR(P/S)QLE211 and 312ALAAGFLAGTVST324, respectively. Such class-specific regions are also located at the N- and C-terminal sequences (data not shown).
RhCG
RhCG1 and RhCG2 ORFs, encode for polypeptides 490 (54.2
kDa) and 483 (53.3 kDa) amino acids in length, respectively. RhCG1 show
7284.6% and 53.964.6% identity to known fish and mammalian RhCG
sequences, respectively. Similarly, the identity between RhCG2 and other fish
sequences is 71.281.0% and 5161% with mammalian RhCGs (data not
shown). RhCG1 has three potential N-glycosylation sites
(60NISS63, 299NSTL302,
479NFTV482), whereas RhCG2 contains two such sites
(57NLTD60, 295NATL298)
(Fig. 1B). The C-terminal
sequences appear to be the least conserved among species and a class-specific
conserved region is also found at the C-terminal of RhCG sequences (data not
shown).
|
Phylogenetic relationships between RhBG and RhCG proteins
The phylogenetic tree reconstruction shows that the Rh proteins form two
main clusters: Cluster I (RhCG) and II (RhBG), which are subdivided into
smaller clusters (Fig. 3). The
invertebrate Rh-like proteins (Ib) are divergent from the RhCG family (Ia).
The vertebrate RhCG, on the other hand, diverge into a mammalian RhCG cluster
and a cluster including other vertebrate RhCGs, which are then divided later
into fish, amphibian and avian RhCG clusters. On the other hand, the RhBG
cluster (cluster II), is also subdivided into two groups IIa and IIb. However,
it is interesting to note that the fish RhBG (IIa) proteins apparently
diverged earlier, forming one distinct cluster, whereas mammalian RhBGs, in
this case, have closer relationships with the amphibian and avian homologues
and diverged later than the fish RhBGs.
Whole-body ammonia content
The whole-body ammonia level was not altered after 5 days of exposure to 1
mmol l1 NH4HCO3. However, after 5 days
of 2 mmol l1 NH4HCO3 exposure,
whole-body ammonia content increased significantly by 37%
(Fig. 4).
Tissue expression of Rh genes
Reverse-transcription PCR results show that RhBG expression in
control K. marmoratus is consistently found in gill and skin, whereas
RhCG1 and RhCG2 are predominantly expressed in gill. After 5
days of exposure to high external ammonia levels (2 mmol l1
NH4HCO3), RhBG expression is induced in brain,
eye, gonad, gut, kidney, liver and skeletal muscle and continues in gill and
skin. RhCG1 expression is also induced in skin of ammonia-exposed
fish, but RhCG2 expression remains restricted to the gill
(Fig. 5).
|
Quantitative PCR
Response to high external ammonia
Gill RhCG2 mRNA levels were not altered after 5 days of exposure
to 1 mmol l1 NH4HCO3, but 2 mmol
l1 NH4HCO3 exposure resulted in a
5.8-fold increase, relative to the control level. Gill RhBG and
RhCG1 mRNA levels did not change in response to either ammonia level
(Fig. 6A). In skin,
RhCG1 mRNA levels increased significantly by 2.4-fold and 7.7-fold
after 5 days of 1 and 2 mmol l1 of
NH4HCO3 exposure, respectively, relative to control
fish. As well, skin RhCG2 mRNA levels increased by 3.8-fold after
exposure to 1 mmol l1 NH4HCO3, but
there were no changes when fish were exposed to 2 mmol l1
NH4HCO3 relative to control fish
(Fig. 6B).
|
|
|
| Discussion |
|---|
|
|
|---|
Our study represents the first report of the possible involvement of
Rh gene/proteins in ammonia excretion in fish during adverse
conditions such as high external ammonia and aerial exposure. All three
Rh mRNAs (RhBG, RhCG1 and RhCG2) were expressed
under control conditions in the gill, similar to the observation in pufferfish
gills (Nakada et al., 2007
),
and RhBG is also expressed in the skin. After exposure to high
environmental ammonia (2 mmol l1
NH4HCO3, pH 8.1), RhBG was widely expressed in
many tissues, and RhCG1 expression extended to the skin.
Interestingly, RhBG induction is observed in almost all tissues
screened (Figs 5 and
7) except gill and skin
(Fig. 6). RhCG1 and
RhCG2 appear to demonstrate tissue specificity during high ammonia
exposure (Fig. 6), with
RhCG1 mRNA levels dominating skin Rh expression and
RhCG2 dominating gill Rh expression.
An earlier study (Frick and Wright,
2002a
) indicated that ammonia might be excreted against the
gradients when K. marmoratus were exposed to high environmental
ammonia (see Introduction). Indeed, in the present study, there was no
elevation of body tissue ammonia levels after 5 days in 1 mmol
l1 NH4HCO3 and only a small increase
(37%) after the same period of time in 2 mmol l1
NH4HCO3 (pH=8.1, NH3
100 µmol
l1). This is surprising because in other fish, internal
ammonia levels typically increase several-fold in response to external ammonia
levels (Wilson and Taylor,
1992
; Wilson et al.,
1994
; Knoph and Thorud,
1996
; Kong et al.,
1998
; Steele et al.,
2001
; Anderson et al.,
2002
). For example, in the ammonia-tolerant marine toadfish
Opsanus beta, muscle tissue ammonia concentrations were elevated by
threefold after 4 days in water containing 3.5 mmol l1
NH4Cl (at pH 7.8, NH3
70 µmol
l1) (Wang and Walsh,
2000
), a lower NH3 level than in this study. In
contrast, K. marmoratus is capable of preventing excessive
accumulation of ammonia at high external ammonia and this appears to be
similar to the mudskipper P. schlosseri
(Randall et al., 1999
), a
species that is known to excrete ammonia actively during high environmental
ammonia exposure.
Although the mode of ammonia excretion against high external ammonia in
killifish has not been delineated, we hypothesize that Rh genes may
be involved. All three Rh proteins are expressed in control pufferfish gills
(Nakada et al., 2007
).
Constitutive expression of Rh proteins is probably required for routine
removal of endogenous ammonia from nitrogen metabolism. There was no increase
in any of the Rh mRNAs in the gills of K. marmoratus during
1 mmol l1 exposure, but the upregulation of RhCG1
and RhCG2 in the skin (Fig.
6B) and constitutive expression of Rh proteins in the gill, may
have been involved in facilitating ammonia excretion and thereby preventing an
elevation of whole-body ammonia content
(Fig. 4). Likewise, when
external ammonia levels were increased to 2 mmol l1, the
upregulation of RhCG2 mRNA levels in the gill and RhCG1 mRNA
levels in the skin (Fig. 6B) is
suggestive of a functional role of Rh genes in ammonia transport. It
should be noted that transcriptional changes do not necessarily imply a
corresponding upregulation of protein content, and verification of these ideas
is necessary. Initial experiments using antibodies obtained from mammalian Rh
proteins were unsuccessful and future work will require fish-specific
antibodies.
In the mammalian kidney, polarized localization of the Rh proteins is
observed in epithelial cells of specific regions, including the renal
collecting segment and the collecting duct, with RhBG expression in the
basolateral membrane and RhCG in the apical membrane
(Quentin et al., 2003
;
Verlander et al., 2003
). Such
polarized localization is also present in the pufferfish. RhBG is localized
basolaterally and RhCG2 proteins apically in the pavement cells of the gills,
whereas RhCG1 proteins are found in the apical membrane of the
mitochondrial-rich (MR) cells (Nakada et
al., 2007
). We predict a similar localization of the different Rh
proteins in the killifish.
It has been suggested (Weiner,
2006
) that RhBG may be playing a role in ammonia-sensing or having
roles other than ammonia-transport. This suggestion was based on the
basolateral location of RhBG glycoproteins, together with the observation that
expressions of RhBG mRNA and protein were not increased metabolic
acidosis (which results in net excretion of acid and ammonia by the mammalian
renal system) (Seshadri et al.,
2006
). Others have reported that genetic ablation of RhBG
in the knockout mice did not affect ammonia transport in the kidney and
tolerance to chronic acid-loading (Chambrey
et al., 2005
; Chambrey et al.,
2006
), although other genes may have been upregulated to
compensate for the Rh knockdown. RhBG expressions are
restricted to kidney, liver and gastrointestinal tract in the mammals (human
and mouse) (Liu et al., 2001
;
Handlogten et al., 2005
). In
contrast, RhBG in K. marmoratus has a very broad tissue
expression (Fig. 5). From the
phylogenetic tree (Fig. 3), it
is noted that RhBG is relatively more primitive and emerged earlier compared
to RhCGs. Induction of RhBG was observed in a variety of tissues,
whereas the expression of RhCGs was restricted to gill and skin
during high ammonia exposure (Fig.
4). Fish normally experience much higher extracellular ammonia
concentrations [0.11.3 mmol l1
(Wood, 1993
)] than mammals
[0.030.1 mmol l1
(Felipo and Butterworth,
2002
)]. Taken together, the data suggests that RhBG may
have important functions in fish to facilitate ammonia transport in various
internal organs.
The skin of K. marmarotus is an important site for NH3
volatilization during air exposure (Frick
and Wright, 2002b
; Litwiller
et al., 2006
). Following emersion, there was an 18-fold increase
in the NH +4 concentration on the cutaneous surface,
leading to a substantial elevation in the partial pressure of NH3
(Litwiller et al., 2006
). The
authors proposed that an active mechanism may be involved in moving ammonia
across the skin surface when fish were emersed. Induction of ammonia/ammonium
transporter genes (RhCG1 and RhCG2) in the skin during
aerial exposure (Fig. 8),
therefore, may be involved in the transport of ammonia across the epidermis
for subsequent NH3 volatilization, as well as in aquatic ammonia
excretion. According to the model proposed by Khademi and co-workers
(Khademi et al., 2004
),
ammonia approaches the Amt B channel as NH +4, then the
proton is stripped away and ammonia is transported across the channel as
NH3 gas; it exits the channel as NH3, then picks up a
proton and forms NH +4. We propose that fish Rh proteins
also conduct ammonia in the gaseous form. During air exposure, ammonia would
leave the cutaneous surface of K. marmoratus in the form of
NH3, without being protonated and hence volatilized. While in
water, RhBG and/or RhCG would facilitate NH3 excretion across the
gill and skin, which would be subsequently trapped by H+ to form NH
+4. Acidification of the boundary water layer
(Wright et al., 1989
) in the
cutaneous or gill surface of immersed K. marmoratus might be a
possible mechanism to accelerate ammonia removal in fish, particularly in the
presence of high external ammonia concentration.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Anderson, P. M., Broderius, M. A., Fong, K. C., Tsui, K. N. T.,
Chew, S. F. and Ip, Y. K. (2002). Glutamine synthetase
expression in liver, muscle, stomach and intestine of Bostrichthys
sinensis in response to exposure to a high exogenous ammonia
concentration. J. Exp. Biol.
205,2053
-2065.
Bakouh, N., Benjelloun, F., Hulin, P., Brouillard, F., Edelman,
A., Chérif-Zahar, B. and Planelles, G. (2004). NH is
involved in the NH + 3 4 transport induced by the functional
expression of the human Rh C glycoprotein. J. Biol.
Chem. 279,15975
-15983.
Blakey, D., Leech, A., Thomas, G. H., Coutts, G., Findlay, K. and Merrick, M. (2002). Purification of the Escherichia coli ammonium transporter AmtB reveals a trimeric stoichiometry. Biochem. J. 364,527 -535.[CrossRef][Medline]
Chambrey, R., Goossens, D., Bourgeois, S., Picard, N., Boch-Faure, M., Leviel, F., Geoffroy, V., Cambillau, M., Colin, Y., Paillard, M. et al. (2005). Genetic ablation of Rhbg in the mouse does not impair renal ammonium excretion. Am. J. Physiol. 289,F1281 -F1290.
Chambrey, R., Goossens, D., Quentin, F. and Eladari, D. (2006). Rh glycoproteins in epithelial cells: lessons from rat and mice studies. Transfus. Clin. Biol. 13,154 -158.[CrossRef][Medline]
Chew, S. F., Wilson, J. M., Ip, Y. K. and Randall, D. J. (2006). Nitrogen excretion and defense against ammonia toxicity. In The Physiology of Tropical Fishes (ed. A. L. Val, V. M. F. Almeida-Val and D. J. Randall), pp. 307-395. New York: Academic Press.
Felipo, V. and Butterworth, R. F. (2002). Neurobiology of ammonia. Prog. Neurobiol. 67,259 -279.[CrossRef][Medline]
Frick, N. T. and Wright, P. A. (2002a).
Nitrogen metabolism and excretion in the mangrove killifish, Rivulus
marmoratus. I. The influence of environmental salinity and external
ammonia. J. Exp. Biol.
205, 79-89.
Frick, N. T. and Wright, P. A. (2002b).
Nitrogen metabolism and excretion in the mangrove killifish, Rivulus
marmoratus. II. Significant ammonia volatilization in a teleost during
air exposure. J. Exp. Biol.
205,91
-100.
Handlogten, M. E., Hong, S. P., Zhang, L., Vander, A. W., Steinbaum, M. L., Campbell-Thompson, M. and Weiner, I. D. (2005). Expression of the ammonia transporter proteins Rh B glycoprotein and Rh C glycoprotein in the intestinal tract. Am. J. Physiol. 288,G1036 -G1047.
Huang, C. H. and Liu, P. Z. (2001). New insights into the Rh superfamily of genes and proteins in erythroid cells and nonerythroid tissues. Blood Cells Mol. Dis. 27, 90-101.[CrossRef][Medline]
Huang, C. H. and Peng, J. (2005). Evolutionary
conservation and diversification of Rh family genes and proteins.
Proc. Natl. Acad. Sci. USA
102,15512
-15517.
Ip, I. K., Zubaidah, R. M., Liew, P. C., Loong, A. M., Hiong, K. C., Wong, W. P. and Chew, S. F. (2004). African sharptooth catfish Clarias gariepinus does not detoxify ammonia to urea or amino acids but actively excretes ammonia during exposure to environmental ammonia. Physiol. Biochem. Zool. 77,242 -254.[CrossRef][Medline]
Khademi, S., O'Connell, J., Remis, J., Robles-Colmenares, Y.,
Miercke, L. J. W. and Stroud, R. M. (2004). Mechanism of
ammonia transport by Amt/MEP/Rh: structure of AmtB at 1.35 Å.
Science 305,1587
-1594.
Knoph, M. B. and Thorud, K. (1996). Toxicity of ammonia to Atlantic salmon (Salmo salar L.) in seawater effects on plasma osmolality, ion, ammonia, urea and glucose levels and hematologic parameters. Comp. Biochem. Physiol. 113A,375 -381.[CrossRef][Medline]
Kong, H., Edberg, D. D., Korte, J. J., Salo, W. L., Wright, P. A. and Anderson, P. M. (1998). Nitrogen excretion and expression of carbamoyl-phosphate synthetase III activity and mRNA in extrahepatic tissues of largemouth bass (Micropterus salmoides). Arch. Biochem. Biophys. 350,157 -168.[CrossRef][Medline]
Kumar, S., Tamura, K. and Nei, M. (2004). MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinfomatics 5, 150-163.[CrossRef]
Kun, E. and Kearney, E. B. (1974). Ammonia. In Methods of Enzymatic Analysis. Vol.IV (ed. H. U. Bergmeyer and K. Gawehn), pp.1802 -1806. New York: Academic Press.
Litwiller, S. L., O'Donnell, M. J. and Wright, P. A.
(2006). Rapid increase in the partial pressure of NH3
on the cutaneous surface of air-exposed mangrove killifish, Rivulus
marmoratus. J. Exp. Biol.
209,1737
-1745.
Liu, Z., Chen, Y., Mo, R., Hui, C., Cheng, J. F., Mohandas, N.
and Huang, C. H. (2000). Characterization of human RhCG and
mouse Rhcg as novel nonerythroid Rh glycoprotein homologues predominantly
expressed in kidney and testis. J. Biol. Chem.
275,25641
-25651.
Liu, Z., Peng, J., Mo, R., Hui, C. and Huang, C. H.
(2001). Rh type B glycoprotein is a new member of the Rh
superfamily and a putative ammonia transporter in mammals. J. Biol.
Chem. 276,1424
-1433.
Marini, A. M., Vissers, S., Urrestarazu, A. and André, B. (1994). Cloning and expression of the MEP1 gene encoding an ammonium transporter in Saccharomyces cerevisiae. EMBO J. 13,3456 -3463.[Medline]
Mayer, M., Schaaf, G., Mouro, I., Lopez, C., Colin, Y., Neumann,
P., Cartron, J.-P. and Ludewig, U. (2006). Different
transport mechanisms in plant and human AMT/Rh-type ammonium transporters.
J. Gen. Physiol. 127,133
-144.
Nakada, T., Westhoff, C. M., Kato, A. and Hirose, S.
(2007). Ammonia secretion from fish gill depends on a set of Rh
glycoproteins. FASEB J.
21,1067
-1074.
Nakhoul, N. L., DeJong, H., Abdulnour-Nakhoul, S. M., Boulpaep, E. L., Hering-Smith, K. and Hamm, L. L. (2005). Characteristics of renal Rhbg as an NH +4 transporter. Am. J. Physiol. 288,F170 -F181.
Ninnemann, O., Jauniaux, J. C. and Frommer, W. B. (1994). Identification of a high affinity NH +4 transporter from plants. EMBO J. 13,3464 -3471.[Medline]
Ong, K. J., Stevens, E. D. and Wright, P. A.
(2007). Gill morphology of the mangrove killifish
(Kryptolebias marmoratus) is plastic and changes in response to
terrestrial air exposure. J. Exp. Biol.
210,1109
-1115.
Quentin, F., Eladari, D., Cheval, L., Lopez, C., Goossens, D.,
Colin, Y., Cartron, J.-P., Paillard, M. and Chambrey, R.
(2003). RhBG and RhCG, the putative ammonia transporters, are
expressed in the same cells in the distal nephron. J. Am. Soc.
Nephrol. 14,545
-554.
Randall, D. J., Wilson, J. M., Peng, K. W., Kok, W. K., Kuah, S. S. L., Chew, S. F., Lam, T. J. and Ip, Y. K. (1999). The mudskipper, Periophthalmodon schlosseri, actively transports NH +4 against a concentration gradient. Am. J. Physiol. 277,R1562 -R1567.[Medline]
Rose, C. (2006). Effect of ammonia on astrocytic glutamate uptake/release mechanisms. J. Neurochem. 97 Suppl. 1,11 -15.[CrossRef][Medline]
Seshadri, R. M., Klein, J. D., Kozlowski, S., Sands, J. M., Kim, Y. H., Han, K. H., Handlogten, M. E., Verlander, J. W. and Weiner, I. D. (2006). Renal expression of the ammonia transporters, Rhbg and Rhcg, in response to chronic metabolic acidosis. Am. J. Physiol. 290,F397 -F408.
Steele, S. L., Chadwick, T. D. and Wright, P. A. (2001). Ammonia detoxification and localization of urea cycle enzyme activity in embryos of the rainbow trout (Oncorhynchus mykiss) in relation to early tolerance to high environmental ammonia levels. J. Exp. Biol. 204,2145 -2154.[Medline]
Verlander, J. W., Miller, R. T., Frank, A. E., Royaux, I. E., Kim, Y. H. and Weiner, I. D. (2003). Localization of the ammonium transporter proteins, Rh B Glycoprotein and Rh C Glycoprotein, in the mouse kidney. Am. J. Physiol. 284,F323 -F337.
Wang, Y. H. and Walsh, P. J. (2000). High ammonia tolerance in fishes of the family Batrachoididae (toadfish and midshipmen). Aquat. Toxicol. 50,205 -219.[CrossRef][Medline]
Weihrauch, D., Morris, S. and Towle, D. W.
(2004). Ammonia excretion in aquatic and terrestrial crabs.
J. Exp. Biol. 207,4491
-4504.
Weiner, I. D. (2006). Expression of the non-erythroid Rh glycoproteins in mammalian tissues. Transfus. Clin. Biol. 13,159 -163.[CrossRef][Medline]
Weiner, I. D. and Verlander, J. W. (2003). Renal and hepatic expression of the ammonium transporter proteins, Rh B Glycoprotein and Rh C Glycoprotein. Acta Physiol. Scand. 179,331 -338.[CrossRef][Medline]
Weiner, I. D., Miller, R. T. and Verlander, J. W. (2003). Localization of the ammonium transporters, Rh B glycoprotein and Rh C glycoprotein, in the mouse liver. Gastroenterology 124,1432 -1440.[CrossRef][Medline]
Wilkie, M. P. (2002). Ammonia excretion and urea handling by fish gills: present understanding and future research challenges. J. Exp. Zool. 293,284 -301.[CrossRef][Medline]
Wilson, R. W. and Taylor, E. W. (1992).
Transbranchial ammonia gradients and acidbase responses to high
external ammonia concentration in rainbow trout (Oncorhynchus mykiss)
acclimated to different salinities. J. Exp. Biol.
166,95
-112.
Wilson, R. W., Wright, P., Munger, S. and Wood, C. (1994). Ammonia excretion in freshwater rainbow trout (Oncorhynchus mykiss) and the importance of gill boundary layer acidification: lack of evidence for Na+/NH +4 exchange. J. Exp. Biol. 191, 37-58.[Abstract]
Wood, C. M. (1993). Ammonia and urea metabolism and excretion. In The Physiology of Fishes (ed. D. H. Evans), pp. 379-425. Boca Raton, FL: CRC Press.
Wright, P. A. and Wood, C. M. (1985). An
analysis of branchial ammonia excretion in the freshwater rainbow trout:
effects of environmental pH change and sodium uptake blockade. J.
Exp. Biol. 114,329
-353.
Wright, P. A., Randall, D. J. and Perry, S. F. (1989). Fish gill water boundary layer: a site of linkage between carbon dioxide and ammonia excretion. J. Comp. Physiol. 158B,627 -635.[CrossRef]
Zheng, L., Kosterwa, D., Berneche, S., Winkler, F. K. and Li, X.
D. (2004). The mechanism of ammonia transport based on the
crystal structure of AmtB of Escherichia coli. Proc. Natl. Acad.
Sci. USA 101,17090
-17095.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
P. A. Wright and C. M. Wood A new paradigm for ammonia excretion in aquatic animals: role of Rhesus (Rh) glycoproteins J. Exp. Biol., August 1, 2009; 212(15): 2303 - 2312. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Weihrauch, M. P. Wilkie, and P. J. Walsh Ammonia and urea transporters in gills of fish and aquatic crustaceans J. Exp. Biol., June 1, 2009; 212(11): 1716 - 1730. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Braun, S. L. Steele, M. Ekker, and S. F. Perry Nitrogen excretion in developing zebrafish (Danio rerio): a role for Rh proteins and urea transporters Am J Physiol Renal Physiol, May 1, 2009; 296(5): F994 - F1005. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. N. Tsui, C. Y. C. Hung, C. M. Nawata, J. M. Wilson, P. A. Wright, and C. M. Wood Ammonia transport in cultured gill epithelium of freshwater rainbow trout: the importance of Rhesus glycoproteins and the presence of an apical Na+/NH4+ exchange complex J. Exp. Biol., March 15, 2009; 212(6): 878 - 892. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-H. Shih, J.-L. Horng, P.-P. Hwang, and L.-Y. Lin Ammonia excretion by the skin of zebrafish (Danio rerio) larvae Am J Physiol Cell Physiol, December 1, 2008; 295(6): C1625 - C1632. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Nawata and C. M. Wood The effects of CO2 and external buffering on ammonia excretion and Rhesus glycoprotein mRNA expression in rainbow trout J. Exp. Biol., October 15, 2008; 211(20): 3226 - 3236. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Genz, J. R. Taylor, and M. Grosell Effects of salinity on intestinal bicarbonate secretion and compensatory regulation of acid-base balance in Opsanus beta J. Exp. Biol., July 15, 2008; 211(14): 2327 - 2335. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Nawata, C. C. Y. Hung, T. K. N. Tsui, J. M. Wilson, P. A. Wright, and C. M. Wood Ammonia excretion in rainbow trout (Oncorhynchus mykiss): evidence for Rh glycoprotein and H+-ATPase involvement Physiol Genomics, November 14, 2007; 31(3): 463 - 474. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||