spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online June 11, 2007
Journal of Experimental Biology 210, 2113-2120 (2007)
Published by The Company of Biologists 2007
doi: 10.1242/jeb.004101
This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tse, W. K. F.
Right arrow Articles by Wong, C. K. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tse, W. K. F.
Right arrow Articles by Wong, C. K. C.

Effect of osmotic shrinkage and hormones on the expression of Na+/H+ exchanger-1, Na+/K+/2Cl cotransporter and Na+/K+-ATPase in gill pavement cells of freshwater adapted Japanese eel, Anguilla japonica

William K. F. Tse1, Doris W. T. Au2 and Chris K. C. Wong1,*

1 Department of Biology, Hong Kong Baptist University, Kowloon Tong, Hong Kong
2 Departments of Biology and Chemistry, City University of Hong Kong, Hong Kong

* Author for correspondence (e-mail: ckcwong{at}hkbu.edu.hk)

Accepted 4 April 2007


    Summary
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
It is well-known that gill epithelial cells are important in fish osmoregulation. However, studies on the effect of osmotic stress on the direct cellular responses of the gill epithelial cells are limited. In this paper, we aimed to determine the effects of osmotic hypertonicity, hormones and cellular signaling molecules on the expression of ion transporters in the cultured primary freshwater pavement cells (PVCs), prepared from freshwater-adapted eels (Anguilla japonica). Our data demonstrated that the hypertonic (500 mOsmol l–1) treatment of the isolated PVCs induced cell shrinkage, followed by regulatory volume increase (RVI). Application of blockers (i.e. ouabain, bumetanide and EIPA) demonstrated that Na+/K+-ATPase, Na+/K+/2Cl cotransporter (NKCC) and Na+/H+ exchanger-1 (NHE-1) were involved in RVI. Western blot analysis of the hypertonic-treated cells revealed a significant induction of NHE-1, NKCC and, {alpha} and ß subunits of Na+/K+-ATPase. In nonshrunken cultured PVCs, we found that dexamethasone and dibutyryl cAMP treatments significantly stimulated the expression levels of the three ion transporters. Both prolactin and insulin-like growth factor-1, can only induce the expression of NKCC. The effect of thyroid hormone (T3) and dibutyryl cGMP was negligible. In this study, the induction of ion transporter expression was found to be post-transcriptionally regulated as no significant change in mRNA levels was detected. This observation implies that the regulation is rapid and is probably induced via nongenomic actions.

Key words: dexamethasone, hypertonic stress, dibutyryl cAMP, regulatory volume increase


    Introduction
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Eel (Anguilla japonica) is a euryhaline fish. To acclimate to the wide range of salinities during migration, the cellular and molecular reorganization of gill epithelia is essential for osmoregulation (Evans et al., 2005Go; Wong and Chan, 1999aGo). It had been reported in trout that during seawater transfer, transient increase in plasma osmolarity imposes hypertonic stress, which causes the shrinkage of red blood cells (Brauner et al., 2002Go). In addition, the drinking response in seawater-acclimating fish induced cell shrinkage in intestinal epithelia (Ando et al., 2003Go; Lionetto et al., 2001Go). Under the same circumstances, it is anticipated that the gill epithelium, which is in direct contact with water, would be exposed to the large osmotic fluctuations in the surrounding water. Surprisingly, there has been no study to address the effect of the hypertonic stress on the disturbance of gill cell volume.

Cell volume regulation is a fundamental and highly conserved cellular process found in most cells (Chamberlin and Strange, 1989Go; Lang et al., 1998bGo; Lang et al., 1998aGo). It is particularly important in euryhaline fish as they may require a rapid and effective mechanism to respond to the changing water salinity. The capability of gill epithelial cells to maintain a constant intracellular osmotic conditions is critical for normal cell functioning. As the gill is one of the major osmoregulatory organs in fish, the ability of the gill epithelial cells to recover from osmotic shrinkage/swelling, may relate to fish euryhalinity.

In vertebrates, hormones and growth factors play a critical role in cell volume regulation (Hoffmann and Dunham, 1995Go; Pedersen et al., 2006Go). In teleost fish, a number of key hormones have been identified as essential for euryhalinity and osmotic adaptability. The osmoregulatory hormones can be classified into two groups: (i) fast-acting hormones (i.e. natriuretic peptides and epinephrine, which are mediated by the action of cGMP and cAMP, respectively), and (ii) slow-acting hormones (i.e. cortisol, growth hormone/insulin-like growth factors and prolactin) (McCormick and Bradshaw, 2006Go). A considerable number of studies has demonstrated the biological effects of these hormones on gill functions, including the expression/distribution/activities of ion transporters and the proliferation/differentiation of chloride cells (Evans, 2002Go; Evans et al., 2005Go; Perry, 1997Go; Tse et al., 2006Go; Wong and Chan, 1999aGo; Wong and Chan, 1999bGo). Despite this body of evidence, however, because of the anatomical complexities of the gill epithelium, it is difficult to elucidate the direct hormonal effect as well as the immediate biological responses of the gill epithelial cells, using an in vivo approach.

Gill epithelial culture has been established in freshwater trout for the study of unidirectional ion fluxes and for the characterization of ion transporter properties (Kelly et al., 2000Go; Kelly and Wood, 2001cGo; Kelly and Wood, 2001aGo; Kelly and Wood, 2001bGo; Kelly and Wood, 2002aGo; Kelly and Wood, 2002bGo; Kelly and Wood, 2003Go; O'Donnell et al., 2001Go; Wood et al., 2002Go; Zhou et al., 2003Go; Zhou et al., 2004Go). A gill cell culture model from other fish species including salmon and eel, however, has not yet been established. In this study, we aimed to investigate the effects of hypertonic stress on the cellular responses of freshwater gill epithelial cells. Using purified pavement cells (PVCs), we demonstrated the effect of osmotic shrinkage on cell regulatory volume increase (RVI) as well as the expressions of the three important ion transporters: Na+/K+-ATPase, Na+/K+/2Cl cotransporter (NKCC), Na+/H+ exchanger-1 (NHE-1) in the cells. The involvement of the three ion transporters in RVI was demonstrated using three specific blockers [i.e. ouabain, bumetanide and 5-(N-ethyl-N-isopropyl)amiloride (EIPA)]. In addition, we established the primary epithelial gill culture from freshwater-adapted eels. Using the cultured cells, we measured and compared the direct effects of dexamethasone (DEX), prolactin (PRL), thyroid hormone (T3), insulin-like growth factor-1 (IGF-1), dibutyryl cAMP (dbcAMP) and dibutyryl cGMP (cGMP) to the expressions of the ion transporters.


    Materials and methods
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cell isolation, sizing and counting
Japanese eels (Anguilla japonica Temminck & Schlegel) weighing between 500–600 g, were reared in fibreglass tanks supplied with charcoal-filtered aerated tap-water at 18–20°C under a 12 h:12 h L:D photoperiod for at least 3 weeks. The eels were anaesthetized by 1–2% tricaine methanosulfonate (Sigma, St Louis, MO, USA) and the gill epithelial cells were isolated using a three-step discontinuous Percoll gradient system as described previously (Wong and Chan, 1999bGo; Tse et al., 2006Go). Briefly, fish gills were perfused with buffered saline (130 mmol l–1 NaCl, 2.5 mmol l–1 KCl, 5 mmol l–1 NaHCO3, 2.5 mmol l–1 glucose, 2 mmol l–1 EDTA, 10 mmol l–1 Hepes, pH 7.7) to remove blood cells, and the fish were then decapitated. Gill arches were excised, washed and cut into small fragments for tryptic digestion (0.5% trypsin + 5.3 mmol l–1 EDTA). The cell suspension was then filtered, washed and finally resuspended in 1.6 g ml–1 of Percoll solution for pavement cell (PVC) isolation. The purity and the identity of PVCs was determined by their weak staining of Na+/K+-ATPase as compared to chloride cells (Tse et al., 2006Go; Wong and Chan, 1999bGo). Isolated PVCs were then washed and resuspended in Leibovitz's L-15 medium (Sigma) supplemented with 10% foetal bovine serum (FBS), 1% penicillin/streptomycin and 0.5% fungizone (Gibco-BRL).

The cells were maintained in the medium for 1 h at room temperature before cell sizing and counting. Thereafter the cells were either resuspended in a normal (317 mOsmol l–1) or modified (500 mOsmol l–1, adjusted with 5 mol l–1 NaCl) Leibovitz's L-15 medium. Blockers for three ion transporters [1 mmol l–1 ouabain, 100 µmol l–1 bumetanide or 100 µmol l–1 5-(N-ethyl-N-isopropyl)amiloride (EIPA); Sigma] were added to the cells before the application of hyperosmotic stress. The medium osmolarity was determined using a vapour pressure osmometer (Wescor, 5500XR, Logan, UT, USA). The two groups of cells were counted and sized using a Coulter Multisizer II [with an orifice tube of 70 µm diameter and Isoton II (Beckamn, Coulter, Miami, FL, USA) as electrolyte] in every 5–10 min interval for 60 min. The cell count signal was the change of conductance of the electrolyte induced by particle resistance. Isoton II was used as the blank and calibration was carried out with monodiameter particles (P.D.V.B. latex 5.06 µm, Beckman Coulter). An aperture coincidence correction was below 2%.

Primary culture of freshwater gill epithelial cells
The cell suspension obtain from trypsin digestion was filtered and washed. The cells were then seeded at a density of 5x106 cells cm–1 onto collagen-coated culture plate. The cells were incubated at 22°C in a growth chamber with a humidified air atmosphere. One day after seeding, the plate was rinsed to remove mucous cells. Gill epithelial cells cultured for 1 day were then exposed to either hypertonic stress or drug treatments. In preliminary studies, we conducted time-course experiments to investigate the effects of the treatments on the expression of the ion transporters. The cultured cells were incubated in the different conditions for varying periods of time (1, 2, 6, 12 and 24 h). A significant induction of the ion transporter protein was observed after 6 h of hypertonic treatment and only after 24 h of hormonal or cell signaling molecule treatment. No induction of the ion-transporter mRNA was observed. Hence we selected the 6 h treatment for the hypertonic stress (500 mOsmol l–1) but 24 h exposure to each of the following drug treatments: (a) 0.5–2 µmol l–1 dexamethasone (DEX; Calbiochem, Darmstadt, Germany), (b) 0.1–10 nmol l–1 prolactin (PRL; Calbiochem), (c) 0.1–10 nmol l–1 insulin-like growth factor-1 (IGF-1; Sigma), (d) 0.05–0.2 µmol l–1 thyroid hormone (T3), (e) 1–4 mmol l–1 dibutyryl cGMP (cGMP) or (f) 1–4 mmol l–1 dibutyryl cAMP (dbcAMP; Calbiochem). For real-time PCR analysis, the isolated gill epithelial cells were dissolved in Trizol Reagent (Gibco-BRL) for total RNA extraction. For western blots, the samples were resuspended in cold lysis buffer containing 250 mmol l–1 Tris–HCl, pH 8.0, 1% NP-40 and 150 mmol l–1 NaCl and were assayed for protein concentration (DC Protein Assay Kit II, Bio-Rad Pacific Ltd, Hercules, CA, USA).


Figure 1
View larger version (41K):
[in this window]
[in a new window]

 
Fig. 1. Hypertonicity-induced cell volume change and the expression of Na+/K+-ATPase, Na+/K+/2Cl cotransporter (NKCC) and Na+/H+ exchanger-1 (NHE-1) in freshwater gill pavement cells (PVCs). (A) Percoll-purified PVCs were incubated in either normal (317 mOsmol l–1) or hypertonic (500 mOsmol l–1) medium. Blockers for three ion transporters (ouabain, bumetanide or EIPA) were added to the cells before the application of hyperosmotic stress. The change in cell volume was monitored using a Multisizer for a period of 60 min. Note that the three blockers reduced the RVI response in the cells. (B) A primary freshwater PVC culture was established. Over 80% of gill epithelial cells attached after overnight incubation (Bi); the cell suspension was obtained from trypsin digestion. (Bii) Gill epithelial cells cultured for 1 day. (C) Cell lysates were obtained from 6 h hypertonic treatment (HT) of the PVC culture and analysed by western blot (right). The amounts of the respective ion transporter protein were quantified and tabulated in graphical form (left). Significant induction of {alpha} and ß subunits of Na+/K+-ATPase, NKCC and NHE-1 were observed. (D) The gene expression levels for Ostf1 in the control and hypertonic-treated cells. *P<0.05 compared with the control. The results were obtained from more than five independent experiments.

 
Real-time PCR
Purified sample RNA with a ratio of 1.8–2.0 at A260/A280 was used. Briefly, 0.5 µg of total cellular RNA was reversed transcribed (iScript, Bio-Rad). PCR reactions were conducted with the iCycler iQ real-time PCR detection system using iQTM SYBR® Green Supermix (Bio-Rad). Primers for Na+/K+-ATPase {alpha}-subunit (X76108: TCTGATGTCTCCAAGCA GGC forward, CTGGTCAGGGTGTAGGC reverse) and ß233-subunits (AJ239317: ATGTCAGGAAATAA AGACAGT forward, TGCGTGGGTTTGTAGTTGCTCA reverse), Na+/K+/2Cl co-transporter-1 (NKCC-1; AJ486858: CCCATCATCTCCAACTTCTTCCT forward, CCCACCAGTTGATGACGAACA reverse), Na+/H+ exchanger-1 (NHE-1, AJ006917: CGCTTCTCGTCTTCGTCTACAG forward, CATGTTGGCCTCCACGTATGG reverse), and actin (CTGGTATCGTGATGGACTCT forward, AGCTCA TAG CTCTTCTCCAG reverse) have been tested in our previous study (Tse et al., 2006Go). A degenerative primer set for osmotic stress transcription factor 1 (Ostf1, AY679524: AGTGCCTCYGGWGCYAGYGT forward, TGGAACTTYTCCAGYTGYTC reverse) was designed according to the published sequences (Fiol et al., 2006Go; Fiol and Kultz, 2005Go). The PCR products were cloned into PCRII-TOPO (Invitrogen, Carlsbad, CA, USA) and subjected to dideoxy sequencing for verification. The copy number of the transcripts for each sample was calculated in reference to the parallel amplifications of known concentrations of the respective cloned PCR fragments. Standard curves were constructed and the amplification efficiencies were about 0.9–0.95. The occurrence of primer-dimers and secondary products was examined using melting curve analysis. Our data indicated that the amplification was specific. There was only one PCR product amplified for each individual set of primers. Control amplification was done either without reverse transcriptase or without RNA. We had determined the actin mRNA levels per same quantity of cDNA from PVCs exposed to the different treatments. The mRNA expression levels were comparable with the threshold cycle (Ct) values of around 20–21 cycles. Hence in this study the expression levels of actin mRNA were used for data normalization.

Western blot analysis
Samples were subjected to electrophoresis in 10% polyacrylamide gels. The gels were then blotted onto PVDF membranes (PerkinElmer Life Sciences, Boston, MA, USA). Western blot was conducted using mouse antibodies against Na+/K+-ATPase {alpha} ({alpha}5; 1:100), ß-subunits (ß4B4; 1:100), NKCC (T4; 1:100; Developmental Studies Hybridoma Bank, University of Iowa) and NHE-1 (1:1000; Chemicon Int., Temecula, CA, USA), followed by incubation with (1:4000) horseradish peroxidase-conjugated goat anti-mouse antibody. Specific bands were visualized using chemiluminescent reagent (Western-lightening Plus, PerkinElmer Life Sciences). The blots were then washed in phosphate-buffered saline (PBS) and re-probed with (1:100) mouse anti-actin serum (JLA20, Developmental Studies Hybridoma Bank, the University of Iowa, IA, USA). Images of the blots were digitally captured by a gel documentation system (UVP). The optical density of each band was quantified using image analyzing software (Metamorph, Universal Imaging Corp.). The data were then normalized using the expression levels of actin.

Statistical analysis
All data are represented as means ± s.e.m. Statistical significance was tested using Student's t-test. Groups were considered significantly different if P<0.05.


    Results
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Effect of hypertonic treatment on the cell size and the expressions of NHE-1, NKCC and Na+/K+-ATPase in PVCs
We conducted preliminary studies to test the viability of the gill epithelial cells maintained in different hypertonic media, with osmolarities of 500, 700 and 900 mOsmol l–1. Significant cell death was observed in media of 700 and 900 mOsmol l–1, as evaluated by Trypan Blue exclusion test. The viability of the gill epithelial cells maintained in 500 mOsmol l–1 was similar to the control (317 mOsmol l–1). Hence the osmolarity of the hypertonic medium used in the subsequent experiments was 500 mOsmol l–1. Multisizer counting demonstrated that the hypertonic-treated PVCs decreased in size significantly in 5 min, by about 13%. Regulatory volume increase (RVI) was induced afterwards as the cell size recovered and stabilized at about 30–40 min post-treatment (Fig. 1A). All three blockers reduced the RVI response in the cells. Bumetanide or ouabain treatment produced the most remarkable effect. There was no significant change in the size of the cells that were maintained in the control medium.

Primary freshwater gill epithelial cell culture was established (Fig. 1B). Over 80% of gill epithelial cells attached after overnight incubation. In the culture, the percentage of chloride cells was very low (about 1%). The major of the cell population was found to be the PVCs. Using the cell culture model, we tested the effect of hypertonic stress and hormones/cell signaling molecules on the expression levels of the three ion transporters (i.e. NHE-1, NKCC, {alpha} and ß subunits of Na+/K+-ATPase). Our data indicated that hypertonic treatment in PVC cultures for 6 h notably stimulated the expression of the ion transporter proteins (Fig. 1C). Comparatively, the catalytic subunit of Na+/K+-ATPase, {alpha}-subunit was induced threefold. The ß-subunit and NHE-1 were induced twofold, whereas NKCC increased by about 0.7 fold. Expression of Na+/K+-ATPase {alpha}- and ß-subunits was stimulated, suggesting the induction provided the subunits required for making the functional enzymes. There was no significant change in the transcript levels of the ion transporters (data not shown). However about 3.5-fold induction of Osft1 mRNA was observed at 6 h post-treatment (Fig. 1D).


Figure 2
View larger version (22K):
[in this window]
[in a new window]

 
Fig. 2. Effect of DEX on the expression of Na+/K+-ATPase, Na+/K+/2Cl cotransporter (NKCC) and Na+/H+ exchanger-1 (NHE-1) in pavement cells (PVCs) in culture. The cells were exposed to 0.5–2 µmol l–1 DEX for 24 h. (A) Cell lysates were collected for western blot analysis and (B) the amounts of the respective ion transporter proteins were quantified. Note that the three transporters were significantly induced. *P<0.05 compared with the control. The results were obtained from more than four independent experiments.

 
Effect of the hormones (DEX, prolactin, T3 and IGF-1), dbcAMP and dbcGMP on the expression of ion transporters in the primary PVC culture
DEX-exposed PVCs showed dose-dependent induction of Na+/K+-ATPase {alpha}- and ß-subunits, NKCC and NHE1 as revealed by western blotting (Fig. 2). Among those, the stimulatory effect on Na+/K+-ATPase {alpha}-subunit and NKCC were the most striking, of approximately four- to sixfold induction. The induction was found to be at the translational level as there was no significant change in the mRNA levels (data not shown).


Figure 3
View larger version (55K):
[in this window]
[in a new window]

 
Fig. 3. Effect of prolactin (PRL), thyroid hormone (T3) or insulin-like growth factor-1 (IGF-1) on the expression of Na+/K+-ATPase, Na+/K+/2Cl cotransporter (NKCC) and Na+/H+ exchanger-1 (NHE-1) in pavement cells (PVCs) in culture. The cells were exposed to the respective hormones for 24 h. Cell lysates were collected for western blot analysis (left) and the amounts of the respective ion transporter proteins were quantified (right). (A) PRL at high dose stimulated the expression of NKCC and NHE-1. (B) IGF-1 elicited a dose-dependent induction of NKCC. (C) T3 had no observable effect to the expression of the ion transporters. *P<0.05 compared with the control. The results were obtained from more than six independent experiments.

 
PRL had no effect on the protein levels of Na+/K+-ATPase {alpha}- and ß-subunits (Fig. 3A). At the higher doses (1–10 nmol l–1) of PRL, significant induction of NKCC and NHE-1 (~1.6-fold) were observed. However, the induction was significantly lower than that evoked by DEX. IGF-1 showed a dose-dependent stimulatory effect solely on NKCC (two- to fourfold) (Fig. 3B). T3 had no effect on the expression of the three ion transporters (Fig. 3C). The dbcAMP-exposed cells, showed stimulatory effect on the three ion transporters (Fig. 4). The highest induction was observed in NHE-1 expression (four- to sixfold). The induction of the other ion transporters (Na+/K+-ATPase and NKCC) were about two- to threefold. The effect of dbcGMP was not significant. Both hormonally and dbcAMP-mediated effects were found to be at the protein level as there was no significant change in their respective mRNA levels as revealed by the real-time PCR assay (data not shown).


Figure 4
View larger version (26K):
[in this window]
[in a new window]

 
Fig. 4. Effect of dibutyryl cAMP (dbcAMP) or dibutyryl cGMP (dbcGMP) on the expression of Na+/K+-ATPase, Na+/K+/2Cl cotransporter (NKCC) and Na+/H+ exchanger-1 (NHE-1) in pavement cells (PVCs) in culture. The cells were exposed to 1–4 mmol l–1 of the drugs for 24 h. (A) Cell lysates were collected for western blot analysis and (B) the amounts of the respective ion transporter proteins were quantified. Dibutyryl cAMP significantly induced the expression of the three ion transporters. The effect of dbcGMP was negligible. *P<0.05 compared with the control. The results were obtained from more than four independent experiments.

 

    Discussion
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The fish gill epithelium is a very complex transport membrane that simultaneously participates in an assortment of ion and molecule transport activities, including respiratory gases, universal osmolytes, nitrogenous wastes and water (Evans et al., 2005Go). To achieve ion homeostasis, the branchial ion transport activity is influenced by water salinities and different hormones, so that the osmolarity in the intracellular and extracellular compartments can be maintained. In the past, a considerable number of studies focused on the investigation of how gill cell functions contributed to the regulation of plasma osmolarity. However, studies on the direct osmotic challenge to the ion homeostasis of the gill epithelial cells are limited. Using isolated killifish opercular epithelia, Marshall et al. (Marshall et al., 2005Go) demonstrated that a hypotonic shock rapidly inhibited Cl secretion by chloride cells, possibly through the phosphorylation of MAPK, JNK, stress protein kinase, oxidation stress response kinase, and focal adhesion kinase. In this study, we aimed to determine the effect of osmotic hypertonicity, hormones and cellular signaling molecules on the expression of ion transporters in the cultured primary freshwater gill epithelial cells. The modulation of Na+/K+-ATPase, NKCC and NHE-1 expression levels were determined, because they are known to be the important ion transporters involved in maintaining a stable cell volume (Gilles, 1988Go; Chamberlin and Strange, 1989Go; Lang et al., 1998bGo; Lang et al., 1998aGo).

Our data demonstrated that the hypertonic treatment (500 mOsmol l–1) of the isolated PVCs induced cell shrinkage, followed by regulatory volume increase (RVI). The observation was comparable to a similar study using red blood cells obtained from rainbow trout, carp and European flounder (Brauner et al., 2002Go; Weaver et al., 1999Go). In addition, the application of the three specific blockers reduced the RVI response in the cells. Comparatively the effects of ouabain and bumetanide were more remarkable. The data indicated the participation of NHE-1, NKCC and Na+/K+-ATPase in volume regulation during hypertonic treatment. Interestingly, our data indicated that osmotic shrinkage can induce the expression of the ion transporters in PVCs. Western blot analysis of the 6 h hypertonic-treated PVCs revealed significant induction of NHE-1, NKCC and Na+/K+-ATPase {alpha} and ß subunits. As compared to the time frame (30 min) required for cell volume recovery in PVCs, the RVI could possibly be attributed to stimulation of the activities of the existing ion transporter proteins. In mammals, RVI is known to be triggered by shrinkage-activated mechanisms that stimulate the activities of Na+/H+ exchanger-1 (NHE-1), chloride/bicarbonate exchanger (Cl/HCO3) and Na+/K+/2Cl cotransporter (NKCC) (Hoffmann and Dunham, 1995Go). NHE1s from mammalian, amphibian and teleost species are highly conserved and are activated by cell shrinkage (Pedersen and Cala, 2004Go; Pedersen et al., 2003Go; Pedersen et al., 2006Go; Holt et al., 2006Go). The RVI responses in red blood cells of the European flounder was found to involve NHE-1 and Cl/HCO3 (Weaver et al., 1999Go). The importance of the cell shrinkage activation of NKCC-1 expression has been demonstrated in both mammals and the intestine of American eels (Lionetto et al., 2001Go; Russell, 2000Go). Nevertheless, RVI is possibly accompanied by the action of NHE-1 in exchanging H+ for an extracellular Na+ as well as the increase of NKCC-1 activity that mediates Cl influx. A stable intracellular [Na+] can then be maintained by the activity of the Na+/K+-ATPase (Muto et al., 2000Go). The processes lead to an increase in Na+ and Cl intake and hence restoration of the cell volume. In the present study, the stimulation of protein expression from 6 h onward may imply a long-term adaptation that allows the maintenance of cell volume during continuous exposure to the hypertonic medium. The induction of Na+/K+-ATPase expression was probably related to an increase in intracellular Na+ during RVI, since it was reported that cytosolic [Na+] can directly modulate the expression of Na+/K+-ATPase in rat kidney epithelial cells (Muto et al., 2000Go). Interestingly our data indicated that the induction of ion transporters was regulated at the translational level. Another study using gill organ culture, also demonstrated that the hypertonic-induced Na+/K+-ATPase activity was similarly regulated at the translational level (Mancera and McCormick, 2000Go). To ensure that the lack of response in the transcript levels is not due to the limitation of our real-time PCR assay, we determined the mRNA level of Osft1, which is known to response to salinity stress (Fiol et al., 2006Go; Fiol and Kultz, 2005Go). Our data indicated that the hypertonic-treated PVCs showed significant induction of Osft1 at 6 h of post treatment. This observation supports the notion that PVCs may possess osmoreceptive function which is important for cell volume regulation.

In nonshrunken, cultured gill epithelial cells that were maintained in L-15 medium (317 mOsmol l–1), we found that the stimulatory effects of DEX (an exogenous glucocorticoid) and cAMP were the most remarkable. The expression levels of the three ion transporters were significantly induced. During seawater transfer, it has been reported that there was a marked transitory increase in plasma cortisol and branchial cAMP levels (Foskett et al., 1983Go; Marshall and Singer, 2002Go; Assem and Hanke, 1981Go; Ball et al., 1971Go; Mayer et al., 1967Go). Numerous studies have demonstrated the stimulatory effect of cortisol on Na+/K+-ATPase and NKCC expressions in different fish species (Pelis and McCormick, 2001Go; Wong and Chan, 2001Go; Laiz-Carrion et al., 2003Go; Richards et al., 2003Go; Sunny and Oommen, 2001Go). A cultured gill epithelium study demonstrated a stimulatory effect of cortisol on Na+ and Cl transport (Zhou et al., 2003Go). It has been demonstrated that epinephrine (via cAMP and protein kinase A) stimulated Cl secretion by the enhancement of chloride conductance in seawater fish opercular membranes (Foskett and Scheffey, 1982Go; Foskett et al., 1983Go; Marshall and Singer, 2002Go). Taking into account the data obtained from the hypertonic stress experiments, our results indicated that DEX and cAMP may participate in gill cell volume regulation in the early phase of seawater adaptation. Although there are only limited fish data in the literature, particularly for NHE-1 regulation, a stimulatory effect by DEX was demonstrated in mammalian models (Baum et al., 1994Go; Cho et al., 1994Go; D'Andrea et al., 1996Go; D'Andrea-Winslow et al., 2001Go; Yang et al., 2001Go; Whorwood and Stewart, 1995Go). It seems that the regulation is comparable between fish and mammals.

By contrast, the effect of PRL, IGF-I, T3 and cGMP were considerably lower in this aspect. PRL is known to be important in freshwater adaptation (Evans et al., 2005Go). Its biological function is found to be associated with a reduction of ion loss rather than an increase in ion uptake. The general effect of PRL to Na+/K+-ATPase expression is still controversial (Evans et al., 2005Go; Madsen et al., 1995Go; McCormick and Bradshaw, 2006Go; Miguel et al., 2002Go). It was also interesting to note that PRL can stimulate Na+ and Cl transport in cultured gill epithelium, although it had no effect on Na+/K+-ATPase activity (Zhou et al., 2003Go). Our data provide a possible explanation, in that PRL may instead induce NHE-1 and NKCC activities to facilitate the ion transport function. Growth hormone and T3 are believed to be seawater acclimating hormones (Evans, 2002Go; Evans et al., 2005Go). Both hormones are able to induce gill Na+/K+-ATPase activities in different fish species. However, these effects were suggested to be mediated by cortisol and/or IGF-I (Madsen and Bern, 1993Go; McCormick et al., 1991Go; McCormick and Bradshaw, 2006Go). Our data indicated that T3 had no significant effects on the expression levels of the three ion transporters. IGF-1 can only induce the expression of NKCC, which agrees with the results from another study (Pelis and McCormick, 2001Go). The action of cGMP on the expression of the three ion transporters was not obvious. The use of cGMP in this study was to mimick the action of natriuretic peptide which is recognized to be important in rapid regulation of ion transport in fish (Takei and Hirose, 2002Go). Although the effects of PRL, IGF-I, T3 and cGMP on the expression of the ion transporters were not apparent, the possibility that their actions are mediated by the direct modulation of the ion transporter activities still cannot be excluded.

The present study highlighted the issue of osmotic shrinkage that may occur in fish gill epithelial cells during seawater acclimation. The direct transfer of a fish from a freshwater to a seawater environment imposes immediate osmotic stress on the gill epithelia. Recently, an osmotic stress transcription factor 1 (Ostf1) and a transcriptional factor IIB (TFIIB) were cloned from seawater-acclimating tilapia (Fiol and Kultz, 2005Go). The regulation of Ostf1 was demonstrated in both seawater-acclimating intact fish and hypertonic-treated primary gill epithelial cell culture and was reported to be important in the early phase of seawater acclimation (Fiol et al., 2006Go). Since the fish gill is one of the major osmoregulatory organs, the ability of the gill epithelial cells to recover from osmotic shrinkage/swelling is critical for fish osmoregulation. The osmotic shrinkage, which possibly causes de novo activation of Ostf1 and TFIIB in gill epithelial cells, together with the actions of seawater-acclimating hormones (i.e. cortisol, GH/IGF-I, T3, epinephrine and natriuretic peptides) could provide an integrated signal to modulate the expression of different ion transporters for the maintenance of osmotic homeostasis in the gill epithelial cells and the fish. This paper sheds light on the capability of the gill epithelial cells to trigger their own osmoreceptive function in sensing the salinity of the external environment for both cell volume regulation and osmoregulation.


    Acknowledgments
 
This work was supported by the Research Grants Council (HKBU 2171/04M), Hong Kong.


    References
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

Ando, M., Mukuda, T. and Kozaka, T. (2003). Water metabolism in the eel acclimated to sea water: from mouth to intestine. Comp. Biochem. Physiol. 136B,621 -633.[CrossRef][Medline]

Assem, H. and Hanke, W. (1981). Cortisol and osmotic adjustment of the euryhaline teleost, Sarotherodon mossambicus.Gen. Comp. Endocrinol. 43,370 -380.[CrossRef][Medline]

Ball, J. N., Jones, I. C., Forster, M. E., Hargreaves, G., Hawkins, E. F. and Milne, K. P. (1971). Measurement of plasma cortisol levels in the eel Anguilla anguilla in relation to osmotic adjustments. J. Endocrinol. 50, 75-96.[Medline]

Baum, M., Moe, O. W., Gentry, D. L. and Alpern, R. J. (1994). Effect of glucocorticoids on renal cortical NHE-3 and NHE-1 mRNA. Am. J. Physiol. 267,F437 -F442.[Medline]

Brauner, C. J., Wang, T. and Jensen, F. B. (2002). Influence of hyperosmotic shrinkage and beta-adrenergic stimulation on red blood cell volume regulation and oxygen binding properties in rainbow trout and carp. J. Comp. Physiol. B 172,251 -262.[CrossRef][Medline]

Chamberlin, M. E. and Strange, K. (1989). Anisosmotic cell volume regulation: a comparative view. Am. J. Physiol. 257,C159 -C173.[Medline]

Cho, J. H., Musch, M. W., DePaoli, A. M., Bookstein, C. M., Xie, Y., Burant, C. F., Rao, M. C. and Chang, E. B. (1994). Glucocorticoids regulate Na+/H+ exchange expression and activity in region- and tissue-specific manner. Am. J. Physiol. 267,C796 -C803.[Medline]

D'Andrea, L., Lytle, C., Matthews, J. B., Hofman, P., Forbush, B., III and Madara, J. L. (1996). Na:K:2Cl cotransporter (NKCC) of intestinal epithelial cells. Surface expression in response to cAMP. J. Biol. Chem. 271,28969 -28976.[Abstract/Free Full Text]

D'Andrea-Winslow, L., Strohmeier, G. R., Rossi, B. and Hofman, P. (2001). Identification of a sea urchin Na(+)/K(+)/2Cl(–) cotransporter (NKCC): microfilament-dependent surface expression is mediated by hypotonic shock and cyclic AMP. J. Exp. Biol. 204,147 -156.[Abstract]

Evans, D. H. (2002). Cell signaling and ion transport across the fish gill epithelium. J. Exp. Zool. 293,336 -347.[CrossRef][Medline]

Evans, D. H., Piermarini, P. M. and Choe, K. P. (2005). The multifunctional fish gill: dominant site of gas exchange, osmoregulation, acid-base regulation, and excretion of nitrogenous waste. Physiol. Rev. 85,97 -177.[Abstract/Free Full Text]

Fiol, D. F. and Kultz, D. (2005). Rapid hyperosmotic coinduction of two tilapia (Oreochromis mossambicus) transcription factors in gill cells. Proc. Natl. Acad. Sci. USA 102,927 -932.[Abstract/Free Full Text]

Fiol, D. F., Chan, S. Y. and Kultz, D. (2006). Regulation of osmotic stress transcription factor 1 (Ostf1) in tilapia (Oreochromis mossambicus) gill epithelium during salinity stress. J. Exp. Biol. 209,3257 -3265.[Abstract/Free Full Text]

Foskett, J. K. and Scheffey, C. (1982). The chloride cell: definitive identification as the salt-secretory cell in teleosts. Science 215,164 -166.[Abstract/Free Full Text]

Foskett, J. K., Bern, H. A., Machen, T. E. and Conner, M. (1983). Chloride cells and the hormonal control of teleost fish osmoregulation. J. Exp. Biol. 106,255 -281.[Abstract/Free Full Text]

Gilles, R. (1988). Comparative aspects of cell osmoregulation and volume control. Ren. Physiol. Biochem. 11,277 -288.[Medline]

Hoffmann, E. K. and Dunham, P. B. (1995). Membrane mechanisms and intracellular signalling in cell volume regulation. Int. Rev. Cytol. 161,173 -262.[Medline]

Holt, M. E., King, S. A., Cala, P. M. and Pedersen, S. F. (2006). Regulation of the Pleuronectes americanus Na+/H+ exchanger by osmotic shrinkage, beta-adrenergic stimuli, and inhibition of Ser/Thr protein phosphatases. Cell Biochem. Biophys. 45,1 -18.[CrossRef][Medline]

Kelly, S. P. and Wood, C. M. (2001a). Effect of cortisol on the physiology of cultured pavement cell epithelia from freshwater trout gills. Am. J. Physiol. 281,R811 -R820.

Kelly, S. P. and Wood, C. M. (2001b). The cultured branchial epithelium of the rainbow trout as a model for diffusive fluxes of ammonia across the fish gill. J. Exp. Biol. 204,4115 -4124.[Abstract/Free Full Text]

Kelly, S. P. and Wood, C. M. (2001c). The physiological effects of 3,5',3'-triiodo-L-thyronine alone or combined with cortisol on cultured pavement cell epithelia from freshwater rainbow trout gills. Gen. Comp. Endocrinol. 123,280 -294.[CrossRef][Medline]

Kelly, S. P. and Wood, C. M. (2002a). Cultured gill epithelia from freshwater tilapia (Oreochromis niloticus): effect of cortisol and homologous serum supplements from stressed and unstressed fish. J. Membr. Biol. 190, 29-42.[CrossRef][Medline]

Kelly, S. P. and Wood, C. M. (2002b). Prolactin effects on cultured pavement cell epithelia and pavement cell plus mitochondria-rich cell epithelia from freshwater rainbow trout gills. Gen. Comp. Endocrinol. 128, 44-56.[CrossRef][Medline]

Kelly, S. P. and Wood, C. M. (2003). Dilute culture media as an environmental or physiological simulant in cultured gill epithelia from freshwater rainbow trout. In Vitro Cell. Dev. Biol. Anim. 39,21 -28.

Kelly, S. P., Fletcher, M., Part, P. and Wood, C. M. (2000). Procedures for the preparation and culture of `reconstructed' rainbow trout branchial epithelia. Methods Cell Sci. 22,153 -163.[CrossRef][Medline]

Laiz-Carrion, R., Martin del Rio, M. P., Miguez, J. M., Mancera, J. M. and Soengas, J. L. (2003). Influence of cortisol on osmoregulation and energy metabolism in gilthead seabream Sparus aurata.J. Exp. Zoolog. Part A Comp. Exp. Biol. 298,105 -118.[Medline]

Lang, F., Busch, G. L., Ritter, M., Volkl, H., Waldegger, S., Gulbins, E. and Haussinger, D. (1998a). Functional significance of cell volume regulatory mechanisms. Physiol. Rev. 78,247 -306.[Abstract/Free Full Text]

Lang, F., Busch, G. L. and Volkl, H. (1998b). The diversity of volume regulatory mechanisms. Cell. Physiol. Biochem. 8,1 -45.[Medline]

Lionetto, M. G., Giordona, M. E., Nicolardi, G. and Schettino, T. (2001). Hypertonicity stimulates Cl(–) transport in the intestine of fresh water acclimated eel, Anguilla anguilla.Cell. Physiol. Biochem. 11,41 -54.[Medline]

Madsen, S. S. and Bern, H. A. (1993). In-vitro effects of insulin-like growth factor-I on gill Na+,K(+)-ATPase in coho salmon, Oncorhynchus kisutch. J. Endocrinol. 138,23 -30.[Abstract]

Madsen, S. S., Jensen, M. K., Nhr, J. and Kristiansen, K. (1995). Expression of Na(+)-K(+)-ATPase in the brown trout, Salmo trutta: in vivo modulation by hormones and seawater. Am. J. Physiol. 269,R1339 -R1345.[Medline]

Mancera, J. M. and McCormick, S. D. (2000). Rapid activation of gill Na(+),K(+)-ATPase in the euryhaline teleost Fundulus heteroclitus. J. Exp. Zool. 287,263 -274.[CrossRef][Medline]

Marshall, W. S. and Singer, T. D. (2002). Cystic fibrosis transmembrane conductance regulator in teleost fish. Biochim. Biophys. Acta 1566,16 -27.[Medline]

Marshall, W. S., Ossum, C. G. and Hoffmann, E. K. (2005). Hypotonic shock mediation by p38 MAPK, JNK, PKC, FAK, OSR1 and SPAK in osmosensing chloride secreting cells of killifish opercular epithelium. J. Exp. Biol. 208,1063 -1077.[Abstract/Free Full Text]

Mayer, N., Maetz, J., Chan, D. K., Forster, M. and Jones, I. C. (1967). Cortisol, a sodium excreting factor in the eel (Anguilla anguilla L.) adapted to sea water. Nature 214,1118 -1120.[CrossRef][Medline]

McCormick, S. D. and Bradshaw, D. (2006). Hormonal control of salt and water balance in vertebrates. Gen. Comp. Endocrinol. 147,3 -8.[CrossRef][Medline]

McCormick, S. D., Sakamoto, T., Hasegawa, S. and Hirano, T. (1991). Osmoregulatory actions of insulin-like growth factor-I in rainbow trout (Oncorhynchus mykiss). J. Endocrinol. 130,87 -92.[Abstract]

Miguel, M. J., Laiz, C. R. and del Pilar Martin del Rio, M. (2002). Osmoregulatory action of PRL, GH, and cortisol in the gilthead seabream (Sparus aurata L). Gen. Comp. Endocrinol. 129,95 -103.[CrossRef][Medline]

Muto, S., Nemoto, J., Okada, K., Miyata, Y., Kawakami, K., Saito, T. and Asano, Y. (2000). Intracellular Na+ directly modulates Na+,K+-ATPase gene expression in normal rat kidney epithelial cells. Kidney Int. 57,1617 -1635.[CrossRef][Medline]

O'Donnell, M. J., Kelly, S. P., Nurse, C. A. and Wood, C. M. (2001). A maxi Cl channel in cultured pavement cells from the gills of the freshwater rainbow trout Oncorhynchus mykiss.J. Exp. Biol. 204,1783 -1794.[Abstract]

Pedersen, S. F. and Cala, P. M. (2004). Comparative biology of the ubiquitous Na+/H+ exchanger, NHE1: lessons from erythrocytes. J. Exp. Zool. A Comp. Exp. Biol. 301,569 -578.

Pedersen, S. F., King, S. A., Rigor, R. R., Zhuang, Z., Warren, J. M. and Cala, P. M. (2003). Molecular cloning of NHE1 from winter flounder RBCs: activation by osmotic shrinkage, cAMP, and calyculin A. Am. J. Physiol. 284,C1561 -C1576.

Pedersen, S. F., O'Donnell, M. E., Anderson, S. E. and Cala, P. M. (2006). Physiology and pathophysiology of Na+/H+ exchange and Na+-K+-2Cl cotransport in the heart, brain, and blood. Am. J. Physiol. 291,R1 -R25.[CrossRef]

Pelis, R. M. and McCormick, S. D. (2001). Effects of growth hormone and cortisol on Na(+)-K(+)-2Cl(–) cotransporter localization and abundance in the gills of Atlantic salmon. Gen. Comp. Endocrinol. 124,134 -143.[CrossRef][Medline]

Perry, S. F. (1997). The chloride cell: structure and function in the gills of freshwater fishes. Annu. Rev. Physiol. 59,325 -347.[CrossRef][Medline]

Richards, J. G., Semple, J. W., Bystriansky, J. S. and Schulte, P. M. (2003). Na+/K+-ATPase alpha-isoform switching in gills of rainbow trout (Oncorhynchus mykiss) during salinity transfer. J. Exp. Biol. 206,4475 -4486.[Abstract/Free Full Text]

Russell, J. M. (2000). Sodium-potassium-chloride cotransport. Physiol. Rev. 80,211 -276.[Abstract/Free Full Text]

Sunny, F. and Oommen, O. V. (2001). Rapid action of glucocorticoids on branchial ATPase activity in Oreochromis mossambicus: an in vivo and in vitro study. Comp. Biochem. Physiol. 130B,323 -330.[CrossRef][Medline]

Takei, Y. and Hirose, S. (2002). The natriuretic peptide system in eels: a key endocrine system for euryhalinity? Am. J. Physiol. 282,R940 -R951.

Tse, W. K., Au, D. W. and Wong, C. K. (2006). Characterization of ion channel and transporter mRNA expressions in isolated gill chloride and pavement cells of seawater acclimating eels. Biochem. Biophys. Res. Commun. 346,1181 -1190.[CrossRef][Medline]

Weaver, Y. R., Kiessling, K. and Cossins, A. R. (1999). Responses of the Na+/H+ exchanger of european flounder red blood cells to hypertonic, ß-adrenergic and acidotic stimuli. J. Exp. Biol. 202, 21-32.[Abstract]

Whorwood, C. B. and Stewart, P. M. (1995). Transcriptional regulation of Na/K-ATPase by corticosteroids, glycyrrhetinic acid and second messenger pathways in rat kidney epithelial cells. J. Mol. Endocrinol. 15,93 -103.[Abstract]

Wong, C. K. and Chan, D. K. (1999a). Chloride cell subtypes in the gill epithelium of Japanese eel Anguilla japonica.Am. J. Physiol. 277,R517 -R522.[Medline]

Wong, C. K. and Chan, D. K. (1999b). Isolation of viable cell types from the gill epithelium of Japanese eel Anguilla japonica. Am. J. Physiol. 276,R363 -R372.[Medline]

Wong, C. K. and Chan, D. K. (2001). Effects of cortisol on chloride cells in the gill epithelium of Japanese eel, Anguilla japonica. J. Endocrinol. 168,185 -192.[Abstract]

Wood, C. M., Kelly, S. P., Zhou, B., Fletcher, M., O'Donnell, M., Eletti, B. and Part, P. (2002). Cultured gill epithelia as models for the freshwater fish gill. Biochim. Biophys. Acta 1566,72 -83.[Medline]

Yang, H., Wang, Z., Miyamoto, Y. and Reinach, P. S. (2001). Cell signaling pathways mediating epidermal growth factor stimulation of Na:K:2Cl cotransport activity in rabbit corneal epithelial cells. J. Membr. Biol. 183,93 -101.[CrossRef][Medline]

Zhou, B., Kelly, S. P., Ianowski, J. P. and Wood, C. M. (2003). Effects of cortisol and prolactin on Na+ and Cl transport in cultured branchial epithelia from FW rainbow trout. Am. J. Physiol. 285,R1305 -R1316.

Zhou, B., Kelly, S. P. and Wood, C. M. (2004). Response of developing cultured freshwater gill epithelia to gradual apical media dilution and hormone supplementation. J. Exp. Zool. A Comp. Exp. Biol. 301,867 -881.[Medline]




This article has been cited by other articles:


Home page
J. Exp. Biol.Home page
W. K. F. Tse, S. C. Chow, and C. K. C. Wong
The cloning of eel osmotic stress transcription factor and the regulation of its expression in primary gill cell culture
J. Exp. Biol., June 15, 2008; 211(12): 1964 - 1968.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tse, W. K. F.
Right arrow Articles by Wong, C. K. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tse, W. K. F.
Right arrow Articles by Wong, C. K. C.