|
| ![]() |
|
||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online June 11, 2007
Journal of Experimental Biology 210, 2113-2120 (2007)
Published by The Company of Biologists 2007
doi: 10.1242/jeb.004101
Effect of osmotic shrinkage and hormones on the expression of Na+/H+ exchanger-1, Na+/K+/2Cl cotransporter and Na+/K+-ATPase in gill pavement cells of freshwater adapted Japanese eel, Anguilla japonica
1 Department of Biology, Hong Kong Baptist University, Kowloon Tong, Hong
Kong
2 Departments of Biology and Chemistry, City University of Hong Kong, Hong
Kong
* Author for correspondence (e-mail: ckcwong{at}hkbu.edu.hk)
Accepted 4 April 2007
| Summary |
|---|
|
|
|---|
and ß subunits of
Na+/K+-ATPase. In nonshrunken cultured PVCs, we found
that dexamethasone and dibutyryl cAMP treatments significantly stimulated the
expression levels of the three ion transporters. Both prolactin and
insulin-like growth factor-1, can only induce the expression of NKCC. The
effect of thyroid hormone (T3) and dibutyryl cGMP was negligible.
In this study, the induction of ion transporter expression was found to be
post-transcriptionally regulated as no significant change in mRNA levels was
detected. This observation implies that the regulation is rapid and is
probably induced via nongenomic actions.
Key words: dexamethasone, hypertonic stress, dibutyryl cAMP, regulatory volume increase
| Introduction |
|---|
|
|
|---|
Cell volume regulation is a fundamental and highly conserved cellular
process found in most cells (Chamberlin and
Strange, 1989
; Lang et al.,
1998b
; Lang et al.,
1998a
). It is particularly important in euryhaline fish as they
may require a rapid and effective mechanism to respond to the changing water
salinity. The capability of gill epithelial cells to maintain a constant
intracellular osmotic conditions is critical for normal cell functioning. As
the gill is one of the major osmoregulatory organs in fish, the ability of the
gill epithelial cells to recover from osmotic shrinkage/swelling, may relate
to fish euryhalinity.
In vertebrates, hormones and growth factors play a critical role in cell
volume regulation (Hoffmann and Dunham,
1995
; Pedersen et al.,
2006
). In teleost fish, a number of key hormones have been
identified as essential for euryhalinity and osmotic adaptability. The
osmoregulatory hormones can be classified into two groups: (i) fast-acting
hormones (i.e. natriuretic peptides and epinephrine, which are mediated by the
action of cGMP and cAMP, respectively), and (ii) slow-acting hormones (i.e.
cortisol, growth hormone/insulin-like growth factors and prolactin)
(McCormick and Bradshaw,
2006
). A considerable number of studies has demonstrated the
biological effects of these hormones on gill functions, including the
expression/distribution/activities of ion transporters and the
proliferation/differentiation of chloride cells
(Evans, 2002
;
Evans et al., 2005
;
Perry, 1997
;
Tse et al., 2006
;
Wong and Chan, 1999a
;
Wong and Chan, 1999b
). Despite
this body of evidence, however, because of the anatomical complexities of the
gill epithelium, it is difficult to elucidate the direct hormonal effect as
well as the immediate biological responses of the gill epithelial cells, using
an in vivo approach.
Gill epithelial culture has been established in freshwater trout for the
study of unidirectional ion fluxes and for the characterization of ion
transporter properties (Kelly et al.,
2000
; Kelly and Wood,
2001c
; Kelly and Wood,
2001a
; Kelly and Wood,
2001b
; Kelly and Wood,
2002a
; Kelly and Wood,
2002b
; Kelly and Wood,
2003
; O'Donnell et al.,
2001
; Wood et al.,
2002
; Zhou et al.,
2003
; Zhou et al.,
2004
). A gill cell culture model from other fish species including
salmon and eel, however, has not yet been established. In this study, we aimed
to investigate the effects of hypertonic stress on the cellular responses of
freshwater gill epithelial cells. Using purified pavement cells (PVCs), we
demonstrated the effect of osmotic shrinkage on cell regulatory volume
increase (RVI) as well as the expressions of the three important ion
transporters: Na+/K+-ATPase,
Na+/K+/2Cl cotransporter (NKCC),
Na+/H+ exchanger-1 (NHE-1) in the cells. The involvement
of the three ion transporters in RVI was demonstrated using three specific
blockers [i.e. ouabain, bumetanide and
5-(N-ethyl-N-isopropyl)amiloride (EIPA)]. In addition, we
established the primary epithelial gill culture from freshwater-adapted eels.
Using the cultured cells, we measured and compared the direct effects of
dexamethasone (DEX), prolactin (PRL), thyroid hormone (T3),
insulin-like growth factor-1 (IGF-1), dibutyryl cAMP (dbcAMP) and dibutyryl
cGMP (cGMP) to the expressions of the ion transporters.
| Materials and methods |
|---|
|
|
|---|
The cells were maintained in the medium for 1 h at room temperature before cell sizing and counting. Thereafter the cells were either resuspended in a normal (317 mOsmol l1) or modified (500 mOsmol l1, adjusted with 5 mol l1 NaCl) Leibovitz's L-15 medium. Blockers for three ion transporters [1 mmol l1 ouabain, 100 µmol l1 bumetanide or 100 µmol l1 5-(N-ethyl-N-isopropyl)amiloride (EIPA); Sigma] were added to the cells before the application of hyperosmotic stress. The medium osmolarity was determined using a vapour pressure osmometer (Wescor, 5500XR, Logan, UT, USA). The two groups of cells were counted and sized using a Coulter Multisizer II [with an orifice tube of 70 µm diameter and Isoton II (Beckamn, Coulter, Miami, FL, USA) as electrolyte] in every 510 min interval for 60 min. The cell count signal was the change of conductance of the electrolyte induced by particle resistance. Isoton II was used as the blank and calibration was carried out with monodiameter particles (P.D.V.B. latex 5.06 µm, Beckman Coulter). An aperture coincidence correction was below 2%.
Primary culture of freshwater gill epithelial cells
The cell suspension obtain from trypsin digestion was filtered and washed.
The cells were then seeded at a density of 5x106 cells
cm1 onto collagen-coated culture plate. The cells were
incubated at 22°C in a growth chamber with a humidified air atmosphere.
One day after seeding, the plate was rinsed to remove mucous cells. Gill
epithelial cells cultured for 1 day were then exposed to either hypertonic
stress or drug treatments. In preliminary studies, we conducted time-course
experiments to investigate the effects of the treatments on the expression of
the ion transporters. The cultured cells were incubated in the different
conditions for varying periods of time (1, 2, 6, 12 and 24 h). A significant
induction of the ion transporter protein was observed after 6 h of hypertonic
treatment and only after 24 h of hormonal or cell signaling molecule
treatment. No induction of the ion-transporter mRNA was observed. Hence we
selected the 6 h treatment for the hypertonic stress (500 mOsmol
l1) but 24 h exposure to each of the following drug
treatments: (a) 0.52 µmol l1 dexamethasone (DEX;
Calbiochem, Darmstadt, Germany), (b) 0.110 nmol l1
prolactin (PRL; Calbiochem), (c) 0.110 nmol l1
insulin-like growth factor-1 (IGF-1; Sigma), (d) 0.050.2 µmol
l1 thyroid hormone (T3), (e) 14 mmol
l1 dibutyryl cGMP (cGMP) or (f) 14 mmol
l1 dibutyryl cAMP (dbcAMP; Calbiochem). For real-time PCR
analysis, the isolated gill epithelial cells were dissolved in Trizol Reagent
(Gibco-BRL) for total RNA extraction. For western blots, the samples were
resuspended in cold lysis buffer containing 250 mmol l1
TrisHCl, pH 8.0, 1% NP-40 and 150 mmol l1 NaCl and
were assayed for protein concentration (DC Protein Assay Kit II, Bio-Rad
Pacific Ltd, Hercules, CA, USA).
|
-subunit (X76108: TCTGATGTCTCCAAGCA GGC forward, CTGGTCAGGGTGTAGGC
reverse) and ß233-subunits (AJ239317: ATGTCAGGAAATAA AGACAGT
forward, TGCGTGGGTTTGTAGTTGCTCA reverse),
Na+/K+/2Cl co-transporter-1 (NKCC-1;
AJ486858: CCCATCATCTCCAACTTCTTCCT forward, CCCACCAGTTGATGACGAACA reverse),
Na+/H+ exchanger-1 (NHE-1, AJ006917:
CGCTTCTCGTCTTCGTCTACAG forward, CATGTTGGCCTCCACGTATGG reverse), and actin
(CTGGTATCGTGATGGACTCT forward, AGCTCA TAG CTCTTCTCCAG reverse) have been
tested in our previous study (Tse et al.,
2006
Western blot analysis
Samples were subjected to electrophoresis in 10% polyacrylamide gels. The
gels were then blotted onto PVDF membranes (PerkinElmer Life Sciences, Boston,
MA, USA). Western blot was conducted using mouse antibodies against
Na+/K+-ATPase
(
5; 1:100), ß-subunits
(ß4B4; 1:100), NKCC (T4; 1:100; Developmental Studies Hybridoma Bank,
University of Iowa) and NHE-1 (1:1000; Chemicon Int., Temecula, CA, USA),
followed by incubation with (1:4000) horseradish peroxidase-conjugated goat
anti-mouse antibody. Specific bands were visualized using chemiluminescent
reagent (Western-lightening Plus, PerkinElmer Life Sciences). The blots were
then washed in phosphate-buffered saline (PBS) and re-probed with (1:100)
mouse anti-actin serum (JLA20, Developmental Studies Hybridoma Bank, the
University of Iowa, IA, USA). Images of the blots were digitally captured by a
gel documentation system (UVP). The optical density of each band was
quantified using image analyzing software (Metamorph, Universal Imaging
Corp.). The data were then normalized using the expression levels of
actin.
Statistical analysis
All data are represented as means ± s.e.m. Statistical significance
was tested using Student's t-test. Groups were considered
significantly different if P<0.05.
| Results |
|---|
|
|
|---|
Primary freshwater gill epithelial cell culture was established
(Fig. 1B). Over 80% of gill
epithelial cells attached after overnight incubation. In the culture, the
percentage of chloride cells was very low (about 1%). The major of the cell
population was found to be the PVCs. Using the cell culture model, we tested
the effect of hypertonic stress and hormones/cell signaling molecules on the
expression levels of the three ion transporters (i.e. NHE-1, NKCC,
and
ß subunits of Na+/K+-ATPase). Our data indicated
that hypertonic treatment in PVC cultures for 6 h notably stimulated the
expression of the ion transporter proteins
(Fig. 1C). Comparatively, the
catalytic subunit of Na+/K+-ATPase,
-subunit was
induced threefold. The ß-subunit and NHE-1 were induced twofold, whereas
NKCC increased by about 0.7 fold. Expression of
Na+/K+-ATPase
- and ß-subunits was
stimulated, suggesting the induction provided the subunits required for making
the functional enzymes. There was no significant change in the transcript
levels of the ion transporters (data not shown). However about 3.5-fold
induction of Osft1 mRNA was observed at 6 h post-treatment
(Fig. 1D).
|
- and ß-subunits, NKCC and
NHE1 as revealed by western blotting (Fig.
2). Among those, the stimulatory effect on
Na+/K+-ATPase
-subunit and NKCC were the most
striking, of approximately four- to sixfold induction. The induction was found
to be at the translational level as there was no significant change in the
mRNA levels (data not shown).
|
- and ß-subunits
(Fig. 3A). At the higher doses
(110 nmol l1) of PRL, significant induction of NKCC
and NHE-1 (
1.6-fold) were observed. However, the induction was
significantly lower than that evoked by DEX. IGF-1 showed a dose-dependent
stimulatory effect solely on NKCC (two- to fourfold)
(Fig. 3B). T3 had no
effect on the expression of the three ion transporters
(Fig. 3C). The dbcAMP-exposed
cells, showed stimulatory effect on the three ion transporters
(Fig. 4). The highest induction
was observed in NHE-1 expression (four- to sixfold). The induction of the
other ion transporters (Na+/K+-ATPase and NKCC) were
about two- to threefold. The effect of dbcGMP was not significant. Both
hormonally and dbcAMP-mediated effects were found to be at the protein level
as there was no significant change in their respective mRNA levels as revealed
by the real-time PCR assay (data not shown).
|
| Discussion |
|---|
|
|
|---|
Our data demonstrated that the hypertonic treatment (500 mOsmol
l1) of the isolated PVCs induced cell shrinkage, followed by
regulatory volume increase (RVI). The observation was comparable to a similar
study using red blood cells obtained from rainbow trout, carp and European
flounder (Brauner et al., 2002
;
Weaver et al., 1999
). In
addition, the application of the three specific blockers reduced the RVI
response in the cells. Comparatively the effects of ouabain and bumetanide
were more remarkable. The data indicated the participation of NHE-1, NKCC and
Na+/K+-ATPase in volume regulation during hypertonic
treatment. Interestingly, our data indicated that osmotic shrinkage can induce
the expression of the ion transporters in PVCs. Western blot analysis of the 6
h hypertonic-treated PVCs revealed significant induction of NHE-1, NKCC and
Na+/K+-ATPase
and ß subunits. As compared
to the time frame (30 min) required for cell volume recovery in PVCs, the RVI
could possibly be attributed to stimulation of the activities of the existing
ion transporter proteins. In mammals, RVI is known to be triggered by
shrinkage-activated mechanisms that stimulate the activities of
Na+/H+ exchanger-1 (NHE-1), chloride/bicarbonate
exchanger (Cl/HCO3) and
Na+/K+/2Cl cotransporter (NKCC)
(Hoffmann and Dunham, 1995
).
NHE1s from mammalian, amphibian and teleost species are highly conserved and
are activated by cell shrinkage (Pedersen
and Cala, 2004
; Pedersen et
al., 2003
; Pedersen et al.,
2006
; Holt et al.,
2006
). The RVI responses in red blood cells of the European
flounder was found to involve NHE-1 and Cl/HCO3
(Weaver et al., 1999
). The
importance of the cell shrinkage activation of NKCC-1 expression has been
demonstrated in both mammals and the intestine of American eels
(Lionetto et al., 2001
;
Russell, 2000
). Nevertheless,
RVI is possibly accompanied by the action of NHE-1 in exchanging H+
for an extracellular Na+ as well as the increase of NKCC-1 activity
that mediates Cl influx. A stable intracellular
[Na+] can then be maintained by the activity of the
Na+/K+-ATPase (Muto
et al., 2000
). The processes lead to an increase in Na+
and Cl intake and hence restoration of the cell volume. In
the present study, the stimulation of protein expression from 6 h onward may
imply a long-term adaptation that allows the maintenance of cell volume during
continuous exposure to the hypertonic medium. The induction of
Na+/K+-ATPase expression was probably related to an
increase in intracellular Na+ during RVI, since it was reported
that cytosolic [Na+] can directly modulate the expression of
Na+/K+-ATPase in rat kidney epithelial cells
(Muto et al., 2000
).
Interestingly our data indicated that the induction of ion transporters was
regulated at the translational level. Another study using gill organ culture,
also demonstrated that the hypertonic-induced
Na+/K+-ATPase activity was similarly regulated at the
translational level (Mancera and
McCormick, 2000
). To ensure that the lack of response in the
transcript levels is not due to the limitation of our real-time PCR assay, we
determined the mRNA level of Osft1, which is known to response to salinity
stress (Fiol et al., 2006
;
Fiol and Kultz, 2005
). Our
data indicated that the hypertonic-treated PVCs showed significant induction
of Osft1 at 6 h of post treatment. This observation supports the notion that
PVCs may possess osmoreceptive function which is important for cell volume
regulation.
In nonshrunken, cultured gill epithelial cells that were maintained in L-15
medium (317 mOsmol l1), we found that the stimulatory
effects of DEX (an exogenous glucocorticoid) and cAMP were the most
remarkable. The expression levels of the three ion transporters were
significantly induced. During seawater transfer, it has been reported that
there was a marked transitory increase in plasma cortisol and branchial cAMP
levels (Foskett et al., 1983
;
Marshall and Singer, 2002
;
Assem and Hanke, 1981
;
Ball et al., 1971
;
Mayer et al., 1967
). Numerous
studies have demonstrated the stimulatory effect of cortisol on
Na+/K+-ATPase and NKCC expressions in different fish
species (Pelis and McCormick,
2001
; Wong and Chan,
2001
; Laiz-Carrion et al.,
2003
; Richards et al.,
2003
; Sunny and Oommen,
2001
). A cultured gill epithelium study demonstrated a stimulatory
effect of cortisol on Na+ and Cl transport
(Zhou et al., 2003
). It has
been demonstrated that epinephrine (via cAMP and protein kinase A)
stimulated Cl secretion by the enhancement of chloride
conductance in seawater fish opercular membranes
(Foskett and Scheffey, 1982
;
Foskett et al., 1983
;
Marshall and Singer, 2002
).
Taking into account the data obtained from the hypertonic stress experiments,
our results indicated that DEX and cAMP may participate in gill cell volume
regulation in the early phase of seawater adaptation. Although there are only
limited fish data in the literature, particularly for NHE-1 regulation, a
stimulatory effect by DEX was demonstrated in mammalian models
(Baum et al., 1994
;
Cho et al., 1994
;
D'Andrea et al., 1996
;
D'Andrea-Winslow et al., 2001
;
Yang et al., 2001
;
Whorwood and Stewart, 1995
).
It seems that the regulation is comparable between fish and mammals.
By contrast, the effect of PRL, IGF-I, T3 and cGMP were
considerably lower in this aspect. PRL is known to be important in freshwater
adaptation (Evans et al.,
2005
). Its biological function is found to be associated with a
reduction of ion loss rather than an increase in ion uptake. The general
effect of PRL to Na+/K+-ATPase expression is still
controversial (Evans et al.,
2005
; Madsen et al.,
1995
; McCormick and Bradshaw,
2006
; Miguel et al.,
2002
). It was also interesting to note that PRL can stimulate
Na+ and Cl transport in cultured gill epithelium,
although it had no effect on Na+/K+-ATPase activity
(Zhou et al., 2003
). Our data
provide a possible explanation, in that PRL may instead induce NHE-1 and NKCC
activities to facilitate the ion transport function. Growth hormone and
T3 are believed to be seawater acclimating hormones
(Evans, 2002
;
Evans et al., 2005
). Both
hormones are able to induce gill Na+/K+-ATPase
activities in different fish species. However, these effects were suggested to
be mediated by cortisol and/or IGF-I
(Madsen and Bern, 1993
;
McCormick et al., 1991
;
McCormick and Bradshaw, 2006
).
Our data indicated that T3 had no significant effects on the
expression levels of the three ion transporters. IGF-1 can only induce the
expression of NKCC, which agrees with the results from another study
(Pelis and McCormick, 2001
).
The action of cGMP on the expression of the three ion transporters was not
obvious. The use of cGMP in this study was to mimick the action of natriuretic
peptide which is recognized to be important in rapid regulation of ion
transport in fish (Takei and Hirose,
2002
). Although the effects of PRL, IGF-I, T3 and cGMP
on the expression of the ion transporters were not apparent, the possibility
that their actions are mediated by the direct modulation of the ion
transporter activities still cannot be excluded.
The present study highlighted the issue of osmotic shrinkage that may occur
in fish gill epithelial cells during seawater acclimation. The direct transfer
of a fish from a freshwater to a seawater environment imposes immediate
osmotic stress on the gill epithelia. Recently, an osmotic stress
transcription factor 1 (Ostf1) and a transcriptional factor IIB (TFIIB) were
cloned from seawater-acclimating tilapia
(Fiol and Kultz, 2005
). The
regulation of Ostf1 was demonstrated in both seawater-acclimating intact fish
and hypertonic-treated primary gill epithelial cell culture and was reported
to be important in the early phase of seawater acclimation
(Fiol et al., 2006
). Since the
fish gill is one of the major osmoregulatory organs, the ability of the gill
epithelial cells to recover from osmotic shrinkage/swelling is critical for
fish osmoregulation. The osmotic shrinkage, which possibly causes de
novo activation of Ostf1 and TFIIB in gill epithelial cells, together
with the actions of seawater-acclimating hormones (i.e. cortisol, GH/IGF-I,
T3, epinephrine and natriuretic peptides) could provide an
integrated signal to modulate the expression of different ion transporters for
the maintenance of osmotic homeostasis in the gill epithelial cells and the
fish. This paper sheds light on the capability of the gill epithelial cells to
trigger their own osmoreceptive function in sensing the salinity of the
external environment for both cell volume regulation and osmoregulation.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Ando, M., Mukuda, T. and Kozaka, T. (2003). Water metabolism in the eel acclimated to sea water: from mouth to intestine. Comp. Biochem. Physiol. 136B,621 -633.[CrossRef][Medline]
Assem, H. and Hanke, W. (1981). Cortisol and osmotic adjustment of the euryhaline teleost, Sarotherodon mossambicus.Gen. Comp. Endocrinol. 43,370 -380.[CrossRef][Medline]
Ball, J. N., Jones, I. C., Forster, M. E., Hargreaves, G.,
Hawkins, E. F. and Milne, K. P. (1971). Measurement of plasma
cortisol levels in the eel Anguilla anguilla in relation to osmotic
adjustments. J. Endocrinol.
50, 75-96.
Baum, M., Moe, O. W., Gentry, D. L. and Alpern, R. J. (1994). Effect of glucocorticoids on renal cortical NHE-3 and NHE-1 mRNA. Am. J. Physiol. 267,F437 -F442.[Medline]
Brauner, C. J., Wang, T. and Jensen, F. B. (2002). Influence of hyperosmotic shrinkage and beta-adrenergic stimulation on red blood cell volume regulation and oxygen binding properties in rainbow trout and carp. J. Comp. Physiol. B 172,251 -262.[CrossRef][Medline]
Chamberlin, M. E. and Strange, K. (1989). Anisosmotic cell volume regulation: a comparative view. Am. J. Physiol. 257,C159 -C173.[Medline]
Cho, J. H., Musch, M. W., DePaoli, A. M., Bookstein, C. M., Xie, Y., Burant, C. F., Rao, M. C. and Chang, E. B. (1994). Glucocorticoids regulate Na+/H+ exchange expression and activity in region- and tissue-specific manner. Am. J. Physiol. 267,C796 -C803.[Medline]
D'Andrea, L., Lytle, C., Matthews, J. B., Hofman, P., Forbush,
B., III and Madara, J. L. (1996). Na:K:2Cl cotransporter
(NKCC) of intestinal epithelial cells. Surface expression in response to cAMP.
J. Biol. Chem. 271,28969
-28976.
D'Andrea-Winslow, L., Strohmeier, G. R., Rossi, B. and Hofman, P. (2001). Identification of a sea urchin Na(+)/K(+)/2Cl() cotransporter (NKCC): microfilament-dependent surface expression is mediated by hypotonic shock and cyclic AMP. J. Exp. Biol. 204,147 -156.[Abstract]
Evans, D. H. (2002). Cell signaling and ion transport across the fish gill epithelium. J. Exp. Zool. 293,336 -347.[CrossRef][Medline]
Evans, D. H., Piermarini, P. M. and Choe, K. P.
(2005). The multifunctional fish gill: dominant site of gas
exchange, osmoregulation, acid-base regulation, and excretion of nitrogenous
waste. Physiol. Rev. 85,97
-177.
Fiol, D. F. and Kultz, D. (2005). Rapid
hyperosmotic coinduction of two tilapia (Oreochromis mossambicus)
transcription factors in gill cells. Proc. Natl. Acad. Sci.
USA 102,927
-932.
Fiol, D. F., Chan, S. Y. and Kultz, D. (2006).
Regulation of osmotic stress transcription factor 1 (Ostf1) in tilapia
(Oreochromis mossambicus) gill epithelium during salinity stress.
J. Exp. Biol. 209,3257
-3265.
Foskett, J. K. and Scheffey, C. (1982). The
chloride cell: definitive identification as the salt-secretory cell in
teleosts. Science 215,164
-166.
Foskett, J. K., Bern, H. A., Machen, T. E. and Conner, M.
(1983). Chloride cells and the hormonal control of teleost fish
osmoregulation. J. Exp. Biol.
106,255
-281.
Gilles, R. (1988). Comparative aspects of cell osmoregulation and volume control. Ren. Physiol. Biochem. 11,277 -288.[Medline]
Hoffmann, E. K. and Dunham, P. B. (1995). Membrane mechanisms and intracellular signalling in cell volume regulation. Int. Rev. Cytol. 161,173 -262.[Medline]
Holt, M. E., King, S. A., Cala, P. M. and Pedersen, S. F. (2006). Regulation of the Pleuronectes americanus Na+/H+ exchanger by osmotic shrinkage, beta-adrenergic stimuli, and inhibition of Ser/Thr protein phosphatases. Cell Biochem. Biophys. 45,1 -18.[CrossRef][Medline]
Kelly, S. P. and Wood, C. M. (2001a). Effect of cortisol on the physiology of cultured pavement cell epithelia from freshwater trout gills. Am. J. Physiol. 281,R811 -R820.
Kelly, S. P. and Wood, C. M. (2001b). The
cultured branchial epithelium of the rainbow trout as a model for diffusive
fluxes of ammonia across the fish gill. J. Exp. Biol.
204,4115
-4124.
Kelly, S. P. and Wood, C. M. (2001c). The physiological effects of 3,5',3'-triiodo-L-thyronine alone or combined with cortisol on cultured pavement cell epithelia from freshwater rainbow trout gills. Gen. Comp. Endocrinol. 123,280 -294.[CrossRef][Medline]
Kelly, S. P. and Wood, C. M. (2002a). Cultured gill epithelia from freshwater tilapia (Oreochromis niloticus): effect of cortisol and homologous serum supplements from stressed and unstressed fish. J. Membr. Biol. 190, 29-42.[CrossRef][Medline]
Kelly, S. P. and Wood, C. M. (2002b). Prolactin effects on cultured pavement cell epithelia and pavement cell plus mitochondria-rich cell epithelia from freshwater rainbow trout gills. Gen. Comp. Endocrinol. 128, 44-56.[CrossRef][Medline]
Kelly, S. P. and Wood, C. M. (2003). Dilute culture media as an environmental or physiological simulant in cultured gill epithelia from freshwater rainbow trout. In Vitro Cell. Dev. Biol. Anim. 39,21 -28.
Kelly, S. P., Fletcher, M., Part, P. and Wood, C. M. (2000). Procedures for the preparation and culture of `reconstructed' rainbow trout branchial epithelia. Methods Cell Sci. 22,153 -163.[CrossRef][Medline]
Laiz-Carrion, R., Martin del Rio, M. P., Miguez, J. M., Mancera, J. M. and Soengas, J. L. (2003). Influence of cortisol on osmoregulation and energy metabolism in gilthead seabream Sparus aurata.J. Exp. Zoolog. Part A Comp. Exp. Biol. 298,105 -118.[Medline]
Lang, F., Busch, G. L., Ritter, M., Volkl, H., Waldegger, S.,
Gulbins, E. and Haussinger, D. (1998a). Functional
significance of cell volume regulatory mechanisms. Physiol.
Rev. 78,247
-306.
Lang, F., Busch, G. L. and Volkl, H. (1998b). The diversity of volume regulatory mechanisms. Cell. Physiol. Biochem. 8,1 -45.[Medline]
Lionetto, M. G., Giordona, M. E., Nicolardi, G. and Schettino, T. (2001). Hypertonicity stimulates Cl() transport in the intestine of fresh water acclimated eel, Anguilla anguilla.Cell. Physiol. Biochem. 11,41 -54.[Medline]
Madsen, S. S. and Bern, H. A. (1993).
In-vitro effects of insulin-like growth factor-I on gill
Na+,K(+)-ATPase in coho salmon, Oncorhynchus kisutch. J.
Endocrinol. 138,23
-30.
Madsen, S. S., Jensen, M. K., Nhr, J. and Kristiansen, K. (1995). Expression of Na(+)-K(+)-ATPase in the brown trout, Salmo trutta: in vivo modulation by hormones and seawater. Am. J. Physiol. 269,R1339 -R1345.[Medline]
Mancera, J. M. and McCormick, S. D. (2000). Rapid activation of gill Na(+),K(+)-ATPase in the euryhaline teleost Fundulus heteroclitus. J. Exp. Zool. 287,263 -274.[CrossRef][Medline]
Marshall, W. S. and Singer, T. D. (2002). Cystic fibrosis transmembrane conductance regulator in teleost fish. Biochim. Biophys. Acta 1566,16 -27.[Medline]
Marshall, W. S., Ossum, C. G. and Hoffmann, E. K.
(2005). Hypotonic shock mediation by p38 MAPK, JNK, PKC, FAK,
OSR1 and SPAK in osmosensing chloride secreting cells of killifish opercular
epithelium. J. Exp. Biol.
208,1063
-1077.
Mayer, N., Maetz, J., Chan, D. K., Forster, M. and Jones, I. C. (1967). Cortisol, a sodium excreting factor in the eel (Anguilla anguilla L.) adapted to sea water. Nature 214,1118 -1120.[CrossRef][Medline]
McCormick, S. D. and Bradshaw, D. (2006). Hormonal control of salt and water balance in vertebrates. Gen. Comp. Endocrinol. 147,3 -8.[CrossRef][Medline]
McCormick, S. D., Sakamoto, T., Hasegawa, S. and Hirano, T.
(1991). Osmoregulatory actions of insulin-like growth factor-I in
rainbow trout (Oncorhynchus mykiss). J.
Endocrinol. 130,87
-92.
Miguel, M. J., Laiz, C. R. and del Pilar Martin del Rio, M. (2002). Osmoregulatory action of PRL, GH, and cortisol in the gilthead seabream (Sparus aurata L). Gen. Comp. Endocrinol. 129,95 -103.[CrossRef][Medline]
Muto, S., Nemoto, J., Okada, K., Miyata, Y., Kawakami, K., Saito, T. and Asano, Y. (2000). Intracellular Na+ directly modulates Na+,K+-ATPase gene expression in normal rat kidney epithelial cells. Kidney Int. 57,1617 -1635.[CrossRef][Medline]
O'Donnell, M. J., Kelly, S. P., Nurse, C. A. and Wood, C. M. (2001). A maxi Cl channel in cultured pavement cells from the gills of the freshwater rainbow trout Oncorhynchus mykiss.J. Exp. Biol. 204,1783 -1794.[Abstract]
Pedersen, S. F. and Cala, P. M. (2004). Comparative biology of the ubiquitous Na+/H+ exchanger, NHE1: lessons from erythrocytes. J. Exp. Zool. A Comp. Exp. Biol. 301,569 -578.[Medline]
Pedersen, S. F., King, S. A., Rigor, R. R., Zhuang, Z., Warren, J. M. and Cala, P. M. (2003). Molecular cloning of NHE1 from winter flounder RBCs: activation by osmotic shrinkage, cAMP, and calyculin A. Am. J. Physiol. 284,C1561 -C1576.
Pedersen, S. F., O'Donnell, M. E., Anderson, S. E. and Cala, P. M. (2006). Physiology and pathophysiology of Na+/H+ exchange and Na+-K+-2Cl cotransport in the heart, brain, and blood. Am. J. Physiol. 291,R1 -R25.[CrossRef]
Pelis, R. M. and McCormick, S. D. (2001). Effects of growth hormone and cortisol on Na(+)-K(+)-2Cl() cotransporter localization and abundance in the gills of Atlantic salmon. Gen. Comp. Endocrinol. 124,134 -143.[CrossRef][Medline]
Perry, S. F. (1997). The chloride cell: structure and function in the gills of freshwater fishes. Annu. Rev. Physiol. 59,325 -347.[CrossRef][Medline]
Richards, J. G., Semple, J. W., Bystriansky, J. S. and Schulte,
P. M. (2003). Na+/K+-ATPase
alpha-isoform switching in gills of rainbow trout (Oncorhynchus
mykiss) during salinity transfer. J. Exp. Biol.
206,4475
-4486.
Russell, J. M. (2000).
Sodium-potassium-chloride cotransport. Physiol. Rev.
80,211
-276.
Sunny, F. and Oommen, O. V. (2001). Rapid action of glucocorticoids on branchial ATPase activity in Oreochromis mossambicus: an in vivo and in vitro study. Comp. Biochem. Physiol. 130B,323 -330.[CrossRef][Medline]
Takei, Y. and Hirose, S. (2002). The natriuretic peptide system in eels: a key endocrine system for euryhalinity? Am. J. Physiol. 282,R940 -R951.
Tse, W. K., Au, D. W. and Wong, C. K. (2006). Characterization of ion channel and transporter mRNA expressions in isolated gill chloride and pavement cells of seawater acclimating eels. Biochem. Biophys. Res. Commun. 346,1181 -1190.[CrossRef][Medline]
Weaver, Y. R., Kiessling, K. and Cossins, A. R. (1999). Responses of the Na+/H+ exchanger of european flounder red blood cells to hypertonic, ß-adrenergic and acidotic stimuli. J. Exp. Biol. 202, 21-32.[Abstract]
Whorwood, C. B. and Stewart, P. M. (1995).
Transcriptional regulation of Na/K-ATPase by corticosteroids, glycyrrhetinic
acid and second messenger pathways in rat kidney epithelial cells.
J. Mol. Endocrinol. 15,93
-103.
Wong, C. K. and Chan, D. K. (1999a). Chloride cell subtypes in the gill epithelium of Japanese eel Anguilla japonica.Am. J. Physiol. 277,R517 -R522.[Medline]
Wong, C. K. and Chan, D. K. (1999b). Isolation of viable cell types from the gill epithelium of Japanese eel Anguilla japonica. Am. J. Physiol. 276,R363 -R372.[Medline]
Wong, C. K. and Chan, D. K. (2001). Effects of cortisol on chloride cells in the gill epithelium of Japanese eel, Anguilla japonica. J. Endocrinol. 168,185 -192.[Abstract]
Wood, C. M., Kelly, S. P., Zhou, B., Fletcher, M., O'Donnell, M., Eletti, B. and Part, P. (2002). Cultured gill epithelia as models for the freshwater fish gill. Biochim. Biophys. Acta 1566,72 -83.[Medline]
Yang, H., Wang, Z., Miyamoto, Y. and Reinach, P. S. (2001). Cell signaling pathways mediating epidermal growth factor stimulation of Na:K:2Cl cotransport activity in rabbit corneal epithelial cells. J. Membr. Biol. 183,93 -101.[CrossRef][Medline]
Zhou, B., Kelly, S. P., Ianowski, J. P. and Wood, C. M. (2003). Effects of cortisol and prolactin on Na+ and Cl transport in cultured branchial epithelia from FW rainbow trout. Am. J. Physiol. 285,R1305 -R1316.
Zhou, B., Kelly, S. P. and Wood, C. M. (2004). Response of developing cultured freshwater gill epithelia to gradual apical media dilution and hormone supplementation. J. Exp. Zool. A Comp. Exp. Biol. 301,867 -881.[Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
S. C. Chow, L. Y. Ching, A. M. F. Wong, and C. K. C. Wong Cloning and regulation of expression of the Na+-Cl--taurine transporter in gill cells of freshwater Japanese eels J. Exp. Biol., October 15, 2009; 212(20): 3205 - 3210. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. K. F. Tse, S. C. Chow, and C. K. C. Wong The cloning of eel osmotic stress transcription factor and the regulation of its expression in primary gill cell culture J. Exp. Biol., June 15, 2008; 211(12): 1964 - 1968. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||