|
| ![]() |
|
||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online July 20, 2006
Journal of Experimental Biology 209, 2979-2989 (2006)
Published by The Company of Biologists 2006
doi: 10.1242/jeb.02314
Cloning and functional expression of voltage-gated ion channel subunits from cnidocytes of the Portuguese Man O'War Physalia physalis
1 Whitney Laboratory for Marine Bioscience, University of Florida, 9505
Ocean Shore Blvd, St Augustine, FL 32080, USA
2 Department of Physiology and Functional Genomics, University of Florida,
9505 Ocean Shore Blvd, St Augustine, FL 32080, USA
* Author for correspondence (e-mail: paa{at}whitney.ufl.edu)
Accepted 8 May 2006
| Summary |
|---|
|
|
|---|
1 subunits although the specifics of the
modulation differ. PpKV1 produces fast transient outward
currents that have properties typical of other Shaker channels. The
possible role of these channel proteins in the behavior of cnidocytes is
discussed.
Key words: Ca2+ beta subunit, potassium channel, Shaker, KV1, cnidaria, Physalia physalis
| Introduction |
|---|
|
|
|---|
Cnidocytes are used for a variety of functions, including food capture,
locomotion and defense. Because of the complexity of the cell, and the fact
that a cnidocyte can be used only once, their discharge is very tightly
regulated to minimize what is likely to be the considerable energetic cost of
replacement. Studies of the regulation of cnidocyte discharge have employed a
variety of physiological (Gitter et al.,
1994
; Brinkmann et al.,
1995
; Purcell and Anderson,
1995
; Salleo et al.,
1996
), structural (Lubbock et
al., 1981
; Westfall and
Grimmelikhuijzen, 1993
;
Westfall, 2004
) and
histochemical approaches (Anderson et al.,
2004
; Kass-Simon and
Scappaticci, Jr, 2004
), using representatives of all cnidarian
classes. Given that cnidocyte discharge is thought to be an exocytotic event,
special attention (Lubbock et al.,
1981
; Gitter and Thurm,
1993
; Gitter et al.,
1994
) has been given to the potential role of voltage-gated ionic
currents, particularly Ca2+ currents of the type that trigger
exocytosis at synapses and exocrine cells
(Sudhof, 2004
).
Voltage clamp recordings from single cnidocytes isolated from
Cladonema (Class Hydrozoa) and Chrysaora (Class Scyphozoa)
(Anderson and McKay, 1987
)
provided evidence for a variety of voltage-gated ionic currents in these
cells. Stenotele cnidocytes from Cladonema are capable of producing a
Na+-dependent action potential and both they, and cnidocytes from
Chrysaora, produce voltage-dependent K+ currents. No
evidence for voltage-gated Ca2+ currents was observed in either
type of cnidocyte and in no instance did manipulation of a cell's membrane
potential trigger cnidocyte discharge. Intracellular, current clamp recordings
from cnidocytes in the tentacles of Physalia
(Anderson and McKay, 1987
)
provided no evidence for voltage-gated inward currents and again, cnidocyte
discharge was never triggered by imposed changes in membrane potential.
Cnidocyte discharge does not, however, occur in Ca2+-free media
(Gitter et al., 1994
), nor in
the presence of inorganic Ca2+ channel blockers
(Gitter and Thurm, 1993
),
suggesting that discharge is Ca2+-dependent. Furthermore, because
electrically induced discharge of Hydra cnidocytes is abolished in
the absence of external Ca2+
(Gitter et al., 1994
), it has
been proposed that voltage-gated Ca2+ channels at the apical end of
the cnidocyte are involved. However, although neurons are not always required
for cnidocyte discharge (Aerne et al.,
1991
), cnidocytes are innervated by peptidergic
(Anderson et al., 2004
) and
other classes of neuron (Kass-Simon and
Scappaticci, Jr, 2004
). Consequently, the effects of
Ca2+-free media and Ca2+ channel blockers could be
manifest through their block of synaptic activity within the nerve nets that
surround cnidocytes (Anderson et al.,
2004
; Price and Anderson,
2006
), or at the level of synapses onto the cnidocytes
themselves.
To resolve whether or not Ca2+ channels are present in
cnidocytes, we employed molecular techniques to clone and localize
voltage-gated Ca2+ channel subunits from a cnidocyte-specific
amplified cDNA library. The results indicate that cnidocytes possess a variety
of ion channels, including a Ca2+ channel
1 and
ß subunit, and a voltage-gated K+ channel. The Ca2+
ß subunit is capable of modulating the activity of a mammalian and a
cnidarian
1 subunit, in a predictable manner, and the
K+ channel gates transient outward currents. While the presence of
voltage-gated Ca2+ channel proteins in cnidocytes could reflect
their role in the exocytosis that underlies cnidocyte discharge, other roles
cannot be excluded.
| Materials and methods |
|---|
|
|
|---|
The quality of the cnidocyte purification was assessed visually. A drop of resuspended pellet was placed on a `Probe-on Plus' slide (Fisher Scientific, Suwanee, GA, USA) and left in a humid chamber for 30 min. 4% phosphate-buffered paraformaldehyde was then gently added and, after 30 min, replaced with fresh fixative. After a further 30 min, the sample was rinsed 3x for 10 min each with phosphate-buffered saline (PBS) that contained 0.25% Triton-X 100, stained with 0.008% 4',6-diamidino-2-phenylindole (DAPI) in PBS for 20 min at room temperature, rinsed 3x for 10 min each in PBS and mounted in 90% glycerol in PBS.
RNA isolation and cDNA library production
RNA was prepared from the cnidocyte pellets or from intact tentacles, using
published methods (Matz,
2002
). Briefly, total RNA was isolated
(Chomczynski and Sacchi, 1987
),
except that all procedures are performed at neutral rather than acidic pH. The
RNA was precipitated with LiCl. Messenger RNAs were converted to cDNAs by
reverse transcription with the TRSA primer, CGCAGTCGGTACTTTTTTTTTTTT. A
pseudo-double-stranded adaptor, made of two complementary oligonucleotides
(CGACGTGGACTATCCATGAACGCAACTCTCCGACCTCTCACCGAGTACG and CGTACTCGGT), was then
ligated to the 5' end of the double-stranded cDNA. The structure of the
adaptors evokes a PCR suppression effect which, through the process of
self-annealing, prevents the amplification of molecules that have the adapter
ligated to both ends (Lukyanov et al.,
1997
).
The library was then amplified using the primers CGACGTGGACTATCCATGAACGCA (DAP), which corresponds to part of the double-stranded adaptor, and TRSA, with the adapter ligation mix as the template. A smear was visible on a 1% agarose/ethidium bromide gel after 17 cycles of amplification.
Cloning of ion channel proteins
Fragments of ion channels were amplified from the cnidocyte cDNA library
using degenerate oligonucleotide primers. In the case of the Ca2+
ß subunit, these were AAYAAYGAYTGGTGGA (sense) and GCYTTYTGCATCATRT
(anti-sense), which correspond to the conserved peptide sequences NNDWWI and
DMMQK, respectively. For the K+ channel, a sense primer
(AAYGARTAYTTYGAYMG) corresponding to the peptide sequence NEYFFDR, and an
anti-sense primer (CCRTAICCNASNGTIGTCAT) corresponding to the peptide sequence
MTTVGYG, were used. The PCR reactions contained 50 pmol l-1 of each
of the primers, 1 µl of the cDNA library, and LA Taq polymerase (Takara
Mirus Bio, Madison, WI, USA). Thirty cycles of PCR amplification were carried
out with a denaturing temperature of 94°C (1 min) and an extension
temperature of 72°C (2.5 min). In the case of the Ca2+ ß
subunit the annealing temperature was 52°C (1 min). For the K+
channel, a touchdown protocol from 60°C to 42°C in 0.5°C
increments was used. The products were run on agarose gels, and appropriately
sized bands were excised, gel purified, ligated into the pGemT vector
(Promega, Madison, WI, USA), and sequenced using the BigDye Terminator Cycle
Sequencing Kit (ABI, Applied Biosystems Inc., Foster City, CA, USA).
Full-length sequences for a Ca2+ ß subunit and a K+
channel were obtained with a RACE strategy using a combination of
gene-specific primers and 5'- and 3'-adaptor-specific primers on
the amplified cnidocyte library (Matz et
al., 2003
). The final sequence for each channel was derived from a
consensus of three independent clones. Exact primers corresponding to the
5' and 3' end of this sequence were used to amplify a full-length
cDNA from tentacle mRNA, which was sequenced to confirm its identity to the
consensus.
To confirm the origin of the cloned ion channel subunits, 12 cnidocytes were removed from a suspension of purified cells by aspiration into a fine glass pipette whose tip diameter was slightly larger than that of cnidocytes. The isolated cnidocytes were transferred individually through three, 250 µl drops of Ca2+/Mg2+-free ASW on a glass coverslip. The continued presence of the divalent-free medium, coupled with the light mechanical agitation produced by the pipetting, should have minimized the possibility that fragments from other cells remained attached to the cnidocytes. Total RNA isolation and DNAase treatment were done using the Absolutely RNA Nanoprep kit (Stratagene, La Jolla, CA, USA). As much aqueous medium as possible was first removed from the drop on the slide, and replaced with cell lysis buffer. After cell lysis was observed, the entire volume of the drop was transferred to a microcentrifuge tube, and RNA isolation carried out according to the kit's instructions. In the case of the ß subunit, PCR was performed on 2 µl of the reverse-transcribed product (Superscript III, Invitrogen, Carlsbad, CA, USA) using exact primers (GTTACAGCTTCGTACAATGTTCCTCT and CCATATTCTGAAGATGTACCAGAAGTT), which amplified a 323 bp region at the 5' end of the coding sequence. Electrophoresis of the product on a 1% agarose gel revealed a band of the appropriate size that was then cloned and sequenced. For the K+ channel, PCR with exact primers (CCAGCAAGCATCAGGGTTAT [sense] and ACTATAGCCCACCACGATGC [antisense] produced a smear on the agarose gel after 30 cycles of amplification at an annealing temperature of 55°C. However, a further round of PCR with nested primers (CACGGGGCTTGCAGATCCTA [sense] and TGCCGCAGGTATAGAAGTAAATTTTG [antisense]) produced an intense band of the correct size after 20 cycles of amplification, using identical PCR conditions. This was cloned and sequenced.
Phylogenetic analysis
The phylogenetic relationship between the amino acid sequences of the
cloned channel subunits and equivalent subunits in other organisms was
determined using MrBayes3.1 (Ronquist and
Huelsenbeck, 2003
), a Bayesian phylogenetic inference program. The
evolutionary model was based on a mixture of several fixed-rate amino acid
models, and assumed gamma distribution of sites, according to variability. The
analysis was run for 1.5 million generations, with a sample frequency of 100,
concluding in a summary of the last 3000 trees (burnin=12,000). The analysis
was run three times to ensure convergence. The graphical output was generated
using Treeview (Page, 1996
).
All accession numbers refer to GenBank.
Heterologous expression
The functional properties of the cloned channels were determined as
described previously (Jeziorski et al.,
1999
). In the case of the ß subunit, this was done by
co-expressing the transcript with cnidarian
(CyCaV
1; Accession number U93075)
(Jeziorski et al., 1998
) and
mammalian (CaV2.3: Accession number NM009782)
1
subunits. In the case of the K+ channel, this was done by
expressing the channel transcript directly. Briefly, stage V-VI oocytes
removed from anesthetized adult female Xenopus laevis were
defolliculated with the aid of 2 mg ml-1 collagenase (Sigma Type X)
in Ca2+-free ND96 solution consisting of (mmol l-1):
NaCl, 96; KCl, 2; MgCl2, 1; Hepes, 5 (pH 7.4) and stored overnight
at 17°C in ND96 with 1.8 mmol l-1 CaCl2,
supplemented with 2.5 mmol l-1 sodium pyruvate, 100 U
ml-1 penicillin, 100 µg ml-1 streptomycin and 5%
horse serum. For transcription, the full-length construct of the ß
subunit was ligated into an oocyte expression vector
(Lingueglia et al., 1995
),
while that for the K+ channel was transcribed directly from the pCR
4-TOPO cloning vector (Invitrogen). These were linearized using NotI
and SpeI, respectively, purified with SDS and Proteinase K, followed
by a phenol/chloroform extraction and precipitated with ethanol/sodium
acetate. RNA was generated with an in vitro transcription reaction
using the T7 version of the mMessagem Machine kit (Ambion Inc., Austin, TX,
USA). The mRNA was purified and analyzed on a glyoxal denaturing gel. The
ß subunit mRNA was combined with either CaV2.3 or
CyCaV
1 in a 3:1 ratio to ensure an
excess of the ß subunit. For injections of either of the
1 subunits alone, the mRNA was diluted 1:3 with water to
ensure the same amount of message was injected. A total of 46 nl of mRNA was
injected into each oocyte.
After 48 h of incubation at 17°C in supplemented ND96 medium, the
properties of expressed currents were examined under two-electrode voltage
clamp, as previously described (Jeziorski
et al., 1999
). Capacitive and leakage currents were removed using
a P/3 routine. In recordings involving the ß subunit, the actions of the
endogenous Ca2+-activated Cl- currents in the oocytes
were minimized by pre-treating the oocytes for 10 min in 0.5 mmol
l-1 niflumic acid. The niflumic acid was prepared as a 250 mmol
l-1 stock solution in ethanol and diluted 1:500 in recording
solution. Ethanol alone at this concentration had no effect on the membrane
potential or the current required to hold control oocytes at -90 mV.
Recordings were carried out using either ND96 (K+ channel) or,
in the case of the ß subunit, a modified ND96 containing 40 mmol
l-1 Sr2+ as the charge carrier
(Jeziorski et al., 1998
),
since both CaV2.3 and CyCaV
1
show greatest selectivity for Sr2+. Only oocytes with resting
potentials of at least -20 mV and requiring holding currents of less than
-0.20 µA when clamped at -90 mV were used in this study.
|
| Results |
|---|
|
|
|---|
The isolated cnidocytes fell into two size classes with, so far as could be determined from examination of the discharged and undischarged cysts, structurally similar cysts. In both instances, the cells contained a single, spherical cnidocyst, which occupied the bulk of the apical portion of the cell leaving very little space between the margin of the cyst and that of the cell. In the larger of the two, the cysts measured 40 µm in diameter. They occupied almost the entire volume of the cell, leaving only a small truncated conical projection at the basal end of the cell (Fig. 1B,C). This projection, which contained the nucleus, terminated in an array of fine processes that projected away from the cell body. A cnidocil was evident at the apical end of the cell but stereo-cilia were not obvious (Fig. 1C). In the smaller of the two classes of cnidocyte, the cnidocyst measured 22 µm in diameter and occupied a smaller proportion of the cell. A long narrow cytoplasmic projection extended from the basal end of these cells; the cell's nucleus lies in this process, basal to the cyst (Fig. 1D). These cells also bore a cnidocil which was less distinct than those of the larger cells, but appeared to be surrounded by a collar of sterocilia. The total length of both types of cnidocyte, from the apical end of the cell to the end of the basal cytoplasmic extension, were the same (55-60 µm), presumably representing the width of the tentacle ectoderm.
Ca2+ ß subunit
The initial fragment of the Physalia Ca2+ channel
ß subunit was obtained using two degenerate oligonucleotide primers that
correspond to conserved regions of mammalian ß subunits. These have been
used successfully to isolate ß subunits from a flatworm
(Kohn et al., 2002
). The
remainder of the Physalia ß subunit, which we term
CyCaVß, was obtained using a RACE strategy. The
533-amino-acid polypeptide is encoded by a 1599-base-pair open reading frame
and has a deduced molecular mass of 59 kDa. The sequence for this subunit has
been submitted to GenBank (Accession number: ABD59026).
The primary sequence of PpCaVß is most similar
(62% identity; 76% conserved) to that of CyCaVß from
the scyphozoan jellyfish Cyanea capillata, but is generally similar
to that of other ß subunits (Fig.
2) particularly in the two regions that create the sides of the
AID binding pocket (for a review, see
Richards et al., 2004
).
Moreover, of the 17 residues that have been shown, through crystallization
studies (Chen et al., 2004
), to
interact directly with the
1 subunit in mammalian
Ca2+ channels, all but two are identical in
PpCaVß (Fig.
2), and one of those is conserved.
|
|
Co-expression of PpCaVß with
CyCaV
1 from the jellyfish
Cyanea modulates the properties of currents gated by
CyCaV
1 alone. The most prominent effect
is a threefold increase in the peak of current
(Fig. 4A,B) through the
channel. When currents with and without PpCaVß are
normalized and fit to a modified Boltzman equation, a negative shift in the
I/V relationship is evident
(Fig. 4D). Finally,
inactivation of CyCaV
1 is accelerated by
PpCaVß (Fig.
4F). In contrast, while co-expression of
PpCaVß with the mammalian CaV2.3 results
in a twofold increase in the peak current
(Fig. 4C), the shift in the
I/V relationship of the normalized currents is less marked
than that for CyCaVa1
(Fig. 4E), and there is no
obvious effect on the rate of inactivation
(Fig. 4G).
|
|
|
|
Attempts to confirm the location of these channel transcripts using in situ hybridization have not been successful to date. Instead, the cellular origin of PpCaVß and PpKV1 mRNA was confirmed by RT-PCR directly from cnidocytes RNA, as described in the Materials and methods. Sequencing of the band obtained using PpCaVß- or PpKV1-specific primers yielded identical sequences to the respective channels, thereby confirming that both PpCaVß and PpKV1 are present in cnidocytes. In both cases, PCR performed under identical conditions but in the absence of template, yielded no product. Another control experiment consisted of an amplification, using both primer sets, of cDNA from the wall of the pneumatophore. Again, this yielded no product, whereas PCR of the same template with actin-specific primers produced the appropriate product.
| Discussion |
|---|
|
|
|---|
Work in the field of the regulation of cnidocyte discharge over the years
has demonstrated that cnidocytes do not function as independent effectors, as
originally surmised (Parker,
1916
), but instead normally function in concert with a
multicellular pathway composed of sensory cells
(Holtmann and Thurm, 2001
;
Westfall, 2004
), neurons
(Kass-Simon and Scappaticci, Jr,
2004
; Price and Anderson,
2006
) and in some instances, supporting cells
(Watson and Roberts, 1995
).
One consequence of the fact that multiple cell types are involved in the
regulation of discharge has been the challenge of localizing the site of
action of some experimental manipulations. For example, several studies have
concluded that voltage-gated Ca2+ channels are involved in
discharge (Lubbock et al.,
1981
; Gitter and Thurm,
1993
; Gitter et al.,
1994
), and while it has been assumed that Ca2+ channels
play a direct role on the exocytotic event underlying discharge, the
possibility that those channels are present at synapses within the nerve nets
that innervate cnidocytes cannot be excluded. Distinguishing between these
possibilities is compounded by the small size and diffuse nature of many of
the cells in question, particularly the neurons.
To circumvent this problem, we chose to take advantage of the elevated density of cnidocytes to create a cnidocyte-specific cDNA library, and to screen that library for genes that encode for likely components of any regulatory pathways. A variety of dissociation methods, including treatments with a variety of enzymes, were tested, but with the exception of the heat shock methods described here, none consistently yielded large numbers of pure, intact cnidocytes.
The cnidome of the tentacles of Physalia physalis has been
reported variously to consist of two size-classes of heterotrichous
anisorhizas (Totton and Mackie,
1960
), two size classes of spherical isorhizas
(Purcell, 1984
) and atrichous
isorhizas (Weill, 1934
). The
dissociation procedure employed here yielded large numbers of cnidocytes, of
two size classes. The majority of the cells were intact, but the appearance of
the few discharged cnidocytes present was consistent with that of the cnidome
of P. utriculus (Yanagihara et
al., 2002
), which consists of two size classes of heterotrichous
anisorhizas.
The facts that the isolated cnidocytes possess a cnidocil on the apical end
of the cell, membrane-bound cytoplasmic extensions at the basal end of the
cell, and a DAPI-stained nucleus at the base of the cnidocyst
(Fig. 1) were taken as evidence
that the isolated, purified cells were intact and, therefore, likely to
contain cell-specific mRNA. In the preparations of purified cnidocytes used to
prepare the amplified cDNA libraries, the enrichment for cnidocytes was almost
total. While occasional loose DAPI-stained nuclei were observed, no other cell
types were ever observed. We thus conclude that the cDNA libraries are
specific for cnidocytes. Screening these libraries using standard molecular
cloning protocols yielded a variety of voltage-gated channel fragments,
including PpCaVß and PpKV1, for
which full-length sequences and expression were obtained. Fragments of a
Ca2+ channel
1 subunit and a voltage-gated
Na+ channel
subunit, which were isolated using degenerate
primers that have isolated Ca2+ and Na+ channel
fragments from other cnidarians (Anderson
et al., 1993
; White et al.,
1998
; Jeziorski et al.,
1998
), were not investigated beyond their initial
identification.
The Ca2+ channel ß subunit identified here
(PpCaVß) was isolated using degenerate
oligonucleotide primers that have successfully isolated ß subunits from
another invertebrate. Not unexpectedly, PpCaVß is
phylogenetically closest to CyCaVß, an equivalent
channel isolated from the scyphozoan jellyfish Cynaea capillata
(Jeziorski et al., 1999
), but
shows high structural similarity to other ß subunits, most notably in the
conservation of the residues that interact with the
1
subunit (Chen et al., 2004
;
Van Petegem et al., 2004
;
Richards et al., 2004
).
Functionally, PpCaVß is similar to other ß
subunits inasmuch as it significantly increases currents through both
mammalian (CaV2.3) and cnidarian (CyCaV)
Ca2+ channel
1 subunits and, particularly in the
case of CyCaV, produces a negative shift in the
current/voltage relationship of the current. It also increases the time
constant of inactivation of currents carried by CyCaV.
Thus, PpCaVß is a functional Ca2+
ß-subunit.
The presence of a voltage-gated K+ channel of the
Shaker (KV1) family in cnidocytes is not surprising.
K+-dependent currents are common in many if not most excitable
cells, and K+-dependent outward currents have been recorded from
isolated cnidocytes (Anderson and McKay,
1987
). As might be expected, PpKV1 clusters
with other invertebrate members of the Shaker (KV1)
family, and is most closely associated with jShak1, a Shaker-like
channel from another cnidarian (Jegla et
al., 1995
). The channel contains two consensus sequences for
protein kinase A (PKA) phosphorylation (Tyr420 and
Ser437) located in the C-terminal region. Ser437 is
highly conserved and corresponds to the site that has been shown to be
involved in phosphorylation-dependent modulation of KV1.1 channels
(Winklhofer et al., 2003
). The
functional properties of PpKV1, including its
pharmacology, and the fact that loss of part of the amino terminus of the
channel converts it from a fast inactivating channel to a steady-state one,
are consistent with the properties of other members of this K+
channel family (Hoshi et al.,
1990
).
The discovery that cnidocytes contain Ca2+ channels supports the
argument that cnidocyte discharge involves voltage-gated Ca2+
channels in the cnidocytes, but some caution should be retained. Previous work
with cnidocytes in the tentacles of Physalia showed that cnidocytes
impaled with microelectrodes will not discharge in response to intracellular
current injection (Anderson and
McKay,1987
), implying that discharge does not involve any
voltage-dependent phenomena. Furthermore, cnidocytes isolated from the hydroid
Cladonema have been shown to produce action potentials
(Anderson and McKay, 1987
;
Price and Anderson, 2006
), yet
neither those action potentials, nor imposed changes in membrane potential,
both of which would be expected to activate any endogenous voltage-gated
Ca2+ channels, trigger discharge. It is, of course, possible that
the presence of the microelectrode or the isolation procedure may have
compromised the cells' abilities to discharge, but it is also possible that
the Ca2+ channels reported here may play other roles.
Ultrastructural studies of cnidocytes has revealed the presence of chemical
synapses between cnidocytes and other cell types, with the cnidocytes being
both presynaptic (Holtmann and Thurm,
2001
; Thurm et al.,
2004
) and postsynaptic
(Westfall, 2004
). Cnidocytes
that provide the presynaptic elements of a chemical synapse would be expected
to contain the molecular machinery required for synaptic exocytosis, including
a variety of Ca2+ channel subunits. Thus, the presence of a
Ca2+
1 subunit and PpCaVß in
cnidocytes may simply reflect these cells' role as presynaptic elements and
should not be unexpected. Confirmation that these channel proteins are
involved in cnidocyte discharge will require evidence that these subunits are
localized to the apical membrane of the cnidocytes, where cnidocyst exocytosis
occurs. Now that the primary structure of these channel subunits has been
determined, immunocytochemical localization should be possible.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Aerne, B. L., Stidwell, R. P. and Tardent, P. (1991). Nematocyst discharge in Hydra does not require the presence of nerve cells. J. Exp. Zool. 258,137 -141.[CrossRef]
Anderson, P. A. V. and McKay, M. C. (1987). The
electrophysiology of cnidocytes. J. Exp. Biol.
133,215
-230.
Anderson, P. A. V., Holman, M. A. and Greenberg, R. M.
(1993). Deduced amino acid structure of a putative sodium channel
from the scyphozoan jellyfish Cyanea capillata. Proc. Natl. Acad.
Sci. USA 90,7419
-7423.
Anderson, P. A. V., Thompson, L. F. and Moneypenny, C. G.
(2004). Evidence for a common pattern of peptidergic innervation
of cnidocytes. Biol. Bull.
207,141
-146.
Brinkmann, M., Oliver, D. and Thurm, U. (1995). Interaction of mechano- and chemosensory signals within the same sensory cell. Pflüg. Archiv. Eur. J. Physiol. 429, R153.
Chen, Y., Li, M., Zhang, Y., Yamaha, Y., Fitzmaurice, A., Shen,
Y., Zhang, H., Tong, L. and Yang, J. (2004). Structural basis
of the
1-ß subunit interactions of voltage-gated
Ca2+ channels. Nature
429,675
-680.[CrossRef][Medline]
Chomczynski, P. and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162,156 -159.[Medline]
Gitter, A. H. and Thurm, U. (1993). Inorganic, but not organic calcium channel blockers inhibit nematocyte discharge in Hydra vulgaris. Eur. J. Cell Biol. 60 (Suppl. 37),325 -330.[Medline]
Gitter, A. H., Oliver, D. and Thurm, U. (1994). Calcium- and voltage-dependence of nematocyst discharge in Hydra vulgaris.J. Comp. Physiol. A 174,115 -122.
Holtmann, M. and Thurm, U. (2001). Mono- and oligo-vesicular synapses and their connectivity in a cnidarian sensory epithelium (Coryne tubulosa). J. Comp. Neurol. 432,537 -549.[CrossRef][Medline]
Hoshi, T., Zagotta, W. N. and Aldrich, R. W.
(1990). Biophysical and molecular mechanisms of Shaker potassium
channel inactivation. Science
250,533
-538.
Jegla, T., Grigoriev, N., Gallin, W. J., Salkoff, L. and Spencer, A. N. (1995). Multiple Shaker potassium channels in a primitive metazoa. J. Neurosci. 15,7989 -7999.[Abstract]
Jeziorski, M. C., Greenberg, R. M., Clark, K. S. and Anderson,
P. A. V. (1998). Cloning and functional expression of a
voltage-gated calcium channel
1 subunit from jellyfish.
J. Biol. Chem. 273,22792
-22799.
Jeziorski, M. C., Greenberg, R. M. and Anderson, P. A. V.
(1999). Cloning and expression of a jellyfish calcium channel
ß subunit reveals functional conservation of the
1-ß interaction. Receptors
Channels 6,375
-386.[Medline]
Kass-Simon, G. and Scappaticci, A. A., Jr (2002). The behavioral and developmental physiology of nematocysts. Can. J. Zool. 80,1172 -1794.
Kass-Simon, G. and Scappaticci, A. A., Jr (2004). Glutamatergic and GABAergic control of the tentacle effector systems of Hydra vulgaris. Hydrobiologia 530/531,67 -71.
Kohn, A. B., Anderson Peter, A. V., Roberts-Misterly, J. M. and Greenberg, R. M. (2002). Schistosome calcium channel ß subunits. Unusual modulatory effects and potential role in the action of the antischistosomal drug praziquantel. J. Biol. Chem. 276,36873 -36876.
Lingueglia, E., Champigny, G., Lazdunski, M. and Barbry, P. (1995). Cloning of the amiloride-sensitive FMRFamide peptide-gated sodium channel. Nature 378,730 -733.[CrossRef][Medline]
Lubbock, R., Gupta, B. L. and Hall, T. A.
(1981). Novel role of calcium in exocytosis: mechanism of
nematocyst discharge as shown by X-ray micro analysis. Proc. Natl.
Acad. Sci. USA 78,3624
-3628.
Lukyanov, K., Diatchenko, L., Chenchik, A., Nanisetti, A., Siebert, P., Usman, N., Matz, M. and Lukyanov, S. (1997). Construction of cDNA libraries from small amounts of total RNA using the suppression PCR effect. Biochem. Biophys. Res. Commun. 230,285 -288.[CrossRef][Medline]
Matz, M. V. (2002). Amplification of representative cDNA samples from microscopic amounts of invertebrate tissue to search for new genes. Meth. Mol. Biol. 183, 3-18.[Medline]
Matz, M. V., Alieva, N. O., Chenchik, A. and Lukyanov, S. (2003). Amplification of cDNA ends using PCR suppression effect and step-out PCR. Meth. Mol. Biol. 221, 41-49.[Medline]
McKay, M. C. and Anderson, P. A. V. (1988). On the preparation and properties of isolated cnidocytes and cnidae. In The Biology of Cnidocytes (ed. H. M. Lenhoff and D. A. Hessinger), pp. 273-293. New York: Academic Press.
Page, R. D. M. (1996). TREEVIEW: an application to display phylogenetic trees on personal computers. Comp. Appl. Biosci. 12,357 -358.[Medline]
Parker, G. H. (1916). The effector systems of actinians. J. Exp. Zool. 21,461 -484.[CrossRef]
Price, R. B. and Anderson, P. A. V. (2006). Chemosensory pathways in the capitate tentacles of the hydroid Cladonema. Invert. Neurosci. 6, 23-32.[CrossRef][Medline]
Purcell, J. E. (1984). The functions of
nematocysts in prey capture by epipelagic siphonophore (Coelenterata,
Hydrozoa). Biol. Bull.
166,310
-327.
Purcell, J. E. and Anderson, P. A. V. (1995). Electrical responses to water-soluble components of fish mucus recorded from the cnidocytes of a fish predator, Physalia physalis. Mar. Freshw. Behav. Physiol. 26,149 -162.
Richards, M. W., Butcher, A. J. and Dolphin, A. C. (2004). Ca2+channel ß-subunits: structural insights AID our understanding. Trends Pharmacol. Sci. 25,626 -632.[CrossRef][Medline]
Ronquist, F. and Huelsenbeck, J. P. (2003).
MrBayes 3, Bayesian phylogenetic inference under mixed models.
Bioinformatics 19,1572
-1574.
Salleo, A., Musci, G., Barra, P. F. A. and Calabrese, L. (1996). The discharge mechanism of acontial nematocytes involves the release of nitric oxide. J. Exp. Biol. 199,1261 -1267.[Abstract]
Sudhof, T. C. (2004). The synaptic vesicle cycle. Annu. Rev. Neurosci. 27,509 -547.[CrossRef][Medline]
Thurm, U., Brinkmann, M., Golz, R., Holtmann, M., Oliver, D. and Sieger, T. (2004). Mechanoreception and synaptic transmission of hydrozoan nematocytes. Hydrobiologia 530/ 531, 97-105.
Totton, A. K. and Mackie, G. O. (1960). Studies on Physalia physalis. Discov. Rep. 30,301 -408.
Van Petegem, F., Clark, K. A., Chatelain, F. C. and Minor, D. L., Jr (2004). Structure of a complex between a voltage-gated calcium channel beta-subunit and an alpha-subunit domain. Nature 429,671 -675.[CrossRef][Medline]
Watson, G. M. and Roberts, J. (1995). Chemoreceptor-mediated polymerization and depolymerization of actin in hair bundles of sea anemones. Cell Motil. Cytoskeleton 30,208 -220.[CrossRef][Medline]
Weill, R. (1934). Contributions l'étude des cnidaires et de leurs nématocystes. Trav. Stat. Zool. Wimereux 10,1 -347.
Westfall, J. A. (2004). Neural pathways and innervation of cnidocytes in tentacles of sea anemones. Hydrobiologia 530/531, 117-121.
Westfall, J. A. and Grimmelikhuijzen, C. J. P. (1993). Antho-RFamide immunoreactivity in neuronal synaptic and non-synaptic vesicles of sea anemones. Biol. Bull. 185,109 -114.[Abstract]
White, G. B., Pfahnl, A., Haddock, S., Lamers, S., Greenberg, R. M. and Anderson, P. A. V. (1998). Structure of a putative sodium channel from the sea anemone Aiptasia pallida. Invert. Neurosci. 3,317 -326.[Medline]
Winklhofer, M., Matthias, K., Seifert, G., Stocker, M., Sewing, S., Herget, T., Steinhauser, C. and Saaler-Reinhardt, S. (2003). Analysis of phosphorylation-dependent modulation of KV1.1 potassium channels. Neuropharmacology 44,829 -842.[CrossRef][Medline]
Yanagihara, A. A., Kuroiwa, M. Y., Oliver, L. M. and Dunkel, D. D. (2002). The ultrastructure of nematocysts from the fishing tentacle of the Hawaiian bluebottle, Physalia utriculus (Cnidaria, Hydrozoa, Siphonophora). Hydrobiologia 489,139 -150.[CrossRef]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
T. L. Klassen, M. L. O'Mara, M. Redstone, A. N. Spencer, and W. J. Gallin Non-linear intramolecular interactions and voltage sensitivity of a KV1 family potassium channel from Polyorchis penicillatus (Eschscholtz 1829) J. Exp. Biol., November 1, 2008; 211(21): 3442 - 3453. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||