spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online June 29, 2007
Journal of Experimental Biology 210, 2419-2429 (2007)
Published by The Company of Biologists 2007
doi: 10.1242/jeb.002568
This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hung, C. Y. C.
Right arrow Articles by Wright, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hung, C. Y. C.
Right arrow Articles by Wright, P. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Rhesus glycoprotein gene expression in the mangrove killifish Kryptolebias marmoratus exposed to elevated environmental ammonia levels and air

C. Y. C. Hung1,2, K. N. T. Tsui2, J. M. Wilson3, C. M. Nawata2, C. M. Wood2 and P. A. Wright1,*

1 Department of Integrative Biology, University of Guelph, Guelph, Ontario, N1G 2W1, Canada
2 Department of Biology, McMaster University, 1280 Main Street West, Hamilton, Ontario, L8S 4K1, Canada
3 Ecofisiologia CIMAR Rua dos Bragas 289, 4050-123, Porto, Portugal

* Author for correspondence (e-mail: patwrigh{at}uoguelph.ca)

Accepted 25 April 2007


    Summary
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The mechanism(s) of ammonia excretion in the presence of elevated external ammonia are not well understood in fish. Recent studies in other organisms have revealed a new class of ammonia transporters, Rhesus glycoprotein genes (Rh genes), which may also play a role in ammonia excretion in fish. The first objective of this study was to clone and characterize Rh genes in a fish species with a relatively high tolerance to environmental ammonia, the mangrove killifish Kryptolebias marmoratus (formerly Rivulus marmoratus). We obtained full-length cDNAs of three Rh genes in K. marmoratus: RhBG (1736 bp), RhCG1 (1920 bp) and RhCG2 (2021 bp), which are highly homologous with other known Rh gene sequences. Hydropathy analysis revealed that all three Rh genes encode membrane proteins with 10–12 predicted transmembrane domains. RhBG, RhCG1 and RhCG2 are highly expressed in gill tissue, with RhBG also present in skin of K. marmoratus. Exposure to elevated environmental ammonia (2 mmol l–1 NH4HCO3) for 5 days resulted in a modest (+37%) increase in whole-body ammonia levels, whereas gill RhCG2 and skin RhCG1 mRNA levels were upregulated by 5.8- and 7.7-fold, respectively. RhBG mRNA levels were also increased in various tissues, with 3- to 7-fold increases in the liver and skeletal muscle. In a separate group of killifish exposed to air for 24 h, RhCG1 and RhCG2 mRNA levels were elevated by 4- to 6-fold in the skin. Thus, the multifold induction of Rh mRNA levels in excretory tissues (gills and skin) and internal tissues in response to conditions that perturb normal ammonia excretion suggests that RhBG, RhCG1 and RhCG2 may be involved in facilitating ammonia transport in this species. Furthermore, the findings support earlier studies demonstrating that the skin is an important site of ammonia excretion in K. marmoratus.

Key words: Kryptolebias marmoratus, ammonia excretion, gills, skin, ammonia transporter


    Introduction
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Most teleost fish excrete ammonia and urea as the primary nitrogenous waste, with ammonia contributing more than 80% of the total (Wood, 1993Go). The major site of ammonia elimination is the gills, but the kidney and skin may also be involved (for a review, see Wilkie, 2002Go). Although ammonia is produced endogenously, it is a dangerous neurotoxin at elevated concentrations (Felipo and Butterworth, 2002Go; Rose, 2006Go). Normally ammonia is excreted predominantly by passive diffusion down the NH3 partial pressure gradient (PNH3) from blood to water across the gills (Wilson et al., 1994Go). In environments of high external ammonia or elevated pH, the PNH3 gradient across the gills may be diminished or reversed, resulting in ammonia uptake from the environment and/or an inhibition of ammonia excretion (Wright and Wood, 1985Go; Wilson et al., 1994Go; Wilkie, 2002Go).

Fish survive in environments of elevated ammonia by one or more of the following strategies: reducing endogenous ammonia production, converting ammonia to less toxic molecules (e.g. urea, glutamine), or continuing to excrete ammonia against the gradient (for a review, see Chew et al., 2006Go). Very little is known about the latter possibility because it is very difficult to define the true blood-to-water PNH3 and electrochemical gradients (ENH4+) (Wilson et al., 1994Go). African sharptooth catfish Clarias gariepinus is a species that appears to excrete ammonia actively against high external ammonia, but the exact mechanism of the excretion is currently unknown (Ip et al., 2004Go). Indeed, only the mudskipper Periophthalmodon schlosseri has been reported to actively excrete ammonia against an indisputable gradient (8 and 30 mmol l–1 NH4Cl in the water). The mechanism likely involves basolateral Na+-K+(NH +4)-ATPase coupled to an apical Na+/H+ (NH +4) exchanger (Randall et al., 1999Go).

Another possible mechanism of NH3/NH +4 transport is via the Rhesus glycoproteins. The Rhesus glycoproteins (Rh genes) represent members from the Amt/MEP/Rh superfamily found in all three domains of living organisms: Bacteria, Archaea and Eukarya. Amt and Rh proteins are distantly linked (Huang and Liu, 2001Go). The first ammonia transporter genes were identified from yeast Saccharomyces cerevisiae (ScMep1) and plant Arabidopsis thaliana (AtAmt1) (Marini et al., 1994Go; Ninnemann et al., 1994Go). In mammals, three Rh genes are identified so far: RhAG, RhBG and RhCG. RhAG expression is restricted to the erythrocyte membrane, whereas RhBG and RhCG are expressed in various tissues in the mammalian systems, including liver, kidney and gastrointestinal tract (Handlogten et al., 2005Go; Liu et al., 2000Go; Liu et al., 2001Go; Weiner et al., 2003Go; Weiner and Verlander, 2003Go). Studies in mammalian and plant systems reveal that at least some of those Rh genes encode proteins that mediate NH3/NH +4 movement (Khademi et al., 2004Go; Zheng et al., 2004Go; Mayer et al., 2006Go), but the form of ammonia (NH3 gas or NH +4 ion) being transported, and whether the transport is active or passive, are still under much debate (Bakouh et al., 2004Go; Khademi et al., 2004Go; Nakhoul et al., 2005Go). A full-length cDNA of Rh-like protein (Rh-CM) has been identified recently from the gills of the aquatic crab Carcinus maenas, which has a similar predicted transmembrane structure as the mammalian Rh proteins (Weihrauch et al., 2004Go). However, the precise role of Rh-CM in crab ammonia excretion awaits elucidation.

To date, there have been only two reports of Rh sequences in fish (Huang and Peng, 2005Go; Nakada et al., 2007Go). RhAG, RhBG, RhCG1 and RhCG2 sequences have recently been identified in the pufferfish Takifugu rubripes, with unique spatial distribution within the fish gill, and these Rh genes mediate movement of the ammonia analogue methylammonia when expressed in Xenopus oocytes (Nakada et al., 2007Go). However, no physiological studies of Rh genes have been conducted. This family of Rh transporters may be an important missing link in our understanding of branchial ammonia excretion. The mangrove killifish Kryptolebias marmoratus is very tolerant of elevated external ammonia, surviving 48 h of 10 mmol l–1 NH4Cl at pH 8.0 (Frick and Wright, 2002aGo). Remarkably, there was very little change in tissue ammonia levels in K. marmoratus exposed to external ammonia, nor were tissue urea or glutamine concentrations altered (Frick and Wright, 2002aGo). During prolonged air exposure (11 days), K. marmoratus volatilize NH3 (Frick and Wright, 2002bGo) by elevating both NH +4 concentration and pH on the cutaneous surface (Litwiller et al., 2006Go). Ammonia excretion during both elevated environmental ammonia and air exposure may require specialized transport mechanisms to move ammonia across cell membranes possibly against the gradient, similar to the mudskipper P. schlosseri (Randall et al., 1999Go).

The first objective of this study was to isolate Rh genes from K. marmoratus and determine their tissue distribution, with a particular focus on the gill and skin. The second objective was to quantify changes in Rh mRNA expression in K. marmoratus in response to elevated external ammonia concentrations and aerial exposure. We have cloned three Rh genes from K. marmoratus and investigated the tissue expression pattern of each Rh gene, in control and ammonia-exposed fish. Using quantitative real time-PCR, we have also measured the relative mRNA expression of all three Rh genes in response to (i) high external ammonia in the gills and skin and (ii) aerial exposure in the skin. In addition, relative RhBG expression levels in brain, liver and muscle of control and ammonia-exposed K. marmoratus were also quantified.


    Materials and methods
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Experimental animals
Fish were obtained from a breeding colony of Kryptolebias marmoratus Poey held in the Hagan Aqualab at the University of Guelph, Guelph, ON, Canada (Frick and Wright, 2002aGo). Adult hermaphrodite fish, at least 1 year of age and weighing approximately 0.06–0.12 g, were used for experiments. Hermaphrodites were identified by the appearance of an overall mottled brown colouration, a characteristic caudal ocellus, and a whitish border on the anal fin. Fish were kept in individual containers under a constant photoperiod (12 h:12 h, L:D), in 15{per thousand} artificial seawater (made with distilled water and Crystal Sea® Marinemix; Marine Enterprises International, Inc., Baltimore, MA, USA), 25°C, pH 8.1. Water changes were performed every 2 weeks and fish were fed Artemia five times per week. The experiments in this study were approved by the University of Guelph Animal Care Committee.

Full-length cDNA cloning of the RhBG, RhCG1 and RhCG2 from killifish K. marmoratus
Two fish were used for Rh gene cloning. Fish were decapitated, the gills removed and immediately frozen in liquid nitrogen. Total RNA was extracted from killifish gill using Trizol (Invitrogen Canada Inc., Burlington, ON, Canada). First-strand cDNA was synthesized using Superscript reverse transcriptase II (Invitrogen) with an adaptor oligodT primer (T17AP2: GACTCGAGTCGACATCGAT17). A partial sequence (585 bp) was obtained using F primer (GCACACTGTTCCTGTGGATG) and R primer (CAGCAGGATCTCCCCAGA), with the thermal cycle (PTC-200, Peltier Thermal Cycler, MJ Research, Mississauga, ON, Canada): 94°C, 2 min, 45 cycles of 94°C, 30 s; 51°C, 30 s; 68°C, 1 min and a final extension at 68°C, 5 min (Invitrogen Platinum Taq). Sequence of this PCR product was confirmed to be a Rh homologue. Thereafter, 3' RACE was conducted using the F primer and AP2 primer (GACTCGAGTCGACATCGA) with thermal cycles: 95°C, 5 min, 45 cycles of 94°C, 15 s; 56°C, 1 min; 68°C, 5 min and a final extension at 72°C, 10 min (QIAgen High Fidelity HotStar, Qiagen, Mississauga, ON, Canada). Three PCR products (1.3 kb, 1.6 kb and 1.8 kb) were obtained, gel-purified (QIAquick extraction kit), cloned into pGEM-T easy vectors (Promega, Madison, WI, USA) and transformed into E. coli XL-Blue strain. Plasmids from positive clones were extracted (QIAgen miniprep), sequenced (Mobix sequencing facility, McMaster University) and confirmed to be 3' end sequences of RhBG, RhCG1 and RhCG2. 5' RACE was then carried out with cloning primers (Table 1) (Marathon cDNA Amplification Kit, Clontech, Moutainview, CA, USA).


View this table:
[in this window]
[in a new window]

 
Table 1. Gene-specific primer sequences for 5' end cloning

 

Full-length sequences submitted to GenBank have the following accession number: DQ995211 (RhBG), DQ995210 (RhCG1) and DQ423779 (RhCG2).

Ammonia exposure
Fish were fasted for 48 h prior to the onset of experiments to eliminate the influence of diet on nitrogen metabolism and excretion. Three groups of animals were studied. Control fish were exposed to 15{per thousand} seawater (pH 8.1) containing no added NH4HCO3. Experimental fish were exposed to either 1 or 2 mmol l–1 NH4HCO3 (15{per thousand}, pH 8.1). At the end of 5 days, fish were decapitated. Fish dissections were conducted under a dissecting microscope. Individual tissues (brain, eye, gill, gonad, gut, kidney, liver, skeletal muscle and skin) were excised and immediately frozen in liquid nitrogen and kept at –80°C for later RNA isolation within 2 weeks. Identical groups of fish were treated in the same way, except at the end of exposure, fish were decapitated and whole fish were frozen in liquid nitrogen, and stored at –80°C for whole-body ammonia analysis within 1 week.

We attempted to measure ammonia excretion to the water in fish exposed to 1 and 2 mmol l–1 NH4HCO3, however, due to the small size of the fish and the high background ammonia, this proved to be difficult. In preliminary experiments we extended the flux period from 4 to 24 h to increase the signal:noise ratio, but this introduced the confounding problem of significant microbial metabolism, which removed ammonia from solution. Hence ammonia excretion data were unreliable and are not presented.

Aerial exposure
Fish exposed to terrestrial conditions were placed in individual plastic containers containing a moist paper of 15{per thousand} seawater at 25°C, as described previously (Ong et al., 2007Go). After 24 h, fish were decapitated and skins were dissected, frozen immediately in liquid nitrogen and kept at –80°C until analysis within 1 week.

Whole-body ammonia analysis
The frozen fish samples (including heads) were used for whole-body ammonia content measurement. Each sample was powdered using a mortar and pestle under liquid nitrogen, weighed and deproteinized in 10 vols of 10% trichloroacetic acid (TCA) (Fisher Scientific). The homogenate was centrifuged (Sorvall Legend RT, Mandel, ON, Canada) at 12 000 g at 4°C for 15 min. The deproteinized samples were neutralized to pH 6.5–7.0 with 2 mol l–1 KHCO3 (Sigma-Aldrich). Ammonia content was determined by the method of Kun and Kearney (Kun and Kearney, 1974Go). The change in absorbance at 340 nm (25°C) was monitored using a Spectra Max 90 spectrophotometer (Molecular Devices, Woodbridge, ON, Canada). Freshly prepared ammonium chloride (Sigma-Aldrich) was used as a standard.

Tissue expression
Reverse-transcription PCR (RT-PCR) was used to determine the mRNA expression pattern of RhBG, RhCG1 and RhCG2 in control and ammonia-exposed tissues. Total RNA extraction and cDNA synthesis were done as described above. A DNase I (Invitrogen) digestion step was used (1 U per 1 µg RNA, 15 min at room temperature) to ensure there was no genomic DNA contamination prior to cDNA synthesis. Three sets of gene-specific primers (Table 2) were used to examine the tissue-specific expression of RhBG, RhCG1 and RhCG2; and elongation factor 1alpha (EF1a) was used as the control gene to ensure that cDNA of individual samples were successfully synthesized.


View this table:
[in this window]
[in a new window]

 
Table 2. Gene-specific primer sequences for tissue expression screening

 


Figure 1
View larger version (125K):
[in this window]
[in a new window]

 
 


Figure 2
View larger version (155K):
[in this window]
[in a new window]

 
Fig. 1. Amino acid sequence alignment of Kryptolebias marmoratus Rh with other Rh sequences. Conserved amino acids are shaded in black and similar amino acids are shaded in grey. Potential N-glycosylation sites of K. marmoratus RhCGs are underlined in red. (A) Amino acid sequence alignment of Kryptolebias marmoratus RhBG with other RhBG sequences. Accession numbers of sequences: Takifugu rubripes AAM48577; Danio rerio AAQ09527; Homo sapiens NP_065140; Rattus norvegicus AAH79365 and Mus musculus NP_067350. (B) Amino acid sequence alignment of K. marmoratus RhCGs with other RhCG sequences. Accession numbers of sequences: Takifugu rubripes RhCG1 AAM48578; Takifugu rubripes RhCG2 AAM48579; Danio rerio AAM90586; Homo sapiens AAH30965; Rattus norvegicus NP_898876 and Mus musculus NP_062773.

 
The thermal cycle used was: 94°C, 3 min, 45 cycles of 94°C, 30 s; 58°C, 30 s (RhBG and RhCG2) or 55°C, 30 s (RhCG1 and EF1a); 72°C, 1 min and a final extension at 72°C for 5 min (Invitrogen Taq polymerase).

Quantitative PCR analysis
Potential ammonia excretory organs, gill and skin, were used to test for all three Rh gene expressions in control and experimental fish by quantitative PCR (Q-PCR). Other internal organs, brain, liver and skeletal muscle, were selected to analyze for the expression of RhBG. In this study, two control genes, EF1a and 18S ribosomal RNA (rRNA), were used as normalization factors; and the choice of which normalization factor to use was dependent on which gene exhibited the most consistent expression in control and ammonia-exposed or air-exposed tissues. For each Q-PCR reaction, 5 µl of 5x diluted cDNA sample was used. Q-PCR primers used are listed in Table 3.


View this table:
[in this window]
[in a new window]

 
Table 3. Gene-specific primer sequences for quantitative PCR

 

Quantification of gene expression was done using Platinum SYBR green qPCR Super-mix-UDG (Invitrogen) with PCR thermal cycle (Mx3000P QPCR System, Stratagene, Cedar Creek, Texas, USA): 50°C for 2 min, 95°C for 2 min, followed by 40 cycles of 95°C for 15 s and 60°C for 15 s. Gel electrophoresis was performed to ensure that only a single PCR product of the desired size was obtained for each reaction. The Q-PCR product was purified (QIAquick PCR purification kit) and sequenced to confirm its identity.

Sequence analysis
Mammalian Rh homologues are predicted to be membrane proteins with 12 membrane spanning domains and cytoplasmic N- and C-terminals (Huang and Liu, 2001Go), but nothing is known about fish Rh homologues. To predict the potential localization of killifish Rh proteins, we characterized the primary and secondary structure of the killifish Rh sequences by analyzing their hydropathy profiles (Kyte-Doolittle scale) via webserver SDSC Biology WorkBench 3.2 at http://seqtool.sdsc.edu/CGI/BW.cgi. To further confirm that these three Rh sequences encode for membrane proteins, which consist of transmembrane (TM), intra- and extracellular motifs, transmembrane domain organizations were predicted at TMHMM server, version 2.0 (http://www.cbs.dtu.dk/services/TMHMM). Furthermore, mammalian Rh homologues have been shown to be glycoproteins (Quentin et al., 2003Go) and therefore, potential N-glycosylation sites on killifish Rh protein sequences were predicted via NetNGlyc 1.0 Server at http://www.cbs.dtu.dk/services/NetNGlyc.


Figure 3
View larger version (83K):
[in this window]
[in a new window]

 
Fig. 2. Protein characteristics of K. marmoratus RhBG, RhCG1 and RhCG2. Amino acid compositions indicate that all three Rh proteins consist of hydrophobic and polar amino acids, and all three proteins are negatively charged at physiological pH. Hydropathy profiles (Kyte–Doolittle scale) indicate that high hydrophobicity regions are dispersed along all three sequences and these high hydrophobicity regions correspond to the predicted transmembrane domains (red blocks). All three Rh proteins have intracellular N- and C-terminals.

 
Sequence alignments (Clustal W) were conducted using BioEdit software downloaded at http://www.mbio.ncsu.edu/BioEdit/bioedit.html. The same software was used for molecular mass, isoelectric point (pI), amino acid composition, and percentage sequence identity calculations.

Phylogenetic analysis
Phylogenetic and molecular evolutionary analyses were conducted using MEGA version 3.1 downloaded at http://www.megasoftware.net (Kumar et al., 2004Go). Sequences were first aligned by ClustalW and subjected to a Neighbour-joining (NJ) matrix for tree reconstruction and evaluated by means of a Bootstrap of 1000 replicates.

Statistical analysis
All data are expressed as mean ± the standard error of the mean (s.e.m.) (N=6–8). Analysis of variance (ANOVA) was used to compare means of relative Rh mRNA expression in the gill with Statistix software (Analytical Software, Tallahassee, FL, USA), followed by the Least Significant Difference (LSD) test to determine where significant differences were present (P<0.05). For Rh mRNA expression level between control (immersion) and air-exposed (emersed) fish, an unpaired t-test was conducted to determine if expression was significantly different (P<0.05; control: N=6; air-exposed: N=4).


Figure 4
View larger version (35K):
[in this window]
[in a new window]

 
Fig. 3. Phylogenetic relationships of K. marmoratus RhBG and RhCGs and other homologues. Two major clusters are identified: Cluster I (RhCG), Cluster II (RhBG). Cluster I is subdivided into Ia (fish/amphibian/mammals/aves) and Ib (invertebrates). Cluster II is also further divided into IIa (fish) and IIb (mammals/amphibian/aves). Sequences are obtained from GenBank with accession numbers indicated.

 

    Results
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Nucleotide, protein sequences and structures
We have obtained full-length cDNA sequences of three Rhesus glycoproteins in the killifish K. marmoratus: RhBG, RhCG1 and RhCG2, and they are 1736, 1920 and 2021 bp long, respectively. RhCG1 and RhCG2 are highly homologous in both their nucleotide (72.5% identity) and amino acid (61.1% identity) sequences. RhCG1 and RhCG2 are similar to RhBG, with 50.6% and 49.5% identity, respectively, for nucleotide sequences and 54.4% and 52.3% identity at the amino acid level. All three Rh sequences appear to share high homology with other known Rh gene sequences.

RhBG
K. marmoratus RhBG is 76.2–84.8% identical to other known fish RhBGs and 52.2–61.5% identical to known mammalian RhBGs. Sequence alignment revealed that K. marmoratus RhBG is highly homologous to other fish RhBGs, with no gap found between 55H and 388E (TM2 to TM9 of K. marmoratus RhBG) (Fig. 1A). The open reading frame (ORF) of RhBG encodes a 462-amino acid polypeptide (50.5 kDa), with two potential N-glycosylation sites (47NDSH50, 217NCSV220) (Fig. 1A). When K. marmoratus RhBG was aligned with all known RhBG sequences from fish and mammals, it was found that variable regions of fish RhBG sequences are located between amino acids 250–300 and the C-terminal sequences. However, these regions are rather conserved among the mammalian RhBG sequences (data not shown).

Many fragments of the RhBG sequences appear to be class-specific. For example, RhBG amino acid regions 200MVTRIL(Y/H)RPNLD211 and 312SMIVGF(L/M)AG(I/T)ISV324 are highly conserved among fish sequences. However, the mammalian RhBG sequences of the same regions are highly conserved among themselves and are encoded as 200(V/F)LS(R/W)VLYR(P/S)QLE211 and 312ALAAGFLAGTVST324, respectively. Such class-specific regions are also located at the N- and C-terminal sequences (data not shown).

RhCG
RhCG1 and RhCG2 ORFs, encode for polypeptides 490 (54.2 kDa) and 483 (53.3 kDa) amino acids in length, respectively. RhCG1 show 72–84.6% and 53.9–64.6% identity to known fish and mammalian RhCG sequences, respectively. Similarly, the identity between RhCG2 and other fish sequences is 71.2–81.0% and 51–61% with mammalian RhCGs (data not shown). RhCG1 has three potential N-glycosylation sites (60NISS63, 299NSTL302, 479NFTV482), whereas RhCG2 contains two such sites (57NLTD60, 295NATL298) (Fig. 1B). The C-terminal sequences appear to be the least conserved among species and a class-specific conserved region is also found at the C-terminal of RhCG sequences (data not shown).


Figure 5
View larger version (6K):
[in this window]
[in a new window]

 
Fig. 4. Whole-body ammonia content of K. marmoratus after 5 days of 0 mmol l–1, 1 mmol l–1 and 2 mmol l–1 ammonia exposure. Asterisk indicates that tissue ammonia was significantly higher at 2 mmol l–1 ammonia compared to 0 mmol l–1 and 1 mmol l–1 ammonia. Values are means ± s.e.m., N=6 (one-way ANOVA, P<0.05).

 
Hydropathy analysis
Hydropathy analysis revealed that all three Rh proteins are highly hydrophobic and negatively charged at physiological pH. They share similar topology that resembles bacterial Amt (Blakey et al., 2002Go) and mammalian Rh membrane channels (Liu et al., 2000Go; Liu et al., 2001Go), with cytoplasmic N- and C-terminals. K. marmoratus RhBG is predicted to have ten transmembrane domains, while both RhCG1 and RhCG2 have 12 predicted transmembrane domains (Fig. 2).

Phylogenetic relationships between RhBG and RhCG proteins
The phylogenetic tree reconstruction shows that the Rh proteins form two main clusters: Cluster I (RhCG) and II (RhBG), which are subdivided into smaller clusters (Fig. 3). The invertebrate Rh-like proteins (Ib) are divergent from the RhCG family (Ia). The vertebrate RhCG, on the other hand, diverge into a mammalian RhCG cluster and a cluster including other vertebrate RhCGs, which are then divided later into fish, amphibian and avian RhCG clusters. On the other hand, the RhBG cluster (cluster II), is also subdivided into two groups IIa and IIb. However, it is interesting to note that the fish RhBG (IIa) proteins apparently diverged earlier, forming one distinct cluster, whereas mammalian RhBGs, in this case, have closer relationships with the amphibian and avian homologues and diverged later than the fish RhBGs.

Whole-body ammonia content
The whole-body ammonia level was not altered after 5 days of exposure to 1 mmol l–1 NH4HCO3. However, after 5 days of 2 mmol l–1 NH4HCO3 exposure, whole-body ammonia content increased significantly by 37% (Fig. 4).

Tissue expression of Rh genes
Reverse-transcription PCR results show that RhBG expression in control K. marmoratus is consistently found in gill and skin, whereas RhCG1 and RhCG2 are predominantly expressed in gill. After 5 days of exposure to high external ammonia levels (2 mmol l–1 NH4HCO3), RhBG expression is induced in brain, eye, gonad, gut, kidney, liver and skeletal muscle and continues in gill and skin. RhCG1 expression is also induced in skin of ammonia-exposed fish, but RhCG2 expression remains restricted to the gill (Fig. 5).


Figure 6
View larger version (19K):
[in this window]
[in a new window]

 
Fig. 5. RT-PCR mRNA expression of RhBG, RhCG1 and RhCG2 in control (0 mmol l–1 ammonia) and ammonia-exposed (2 mmol l–1 ammonia) K. marmaratus. For each gene, the following tissues are shown from left to right: brain, eye, gill, gonad, gut, kidney, liver, skeletal muscle and skin. Each gel represents one individual (control N=3, ammonia-exposed N=3). Note RhBG, RhCG1 and RhCG2 are expressed strongly in gill tissue. RhBG expression is low in control tissues except in gill and skin, but higher in many tissues in ammonia-exposed fish. RhCG1 expression in skin is induced with ammonia exposure and RhCG2 expression remains restricted to gill tissues.

 

Quantitative PCR
Response to high external ammonia
Gill RhCG2 mRNA levels were not altered after 5 days of exposure to 1 mmol l–1 NH4HCO3, but 2 mmol l–1 NH4HCO3 exposure resulted in a 5.8-fold increase, relative to the control level. Gill RhBG and RhCG1 mRNA levels did not change in response to either ammonia level (Fig. 6A). In skin, RhCG1 mRNA levels increased significantly by 2.4-fold and 7.7-fold after 5 days of 1 and 2 mmol l–1 of NH4HCO3 exposure, respectively, relative to control fish. As well, skin RhCG2 mRNA levels increased by 3.8-fold after exposure to 1 mmol l–1 NH4HCO3, but there were no changes when fish were exposed to 2 mmol l–1 NH4HCO3 relative to control fish (Fig. 6B).


Figure 7
View larger version (12K):
[in this window]
[in a new window]

 
Fig. 6. Relative mRNA expression levels of gill Rh genes in excretory organs (gills and skin) of K. marmaratus exposed to 0 mmol l–1 (control) or 1 and 2 mmol l–1 NH4HCO3. (A) Gill RhBG, RhCG1 and RhCG2 relative to 18S rRNA. Asterisk indicates that RhCG2 mRNA levels were significantly higher than in fish exposed to 2 mmol l–1 ammonia compared to 0 or 1 mmol l–1 ammonia. RhBG and RhCG1 were not significantly different between control and ammonia-exposed fish. Values are means ± s.e.m.; 0 and 2 mmol l–1 ammonia, N=7, 1 mmol l–1 ammonia, N=8; one-way ANOVA, P<0.05). (B) Skin RhBG, RhCG1 and RhCG2 relative to EF1a. Letters (a,b,c) indicate that RhCG1 mRNA levels were significantly higher in fish exposed to 1 mmol l–1 relative to 0 mmol l–1 ammonia, and significantly higher in 2 mmol l–1 relative to 0 and 1 mmol l–1 ammonia. Asterisk indicates that RhCG2 was significantly higher in 1 mmol l–1 compared to 0 and 2 mmol l–1 ammonia. RhBG was not significantly different between control and ammonia-exposed fish. Values are means ± s.e.m.; N=6 (one-way ANOVA, P<0.05).

 
RhBG mRNA levels remained unchanged in the brain but were significantly higher in liver (3.4-fold) and muscle (7.2-fold) tissue in 2 mmol l–1 NH4HCO3-exposed fish compared to control fish (Fig. 7).


Figure 8
View larger version (7K):
[in this window]
[in a new window]

 
Fig. 7. Relative mRNA expression levels of RhBG to EF1a in internal organs of K. marmaratus exposed to 0 mmol l–1 (control) or 1 and 2 mmol l–1 NH4HCO3. In brain, no significant difference was observed between control and ammonia-exposed fish. In liver, RhBG was significantly higher in liver of fish exposed to 2 mmol l–1 (b) compared to 0 mmol l–1 (a), but there was no significant difference between 0 (a) and 1 mmol l–1 ammonia (a,b), as well as between 1 and 2 mmol l–1 ammonia-exposed fish. In muscle, RhBG in muscle was significantly higher in fish exposed to 2 mmol l–1 (asterisk) than 0 and 1 mmol l–1 ammonia. Values are means ± s.e.m.; N=6 (one-way ANOVA, P<0.05).

 
Response to aerial exposure
Significant induction of RhCG1 (6.2-fold) and RhCG2 (4.2-fold) mRNA levels were observed in killifish skin after 24 h of air exposure. The RhBG mRNA level was not altered (Fig. 8).


Figure 9
View larger version (6K):
[in this window]
[in a new window]

 
Fig. 8. Relative mRNA expression levels of RhBG, RhCG1 and RhCG2 to EF1a in the skin of control (immersed) or air-exposed K. marmoratus. Asterisks indicate both RhCG1 and RhCG2 were significantly higher in skin of air-exposed relative to control fish. Values are means ± s.e.m.; N=6; air-exposed: N=4 (t-test, P<0.05).

 

    Discussion
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
We have identified three Rh genes in killifish K. marmoratus: RhBG, RhCG1 and RhCG2, which encode transmembrane proteins with cytoplasmic N- and C-terminals. The amino acid sequences of these three Rh genes share high homology to known Rh sequences in the GenBank. Since all three Rh proteins contain potential N-glycosylation sites, they are probably expressed as glycoproteins, similar to their mammalian counterparts (Quentin et al., 2003Go). K. marmoratus RhBG shares higher sequence homology to three-spined stickleback (Gasterosteus aculeatus) (data not shown), which also has ten predicted transmembrane domains but is unlike zebrafish (Danio rerio) and pufferfish (T. rubripes), both of which have 12 predicted transmembrane domains (data not shown). K. marmoratus RhCG1 and RhCG2, on the other hand, have 12 transmembrane domains similar to their mammalian counterparts (Huang and Liu, 2001Go).

Our study represents the first report of the possible involvement of Rh gene/proteins in ammonia excretion in fish during adverse conditions such as high external ammonia and aerial exposure. All three Rh mRNAs (RhBG, RhCG1 and RhCG2) were expressed under control conditions in the gill, similar to the observation in pufferfish gills (Nakada et al., 2007Go), and RhBG is also expressed in the skin. After exposure to high environmental ammonia (2 mmol l–1 NH4HCO3, pH 8.1), RhBG was widely expressed in many tissues, and RhCG1 expression extended to the skin. Interestingly, RhBG induction is observed in almost all tissues screened (Figs 5 and 7) except gill and skin (Fig. 6). RhCG1 and RhCG2 appear to demonstrate tissue specificity during high ammonia exposure (Fig. 6), with RhCG1 mRNA levels dominating skin Rh expression and RhCG2 dominating gill Rh expression.

An earlier study (Frick and Wright, 2002aGo) indicated that ammonia might be excreted against the gradients when K. marmoratus were exposed to high environmental ammonia (see Introduction). Indeed, in the present study, there was no elevation of body tissue ammonia levels after 5 days in 1 mmol l–1 NH4HCO3 and only a small increase (37%) after the same period of time in 2 mmol l–1 NH4HCO3 (pH=8.1, NH3{approx}100 µmol l–1). This is surprising because in other fish, internal ammonia levels typically increase several-fold in response to external ammonia levels (Wilson and Taylor, 1992Go; Wilson et al., 1994Go; Knoph and Thorud, 1996Go; Kong et al., 1998Go; Steele et al., 2001Go; Anderson et al., 2002Go). For example, in the ammonia-tolerant marine toadfish Opsanus beta, muscle tissue ammonia concentrations were elevated by threefold after 4 days in water containing 3.5 mmol l–1 NH4Cl (at pH 7.8, NH3{approx}70 µmol l–1) (Wang and Walsh, 2000Go), a lower NH3 level than in this study. In contrast, K. marmoratus is capable of preventing excessive accumulation of ammonia at high external ammonia and this appears to be similar to the mudskipper P. schlosseri (Randall et al., 1999Go), a species that is known to excrete ammonia actively during high environmental ammonia exposure.

Although the mode of ammonia excretion against high external ammonia in killifish has not been delineated, we hypothesize that Rh genes may be involved. All three Rh proteins are expressed in control pufferfish gills (Nakada et al., 2007Go). Constitutive expression of Rh proteins is probably required for routine removal of endogenous ammonia from nitrogen metabolism. There was no increase in any of the Rh mRNAs in the gills of K. marmoratus during 1 mmol l–1 exposure, but the upregulation of RhCG1 and RhCG2 in the skin (Fig. 6B) and constitutive expression of Rh proteins in the gill, may have been involved in facilitating ammonia excretion and thereby preventing an elevation of whole-body ammonia content (Fig. 4). Likewise, when external ammonia levels were increased to 2 mmol l–1, the upregulation of RhCG2 mRNA levels in the gill and RhCG1 mRNA levels in the skin (Fig. 6B) is suggestive of a functional role of Rh genes in ammonia transport. It should be noted that transcriptional changes do not necessarily imply a corresponding upregulation of protein content, and verification of these ideas is necessary. Initial experiments using antibodies obtained from mammalian Rh proteins were unsuccessful and future work will require fish-specific antibodies.

In the mammalian kidney, polarized localization of the Rh proteins is observed in epithelial cells of specific regions, including the renal collecting segment and the collecting duct, with RhBG expression in the basolateral membrane and RhCG in the apical membrane (Quentin et al., 2003Go; Verlander et al., 2003Go). Such polarized localization is also present in the pufferfish. RhBG is localized basolaterally and RhCG2 proteins apically in the pavement cells of the gills, whereas RhCG1 proteins are found in the apical membrane of the mitochondrial-rich (MR) cells (Nakada et al., 2007Go). We predict a similar localization of the different Rh proteins in the killifish.

It has been suggested (Weiner, 2006Go) that RhBG may be playing a role in ammonia-sensing or having roles other than ammonia-transport. This suggestion was based on the basolateral location of RhBG glycoproteins, together with the observation that expressions of RhBG mRNA and protein were not increased metabolic acidosis (which results in net excretion of acid and ammonia by the mammalian renal system) (Seshadri et al., 2006Go). Others have reported that genetic ablation of RhBG in the knockout mice did not affect ammonia transport in the kidney and tolerance to chronic acid-loading (Chambrey et al., 2005Go; Chambrey et al., 2006Go), although other genes may have been upregulated to compensate for the Rh knockdown. RhBG expressions are restricted to kidney, liver and gastrointestinal tract in the mammals (human and mouse) (Liu et al., 2001Go; Handlogten et al., 2005Go). In contrast, RhBG in K. marmoratus has a very broad tissue expression (Fig. 5). From the phylogenetic tree (Fig. 3), it is noted that RhBG is relatively more primitive and emerged earlier compared to RhCGs. Induction of RhBG was observed in a variety of tissues, whereas the expression of RhCGs was restricted to gill and skin during high ammonia exposure (Fig. 4). Fish normally experience much higher extracellular ammonia concentrations [0.1–1.3 mmol l–1 (Wood, 1993Go)] than mammals [0.03–0.1 mmol l–1 (Felipo and Butterworth, 2002Go)]. Taken together, the data suggests that RhBG may have important functions in fish to facilitate ammonia transport in various internal organs.

The skin of K. marmarotus is an important site for NH3 volatilization during air exposure (Frick and Wright, 2002bGo; Litwiller et al., 2006Go). Following emersion, there was an 18-fold increase in the NH +4 concentration on the cutaneous surface, leading to a substantial elevation in the partial pressure of NH3 (Litwiller et al., 2006Go). The authors proposed that an active mechanism may be involved in moving ammonia across the skin surface when fish were emersed. Induction of ammonia/ammonium transporter genes (RhCG1 and RhCG2) in the skin during aerial exposure (Fig. 8), therefore, may be involved in the transport of ammonia across the epidermis for subsequent NH3 volatilization, as well as in aquatic ammonia excretion. According to the model proposed by Khademi and co-workers (Khademi et al., 2004Go), ammonia approaches the Amt B channel as NH +4, then the proton is stripped away and ammonia is transported across the channel as NH3 gas; it exits the channel as NH3, then picks up a proton and forms NH +4. We propose that fish Rh proteins also conduct ammonia in the gaseous form. During air exposure, ammonia would leave the cutaneous surface of K. marmoratus in the form of NH3, without being protonated and hence volatilized. While in water, RhBG and/or RhCG would facilitate NH3 excretion across the gill and skin, which would be subsequently trapped by H+ to form NH +4. Acidification of the boundary water layer (Wright et al., 1989Go) in the cutaneous or gill surface of immersed K. marmoratus might be a possible mechanism to accelerate ammonia removal in fish, particularly in the presence of high external ammonia concentration.


    Acknowledgments
 
The authors wish to thank Jess Vickruck for her assistance with experimental animals, as well as Meaghan Mitchell for her careful attention to fish husbandry. We also thank Allan Edelsparre for his help in fish dissections. This project was supported by NSERC Discovery Grants and C.F.I./O.I.T. awards to C.M.W. and P.A.W. C.M.W. is supported by the Canada Research Chair Programme.


    References
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

Anderson, P. M., Broderius, M. A., Fong, K. C., Tsui, K. N. T., Chew, S. F. and Ip, Y. K. (2002). Glutamine synthetase expression in liver, muscle, stomach and intestine of Bostrichthys sinensis in response to exposure to a high exogenous ammonia concentration. J. Exp. Biol. 205,2053 -2065.[Abstract/Free Full Text]

Bakouh, N., Benjelloun, F., Hulin, P., Brouillard, F., Edelman, A., Chérif-Zahar, B. and Planelles, G. (2004). NH is involved in the NH + 3 4 transport induced by the functional expression of the human Rh C glycoprotein. J. Biol. Chem. 279,15975 -15983.[Abstract/Free Full Text]

Blakey, D., Leech, A., Thomas, G. H., Coutts, G., Findlay, K. and Merrick, M. (2002). Purification of the Escherichia coli ammonium transporter AmtB reveals a trimeric stoichiometry. Biochem. J. 364,527 -535.[CrossRef][Medline]

Chambrey, R., Goossens, D., Bourgeois, S., Picard, N., Boch-Faure, M., Leviel, F., Geoffroy, V., Cambillau, M., Colin, Y., Paillard, M. et al. (2005). Genetic ablation of Rhbg in the mouse does not impair renal ammonium excretion. Am. J. Physiol. 289,F1281 -F1290.

Chambrey, R., Goossens, D., Quentin, F. and Eladari, D. (2006). Rh glycoproteins in epithelial cells: lessons from rat and mice studies. Transfus. Clin. Biol. 13,154 -158.[CrossRef][Medline]

Chew, S. F., Wilson, J. M., Ip, Y. K. and Randall, D. J. (2006). Nitrogen excretion and defense against ammonia toxicity. In The Physiology of Tropical Fishes (ed. A. L. Val, V. M. F. Almeida-Val and D. J. Randall), pp. 307-395. New York: Academic Press.

Felipo, V. and Butterworth, R. F. (2002). Neurobiology of ammonia. Prog. Neurobiol. 67,259 -279.[CrossRef][Medline]

Frick, N. T. and Wright, P. A. (2002a). Nitrogen metabolism and excretion in the mangrove killifish, Rivulus marmoratus. I. The influence of environmental salinity and external ammonia. J. Exp. Biol. 205, 79-89.[Abstract/Free Full Text]

Frick, N. T. and Wright, P. A. (2002b). Nitrogen metabolism and excretion in the mangrove killifish, Rivulus marmoratus. II. Significant ammonia volatilization in a teleost during air exposure. J. Exp. Biol. 205,91 -100.[Abstract/Free Full Text]

Handlogten, M. E., Hong, S. P., Zhang, L., Vander, A. W., Steinbaum, M. L., Campbell-Thompson, M. and Weiner, I. D. (2005). Expression of the ammonia transporter proteins Rh B glycoprotein and Rh C glycoprotein in the intestinal tract. Am. J. Physiol. 288,G1036 -G1047.

Huang, C. H. and Liu, P. Z. (2001). New insights into the Rh superfamily of genes and proteins in erythroid cells and nonerythroid tissues. Blood Cells Mol. Dis. 27, 90-101.[CrossRef][Medline]

Huang, C. H. and Peng, J. (2005). Evolutionary conservation and diversification of Rh family genes and proteins. Proc. Natl. Acad. Sci. USA 102,15512 -15517.[Abstract/Free Full Text]

Ip, I. K., Zubaidah, R. M., Liew, P. C., Loong, A. M., Hiong, K. C., Wong, W. P. and Chew, S. F. (2004). African sharptooth catfish Clarias gariepinus does not detoxify ammonia to urea or amino acids but actively excretes ammonia during exposure to environmental ammonia. Physiol. Biochem. Zool. 77,242 -254.[CrossRef][Medline]

Khademi, S., O'Connell, J., Remis, J., Robles-Colmenares, Y., Miercke, L. J. W. and Stroud, R. M. (2004). Mechanism of ammonia transport by Amt/MEP/Rh: structure of AmtB at 1.35 Å. Science 305,1587 -1594.[Abstract/Free Full Text]

Knoph, M. B. and Thorud, K. (1996). Toxicity of ammonia to Atlantic salmon (Salmo salar L.) in seawater – effects on plasma osmolality, ion, ammonia, urea and glucose levels and hematologic parameters. Comp. Biochem. Physiol. 113A,375 -381.[CrossRef][Medline]

Kong, H., Edberg, D. D., Korte, J. J., Salo, W. L., Wright, P. A. and Anderson, P. M. (1998). Nitrogen excretion and expression of carbamoyl-phosphate synthetase III activity and mRNA in extrahepatic tissues of largemouth bass (Micropterus salmoides). Arch. Biochem. Biophys. 350,157 -168.[CrossRef][Medline]

Kumar, S., Tamura, K. and Nei, M. (2004). MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinfomatics 5, 150-163.[CrossRef]

Kun, E. and Kearney, E. B. (1974). Ammonia. In Methods of Enzymatic Analysis. Vol.IV (ed. H. U. Bergmeyer and K. Gawehn), pp.1802 -1806. New York: Academic Press.

Litwiller, S. L., O'Donnell, M. J. and Wright, P. A. (2006). Rapid increase in the partial pressure of NH3 on the cutaneous surface of air-exposed mangrove killifish, Rivulus marmoratus. J. Exp. Biol. 209,1737 -1745.[Abstract/Free Full Text]

Liu, Z., Chen, Y., Mo, R., Hui, C., Cheng, J. F., Mohandas, N. and Huang, C. H. (2000). Characterization of human RhCG and mouse Rhcg as novel nonerythroid Rh glycoprotein homologues predominantly expressed in kidney and testis. J. Biol. Chem. 275,25641 -25651.[Abstract/Free Full Text]

Liu, Z., Peng, J., Mo, R., Hui, C. and Huang, C. H. (2001). Rh type B glycoprotein is a new member of the Rh superfamily and a putative ammonia transporter in mammals. J. Biol. Chem. 276,1424 -1433.[Abstract/Free Full Text]

Marini, A. M., Vissers, S., Urrestarazu, A. and André, B. (1994). Cloning and expression of the MEP1 gene encoding an ammonium transporter in Saccharomyces cerevisiae. EMBO J. 13,3456 -3463.[Medline]

Mayer, M., Schaaf, G., Mouro, I., Lopez, C., Colin, Y., Neumann, P., Cartron, J.-P. and Ludewig, U. (2006). Different transport mechanisms in plant and human AMT/Rh-type ammonium transporters. J. Gen. Physiol. 127,133 -144.[Abstract/Free Full Text]

Nakada, T., Westhoff, C. M., Kato, A. and Hirose, S. (2007). Ammonia secretion from fish gill depends on a set of Rh glycoproteins. FASEB J. 21,1067 -1074.[Abstract/Free Full Text]

Nakhoul, N. L., DeJong, H., Abdulnour-Nakhoul, S. M., Boulpaep, E. L., Hering-Smith, K. and Hamm, L. L. (2005). Characteristics of renal Rhbg as an NH +4 transporter. Am. J. Physiol. 288,F170 -F181.

Ninnemann, O., Jauniaux, J. C. and Frommer, W. B. (1994). Identification of a high affinity NH +4 transporter from plants. EMBO J. 13,3464 -3471.[Medline]

Ong, K. J., Stevens, E. D. and Wright, P. A. (2007). Gill morphology of the mangrove killifish (Kryptolebias marmoratus) is plastic and changes in response to terrestrial air exposure. J. Exp. Biol. 210,1109 -1115.[Abstract/Free Full Text]

Quentin, F., Eladari, D., Cheval, L., Lopez, C., Goossens, D., Colin, Y., Cartron, J.-P., Paillard, M. and Chambrey, R. (2003). RhBG and RhCG, the putative ammonia transporters, are expressed in the same cells in the distal nephron. J. Am. Soc. Nephrol. 14,545 -554.[Abstract/Free Full Text]

Randall, D. J., Wilson, J. M., Peng, K. W., Kok, W. K., Kuah, S. S. L., Chew, S. F., Lam, T. J. and Ip, Y. K. (1999). The mudskipper, Periophthalmodon schlosseri, actively transports NH +4 against a concentration gradient. Am. J. Physiol. 277,R1562 -R1567.[Medline]

Rose, C. (2006). Effect of ammonia on astrocytic glutamate uptake/release mechanisms. J. Neurochem. 97 Suppl. 1,11 -15.[CrossRef][Medline]

Seshadri, R. M., Klein, J. D., Kozlowski, S., Sands, J. M., Kim, Y. H., Han, K. H., Handlogten, M. E., Verlander, J. W. and Weiner, I. D. (2006). Renal expression of the ammonia transporters, Rhbg and Rhcg, in response to chronic metabolic acidosis. Am. J. Physiol. 290,F397 -F408.

Steele, S. L., Chadwick, T. D. and Wright, P. A. (2001). Ammonia detoxification and localization of urea cycle enzyme activity in embryos of the rainbow trout (Oncorhynchus mykiss) in relation to early tolerance to high environmental ammonia levels. J. Exp. Biol. 204,2145 -2154.[Medline]

Verlander, J. W., Miller, R. T., Frank, A. E., Royaux, I. E., Kim, Y. H. and Weiner, I. D. (2003). Localization of the ammonium transporter proteins, Rh B Glycoprotein and Rh C Glycoprotein, in the mouse kidney. Am. J. Physiol. 284,F323 -F337.

Wang, Y. H. and Walsh, P. J. (2000). High ammonia tolerance in fishes of the family Batrachoididae (toadfish and midshipmen). Aquat. Toxicol. 50,205 -219.[CrossRef][Medline]

Weihrauch, D., Morris, S. and Towle, D. W. (2004). Ammonia excretion in aquatic and terrestrial crabs. J. Exp. Biol. 207,4491 -4504.[Abstract/Free Full Text]

Weiner, I. D. (2006). Expression of the non-erythroid Rh glycoproteins in mammalian tissues. Transfus. Clin. Biol. 13,159 -163.[CrossRef][Medline]

Weiner, I. D. and Verlander, J. W. (2003). Renal and hepatic expression of the ammonium transporter proteins, Rh B Glycoprotein and Rh C Glycoprotein. Acta Physiol. Scand. 179,331 -338.[CrossRef][Medline]

Weiner, I. D., Miller, R. T. and Verlander, J. W. (2003). Localization of the ammonium transporters, Rh B glycoprotein and Rh C glycoprotein, in the mouse liver. Gastroenterology 124,1432 -1440.[CrossRef][Medline]

Wilkie, M. P. (2002). Ammonia excretion and urea handling by fish gills: present understanding and future research challenges. J. Exp. Zool. 293,284 -301.[CrossRef][Medline]

Wilson, R. W. and Taylor, E. W. (1992). Transbranchial ammonia gradients and acid–base responses to high external ammonia concentration in rainbow trout (Oncorhynchus mykiss) acclimated to different salinities. J. Exp. Biol. 166,95 -112.[Abstract/Free Full Text]

Wilson, R. W., Wright, P., Munger, S. and Wood, C. (1994). Ammonia excretion in freshwater rainbow trout (Oncorhynchus mykiss) and the importance of gill boundary layer acidification: lack of evidence for Na+/NH +4 exchange. J. Exp. Biol. 191, 37-58.[Abstract]

Wood, C. M. (1993). Ammonia and urea metabolism and excretion. In The Physiology of Fishes (ed. D. H. Evans), pp. 379-425. Boca Raton, FL: CRC Press.

Wright, P. A. and Wood, C. M. (1985). An analysis of branchial ammonia excretion in the freshwater rainbow trout: effects of environmental pH change and sodium uptake blockade. J. Exp. Biol. 114,329 -353.[Abstract/Free Full Text]

Wright, P. A., Randall, D. J. and Perry, S. F. (1989). Fish gill water boundary layer: a site of linkage between carbon dioxide and ammonia excretion. J. Comp. Physiol. 158B,627 -635.[CrossRef]

Zheng, L., Kosterwa, D., Berneche, S., Winkler, F. K. and Li, X. D. (2004). The mechanism of ammonia transport based on the crystal structure of AmtB of Escherichia coli. Proc. Natl. Acad. Sci. USA 101,17090 -17095.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J. Exp. Biol.Home page
M. H. Braun, S. L. Steele, and S. F. Perry
The responses of zebrafish (Danio rerio) to high external ammonia and urea transporter inhibition: nitrogen excretion and expression of rhesus glycoproteins and urea transporter proteins
J. Exp. Biol., December 1, 2009; 212(23): 3846 - 3856.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
P. A. Wright and C. M. Wood
A new paradigm for ammonia excretion in aquatic animals: role of Rhesus (Rh) glycoproteins
J. Exp. Biol., August 1, 2009; 212(15): 2303 - 2312.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
D. Weihrauch, M. P. Wilkie, and P. J. Walsh
Ammonia and urea transporters in gills of fish and aquatic crustaceans
J. Exp. Biol., June 1, 2009; 212(11): 1716 - 1730.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. H. Braun, S. L. Steele, M. Ekker, and S. F. Perry
Nitrogen excretion in developing zebrafish (Danio rerio): a role for Rh proteins and urea transporters
Am J Physiol Renal Physiol, May 1, 2009; 296(5): F994 - F1005.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
T. K. N. Tsui, C. Y. C. Hung, C. M. Nawata, J. M. Wilson, P. A. Wright, and C. M. Wood
Ammonia transport in cultured gill epithelium of freshwater rainbow trout: the importance of Rhesus glycoproteins and the presence of an apical Na+/NH4+ exchange complex
J. Exp. Biol., March 15, 2009; 212(6): 878 - 892.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T.-H. Shih, J.-L. Horng, P.-P. Hwang, and L.-Y. Lin
Ammonia excretion by the skin of zebrafish (Danio rerio) larvae
Am J Physiol Cell Physiol, December 1, 2008; 295(6): C1625 - C1632.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
C. M. Nawata and C. M. Wood
The effects of CO2 and external buffering on ammonia excretion and Rhesus glycoprotein mRNA expression in rainbow trout
J. Exp. Biol., October 15, 2008; 211(20): 3226 - 3236.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
J. Genz, J. R. Taylor, and M. Grosell
Effects of salinity on intestinal bicarbonate secretion and compensatory regulation of acid-base balance in Opsanus beta
J. Exp. Biol., July 15, 2008; 211(14): 2327 - 2335.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
C. M. Nawata, C. C. Y. Hung, T. K. N. Tsui, J. M. Wilson, P. A. Wright, and C. M. Wood
Ammonia excretion in rainbow trout (Oncorhynchus mykiss): evidence for Rh glycoprotein and H+-ATPase involvement
Physiol Genomics, November 14, 2007; 31(3): 463 - 474.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hung, C. Y. C.
Right arrow Articles by Wright, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hung, C. Y. C.
Right arrow Articles by Wright, P. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?