|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online June 15, 2006
Journal of Experimental Biology 209, 2595-2605 (2006)
Published by The Company of Biologists 2006
doi: 10.1242/jeb.02286
Functional evidence for the presence of a carbonic anhydrase repressor in the eyestalk of the euryhaline green crab Carcinus maenas
Department of Biological Sciences, 101 Life Science Building, Auburn University, Auburn, AL 36849, USA
e-mail: henryrp{at}auburn.edu
Accepted 19 April 2006
| Summary |
|---|
|
|
|---|
Key words: carbonic anhydrase, osmoregulation, crustacean, salinity, green crab, Carcinus maenas
| Introduction |
|---|
|
|
|---|
Branchial carbonic anhydrase activity in euryhaline crustaceans is highly
sensitive to changes in environmental salinity. In blue crabs, there is up to
a 14-fold increase in CA activity, and in green crabs, increases of up to
tenfold have been reported, depending on the magnitude of decrease in salinity
to which the crabs were exposed (Henry and
Cameron, 1982a
; Henry and
Watts, 2001
; Henry et al.,
2002
). The induction process occurs exclusively in the posterior,
ion transporting gills of both species, and it is the cytoplasmic fraction of
branchial CA, the fraction believed to be involved in ion transport, which is
induced (Henry, 1988
;
Henry et al., 2003
). CA
induction is also known to occur in more moderately euryhaline, weaker
osmoregulators, such as Callinectes similis
(Pillar et al., 1995
) and in
euryhaline freshwater crayfish (Pacifastacus leniusculus)
(Wheatly and Henry, 1987
;
Henry and Wheatly, 1988
), but
not in stenohaline osmoconformers such as Libinia emarginata
(Henry and Cameron,
1982a
).
Early reports on the time course of CA induction after exposure to low
salinity have been consistent with the hypothesis that the increase in CA
activity was a result of the synthesis of new enzyme. CA induction in both the
blue crab and the green crab has been reported to take on the order of
2448 h to be initiated and 47 days to reach new acclimated
levels, respectively (Henry and Cameron,
1982b
; Henry and Watts,
2001
; Henry et al.,
2002
). Changes in CA activity in other species (e.g. crayfish) are
also known to occur over a period of days
(Henry and Wheatly, 1988
).
Recently, CA induction in C. maenas was shown to be under
transcriptional regulation: CA mRNA increased first, at 24 h after transfer to
low salinity, followed by an initial increase in CA activity at 4872 h
post-transfer (Henry et al.,
2003
).
Preliminary new evidence also suggests that the CA induction process is
under neuroendocrine regulation. Eyestalk ablation (ESA) resulted in an
increase in CA activity in green crabs acclimated to high salinity even
without transfer to low salinity (Henry et
al., 2000
). These results suggest that CA induction is under
inhibitory control by a repressor compound found in the major endocrine organ
of the crab, the eyestalk. Perhaps because CA has such a high turnover rate
and is typically expressed in excess of what is physiologically needed (e.g.
Henry, 2001
), its regulation
has never been systematically studied, especially in invertebrates. CA and its
induction in the crustacean gill, however, represent an ideal system in which
to study the regulation of environmentally mediated changes in gene
expression. CA activity and expression can be measured in opposing gill pairs
of the same individual; the changes are large and easily measured, and the
anterior gills serve as a control in which neither activity nor expression
change in response to salinity.
This report presents the first functional evidence for the presence of a CA repressor in the eyestalk of the green crab, based on classical endocrinological approaches of eyestalk ablation combined with injections of extracts from the eyestalk and exposure to low salinity.
| Materials and methods |
|---|
|
|
|---|
Experimental protocol
Green crabs (4090 g) that were collected from 32 p.p.t. were held at
that salinity for 1 week prior to experimentation. For the bulk of the
salinity transfers, these crabs were either placed in 80 liter tanks with
running seawater of 32 p.p.t. (controls) or transferred to 160 liter
recirculating tanks (610 crabs per tank) of 10 p.p.t., thermostatted to
12°C, and also equipped with biological filters. Transfer to 10 p.p.t.
salinity has been shown to cause an approximate eight- to tenfold induction in
CA activity over a 7-day acclimation period
(Henry et al., 2002
). The time
course of low salinity exposure for these experiments was between 4 and 7
days, the time periods that have been shown to be needed for initial and
maximal CA induction, respectively, in green crabs
(Henry et al., 2002
). The
crabs were transferred either as untreated (intact) controls, crabs subjected
to eyestalk ablation (ESA), or intact or ESA crabs given daily injections of
eyestalk extracts.
For the ESA procedure, crabs were chilled on ice for 10 min, and the eyestalks were cut at their base using a dissecting scissors. The crabs were kept on ice for another 10 min to allow the hemolymph to clot, and then they were transferred to the treatment salinity.
For salinity transfer experiments involving injections, three treatments were used: (1) intact controls (no injection), (2) sham injection (injection of filtered seawater), and (3) injection of eyestalk extract. The eyestalk extracts were prepared in the following manner. For a typical sample size of 6 crabs, 12 eyestalks were homogenized in cold, filtered (0.45 µm) seawater using a hand-held homogenizer and stainless steel generator (Omni TH115; Omni Instruments, Warrenton, VA, USA). The homogenate was centrifuged at 10 000 g for 10 min at 4°C (Sorvall RC5-B, Wilmington, NE, USA), and 400 µl of the supernatant was injected into the hemolymph of each crab. The injection was given through the arthroidial membrane at the base of the walking legs using a 22-gauge needle and 1 ml syringe. Green crabs were given one injection immediately upon transfer to low salinity and one injection daily through the remainder of the time course of the experiment. To avoid potential injury to one area, the injections were given at the base of a different leg each day. A separate set of green crabs was maintained at 32 p.p.t.salinity to serve as `eyestalk donors'. After ESA, these crabs were returned to Frenchman's Bay. A 7-day experiment, involving daily injections, required the use of a large number of animals (e.g. treatment group of up to 10 crabs plus a donor group of 70). The 4-day experimental time course was validated in order to reduce animal use and increase the number of experiments able to be completed in the same amount of time, while still being able to show the same treatment effects as in the 7-day time course.
For experiments in which CA activity and CA mRNA expression were measured simultaneously in the same crab, the anterior and posterior gills from the right side of the crab were dissected out and used for total mRNA extraction and analysis, and gills from the left side of the same individual were assayed for CA activity.
For all crabs, at the end of the experiment, hemolymph samples were withdrawn from the infrabranchial sinus at the base of the walking legs, using a 22-gauge needle and 1 ml syringe, transferred to a 1.5 ml centrifuge tube, and stored at 20°C for analysis of osmotic and ionic concentrations.
Anterior gills (e.g. G4), which lack the CA induction response to low
salinity exposure (e.g. Henry et al.,
2003
), were used as a non ion-transporting tissue control, and
posterior (e.g. G8), ion-transporting gills were used as the experimental
tissue. At the end of each experiment, crabs were immersed in crushed ice for
10 min, and both anterior and posterior gills were dissected out and placed in
5 volumes of cold (4°C) homogenization/assay buffer (225 mmol
l1 mannitol, 75 mmol l1 sucrose, 10 mmol
l1 Trizma base, adjusted to pH=7.40 with 10% phosphoric
acid). Crabs were killed via exsanguination.
Analytical procedures
Carbonic anhydrase activity was measured electrometrically by the delta pH
method (Henry, 1991
). Anterior
(G4) and posterior (G8) gills were homogenized in 5 volumes of cold buffer
using an Omni 1000 or TH115 hand-held homogenizer (Omni Instruments) and then
sonicated at 25 W for 30 s(Heat Systems Microsonicator, Farmingdale, NY, USA).
Homogenates were centrifuged at 10 000 g for 20 min at 4°C
(RC5-B, Sorvall Instruments, Wilmington, DE, USA), and the supernatant was
assayed for CA activity. Briefly, 50200 µl of supernatant was added
to 6 ml of buffer in a thermostatted reaction vessel (4°C) and stirred
rigorously. The reaction was started by the addition of
CO2-saturated water, and the drop in pH (about 0.25 units) was
monitored by micro pH and reference electrodes (World Precision Instruments,
Sarasota, FL, USA) and a null-point pH meter. Protein concentration was also
measured in the supernatant by Coomassie Brilliant Blue dye binding (Bio Rad
Laboratories, Hercules, CA, USA), and CA activity was reported as µmol
CO2 mg protein1 min1.
Total RNA from anterior and posterior gills was isolated under RNAse-free conditions by phenolchloroform extraction (RNAgents, Promega, Madison, WI, USA). All dissecting equipment and homogenizers were cleaned with RNAse-zap (Ambion, Austin, TX, USA) and rinsed in RNAse-free water. RNA concentrations, purity and DNA contamination were monitored using a Bioanalyzer 2100 lab chip system (Agilent, Wilmington, DE, USA). Single stranded, complementary DNA was then produced from Poly-A mRNA in 2 µg of total RNA by reverse transcription using Superscript II reverse transriptase (Invitrogen, Carlsbad, CA, USA) and oligo dT as primer.
Degenerate primers were designed, and nucleotide sequence for CA was
obtained, exactly as previously described
(Henry et al., 2003
). Using
nucleotide sequence data obtained in this manner (data not shown) plus
existing sequence data (Henry et al.,
2003
), gene-specific primers were designed for C. maenas
branchial CA using Primer Premiere software. These primers are as follows:
168F: 5' CGC TCA GTT CCA CTT CCA 3'; 398R: 5' ACA TCT CAG
CAT CCG TCA 3'.
These primers were used to amplify the CA cDNA template for quantitative, real time PCR on a real-time PCR instrument (Stratagene MX 4000, Cedar Creek, TX, USA). The sample with the highest measured protein-specific CA activity was used to construct a standard curve consisting of amplification products generated from stepwise tenfold dilutions spanning four orders of magnitude (100 to 103). Concentrations of amplified CA cDNA were calculated using the standard curve and were reported on the basis of relative amounts.
In most studies of changes in gene expression, a `housekeeping' gene, such
as actin, is used as a control. This approach depends on the control gene
being expressed constituitively and being unresponsive to the experimental
treatment. However, the ion transporting gills in euryhaline species (lower
vertebrates and invertebrates) undergo complete molecular and ultrastructural
remodeling in response to low salinity, including increases in membrane and
cytoskeletal elements (e.g. Perry,
1997
; Luquet et al.,
2002
; Evans et al.,
2005
), making traditional housekeeping genes inappropriate in
these tissues.
The metabolic gene, arginine kinase (AK) was used instead of actin. AK
activity in the gills of green crabs was shown not to change with salinity
(Kotlyar et al., 2000
); and AK
mRNA expression, as measured with semi-quantitative PCR, was also shown to be
insensitive to low salinity exposure in both C. maenas and a closely
related species, the blue crab Callinectes sapidus
(Towle et al., 2001
;
Henry et al., 2003
). The
primers used for AK real time PCR in this study were as follows
(Towle et al., 2001
): AKF51:
GCTGAGTCTAAGAAGGGATT; AKCALLR1: CCCAGGCTTGTCTTCTTGTCC. Real time PCR was
performed, using Sybr green, on a Mini-Opticon (Bio Rad, Hercules, CA,
USA).
Branchial AK activity in posterior gills of blue crabs is sensitive to low salinity, however, and initial evidence obtained from real time PCR indicates that AK mRNA expression in posterior gills increases substantially in response to low salinity (fivefold; L. Serrano and R.P.H., unpublished data). It is therefore possible that in some species the salinity response of the posterior gills is so extensive that a traditional housekeeping gene may not exist. So in addition to a control gene, a control tissue, anterior gill, a tissue in which the salinity response is absent, was also used to follow both CA activity and mRNA abundance. This was done for two reasons: (1) to show that a gill that lacks induction of CA activity also lacks changes in CA mRNA abundance, and (2) to validate the use of a tissue control for gene expression studies in cases where a traditional housekeeping gene may be absent.
Hemolymph samples were thawed on ice, sonicated, and centrifuged at 14 000 g for 1 min to separate out clot material. Osmolality was then measured on 10 µl samples using a vapor pressure osmometer (Wescor 5100C, Logan, UT, USA).
Statistical analysis
Statistical analysis of the data was performed using Sigma Stat 2.0 (SPSS,
Chicago, IL, USA) and plotted using Sigma Plot 2001.
| Results |
|---|
|
|
|---|
|
In a separate experiment, injection of eyestalk extract into green crabs that had been subjected to ESA abolished the increase in CA activity. Again, there was no difference between anterior and posterior gills for crabs acclimated to 32 p.p.t. (P=0.83, t-test; Fig. 2). ESA alone resulted in an approximate 50% increase in CA activity in posterior gills (P<0.005, ANOVA and Tukey's post hoc comparison; Fig. 2). This increase was completely abolished by daily injections of extracts of eyestalks taken from crabs also acclimated to 32 p.p.t., as values from injected crabs were not significantly different from those of controls (P=0.10, Tukey's post hoc comparison). There was no difference in CA activity in G8 of sham-injected crabs vs controls (P=0.27, Tukey's post hoc comparison). Interestingly, while there was no difference in CA activity between G4 and G8 in 32 p.p.t.-acclimated crabs, there were slight but significant decreases in activity in G4 in both the sham-operated and eyestalk extract-injected crabs (P<0.01, KruskallWallace ANOVA in ranks and Dunn's post hoc comparison).
|
|
Transfer of green crabs from 32 to 10 p.p.t. salinity for a period of 7 days resulted in a greater than tenfold increase in CA activity in posterior gills (P<0.001, t-test; Fig. 3A). This was accompanied by an approximate sixfold increase in mRNA expression, again only in the posterior gill (P<0.001, t-test). For both CA activity and mRNA expression, there were no significant differences between values for anterior vs posterior gills in crabs acclimated to 32 p.p.t. (P=0.19 and 0.77, t-test, for activity and mRNA, respectively) or for anterior gills in crabs acclimated to 32 p.p.t. vs those transferred to 10 p.p.t. for 7 days (P=0.90 and 0.80, t-test, for activity and expression, respectively; Fig. 3A,B).
|
When intact crabs were transferred from 32 to 10 p.p.t., there was a large
increase in CA activity in the posterior gills which was inhibited by daily
injections of eyestalk extract (P<0.001, ANOVA and Tukey's
post hoc comparison; Fig.
4). In this group of crabs, transfer to 10 p.p.t. for 7 days
resulted in an eightfold increase in CA activity in the posterior gills
(Fig. 4). There was no
significant difference between CA activity in posterior gills of intact
vs sham-injected crabs (P=0.38, Tukey's post hoc
comparison). However, a daily injection of extract from eyestalks taken from
green crabs acclimated to 32 p.p.t. reduced normal CA induction by 60%
(P<0.001, Tukey's post hoc comparison;
Fig. 4). The inhibition was not
complete, however, as the CA activity in the posterior gills of the injected
crabs was still significantly higher (threefold) than that in the 32 p.p.t.
acclimated controls (P=0.003, Tukey's post hoc comparison).
In this experiment, while there was no difference between CA activity in
anterior vs posterior gills in crabs acclimated to 32 p.p.t., there
were significant differences among anterior gills as a result of the different
experimental treatments (P<0.001, ANOVA). Intact crabs transferred
to 10 p.p.t. for 7 days, and crabs given daily injections of eyestalk extract
both had slightly but significantly lower CA activity in the anterior gills
vs the 32 p.p.t. controls (P<0.05, Tukey's post
hoc comparison; Fig. 4).
This pattern has been reported previously for anterior gills of C.
maenas (Henry et al.,
2003
; Henry,
2005
), but there has never been an increase in CA activity, as a
result of low salinity exposure, in anterior gills.
|
|
Eyestalk ablation, either by itself or combined with injections of eyestalk extract, resulted in less than 5% mortality in green crabs.
Hemolymph osmolality was slightly but not significantly higher than ambient seawater in crabs acclimated to 32 p.p.t. After 7 days exposure to 10 p.p.t. salinity (307 mOsm kg1), hemolymph values in intact crabs were significantly higher by about 300 mOsm (P<0.001, t-test, Table 2). These values were not affected by either ESA, a single daily injection of eyestalk extract, or a combination of both treatments (P=0.79, ANOVA, Table 2).
|
As mentioned previously, a 7-day time course requires the use of a high number of animals, especially for experiments involving daily injections from groups of `donor' crabs. Because of this, CA activity and mRNA expression were measured after a 4-day time course in order to determine if the degree of CA induction was large enough, and the degree of subsequent inhibition of CA induction was great enough to be accurately measured by the electrometric pH assay to be used in these experiments. A 4-day exposure to 10 p.p.t. resulted in a 4.5-fold increase in CA activity in posterior gills (P<0.001, MannWhitney rank sum test; Fig. 6A) but caused no change in activity in anterior gills (P=0.86, MannWhitney). The same pattern was seen for CA mRNA expression. There was no difference between anterior and posterior gills in crabs acclimated to 32 p.p.t. (P=0.77, MannWhitney, Fig. 6B), and there was also no difference between anterior gills after 4 days exposure to 10 p.p.t. (P=0.68, MannWhitney). There was, however, a large (15-fold) increase in CA mRNA expression in posterior gills in response to a 4-day transfer to 10 p.p.t. (P=0.016, MannWhitney, Fig. 6B). The increase in CA activity was, as expected, smaller than that seen after 7 days (Fig. 3A vs Fig. 6A), but interestingly, the increase in CA mRNA expression was more than twice as large at 4 vs 7 days post-transfer (Fig. 3B vs Fig. 6B).
|
|
|
For both the 4-day and 7-day transfers to low salinity, the relative abundance of AK mRNA did not change (Fig. 9). There was no difference in AK mRNA levels between anterior and posterior gills in crabs acclimated to 32 p.p.t. (P=0.87, t-test), and there were no differences either among anterior (P=0.66, ANOVA) or posterior (P=0.72, ANOVA) gills at either 4 or 7 days post-transfer to 15 p.p.t. salinity.
|
|
| Discussion |
|---|
|
|
|---|
In a more detailed study (Henry et al.,
2006
), increases in both CA activity and CA protein concentrations
were shown to result from increases in relative CA mRNA abundance, strongly
suggesting that induction of CA activity is a direct result of increased CA
gene expression and protein synthesis. As such, measurements of CA activity
represent a good reporter system for changes in CA gene expression. The
results presented here confirm this relationship and further validate the use
of monitoring CA activity as a reporter assay for CA expression.
The patterns of induction of CA mRNA vs activity appear to be
different. CA mRNA increases within 24 h after low salinity transfer and
remains unchanged through 4 days, while CA activity begins to increase at
4872 h post-transfer and continues to increase through 7 days of low
salinity acclimation (Henry et al.,
2003
). CA activity remains elevated even after 14 days of low
salinity exposure (Henry et al.,
2002
). Quantitative changes in CA mRNA expression were followed
through 7 days of low salinity exposure in this study, and a significant
decrease was found relative to the value at 4 days
(Fig. 3B vs
Fig. 6B). These differences
suggest that the process of CA induction involves a rapid but perhaps
transient increase in CA mRNA, followed by a slower but more long lasting
increase in the synthesis of new CA protein. This potential relationship
deserves a more detailed, systematic investigation.
This study also extends transcriptional regulation of CA activity to other
treatments besides salinity. Specifically, the increase in CA activity as a
result of eyestalk ablation also appears to be rooted in changes in CA mRNA
expression. Furthermore, the increase in CA gene expression persists for at
least 7 days after ESA. CA has a very high turnover rate (106
molecules s1) (Maren,
1967
), and the enzyme is expressed in large excess of the
physiological processes it supports. Consequently, short-term regulation of CA
activity is rarely found in animal systems, primarily because it is not
believed to be necessary. It will be interesting to see if regulation of CA
activity through changes in gene expression represents a more widespread and
common mechanism, especially in tissues and cell types in which large changes
in activity occur.
It should be noted again that a typical control (`housekeeping') gene, such
as actin, was not used for comparison to CA in this study. However, the
expression of a common metabolic gene, arginine kinase, did not change in
either anterior or posterior gills in response to low salinity exposure.
Furthermore, there were also no changes in CA mRNA expression in the control
tissue, the anterior, respiratory gill (G4). This correlates with the lack of
induction of CA activity in this tissue. The posterior, ion-transporting gills
in euryhaline crustaceans undergo ultrastructural, biochemical, and molecular
changes during the process of low salinity adaptation, and so it is not
surprising that the expression of even some of the most commonly used
housekeeping genes (e.g. actin) also change (e.g.
Lovett et al., 2003
). Activity
of arginine kinase, which was also used as a control in a previous study of CA
expression using semi-quantitative PCR
(Henry et al., 2003
), does not
change in C. maenas but doubles in response to low salinity in
another euryhaline crab, Callinectes sapidus, and also changes in
Chasmagnathus granulatus (Kotylar et al., 2000;
Luquet et al., 2005
).
Furthermore, AK mRNA expression increases approximately fivefold in posterior
gills of C. sapidus in response to low salinity exposure (L. Serrano
and R.P.H., unpublished data). For salinity studies in crustaceans it may be
more accurate to look at changes in expression of the same gene in two
different tissues, especially if the two tissues are as closely related
physically but as different physiologically as anterior vs posterior
gills. This approach has also been used successfully in two other species of
euryhaline crabs. In Pachygrapsus marmoratus, the expression of the
Na+/K+/2Cl cotransporter was shown to
increase in response to low salinity in the posterior but not the anterior
gills (Spanings-Pierrot and Towle,
2004
), and in Chasmagnathus granulatus, both the
co-transporter and the Na+/K+-ATPase were shown to
increase in G7 but not G3 in crabs transferred to 10 p.p.t. salinity
(Luquet et al., 2003
). More
recently, Luquet et al. reported (Luquet
et al., 2005
) that the expression of the
Na+/K+-ATPase, arginine kinase, the
Na+/K+/2Cl co-transporter and the
V-Type ATPase all increased in anterior and posterior gills during the time
course of low salinity adaptation in C. granulatus. The increases in
anterior gills, however, were much less than in posterior gills, and they were
not consistent over every time period examined, in contrast to the increases
in posterior gills. Nevertheless, all studies on transport protein expression
have so far been descriptive; no attempt has been made to identify a mechanism
by which expression is regulated.
The results of the eyestalk ablation, injection, and salinity transfer
experiments represent the first evidence for the potential mechanism of
control of CA expression. For green crabs acclimated to 32 p.p.t., ESA
resulted in an approximate doubling of CA activity over a 7-day period, and
this increase was due to an increase in CA mRNA expression. The increase
reported here is approximately twice as large as that reported earlier from a
preliminary study (Henry et al.,
2003
). The occurrence of CA induction in response to ESA in the
absence of a low salinity stimulus suggests that expression is under
inhibitory regulation by a compound located in the eyestalk. This compound
would appear to function as a repressor, maintaining CA expression (and thus
CA activity) at baseline levels in crabs acclimated to high salinity. When the
eyestalks are removed, the putative repressor (or its effects) is also
removed, allowing CA expression to increase.
Eyestalk ablation is a coarse technique; it removes the entire sinus
gland/X-organ endocrine complex as well as neural input from the optical
plexus. Therefore, this procedure could potentially have more widespread
physiological effects on the crab than just altering CA expression. However,
it is doubtful that the resultant CA induction at 32 p.p.t. is a by-product of
some other, unrelated, endocrine change in the crab. The most likely artefact,
molting, can be ruled out. ESA is known to induce molting in crabs
(Mykles, 2001
), and branchial
CA activity has been shown to increase during pre-molt in a closely related
species, Callinectes sapidus
(Henry and Kormanik, 1985
),
but these two processes take place on different time scales. ESA-induced
molting takes on the order of weeks
(Mykles, 2001
), but
ESA-induced changes in CA expression in green crabs take place within
47 days. Furthermore, molting results in an increase in CA activity in
both anterior and posterior gills in both C. sapidus
(Henry and Kormanik, 1985
) and
C. maenas (R.P.H., unpublished data). Typical values for CA activity
in anterior gills of intermolt green crabs are in the range of 80150
µmol CO2 mg protein1 min1,
and these values more than double in pre-molt crabs. In our experiments, CA
activity in anterior gills is used as a diagnostic indicator of the early
stages of pre-molt; any crabs that have CA activity greater than 250 µmol
CO2 mg protein1 min1 are
considered to be in pre-molt and are excluded from the data set.
One more experimental piece of evidence also suggests that CA induction, as
a result of ESA, is the result of an endocrine or neuroendocrine compound
found in the eyestalk. Injection of eyestalk extract completely abolished the
ESA-induced CA induction in high salinity acclimated crabs. Organ ablation, to
induce a treatment effect, coupled with injection of organ extract to abolish
that effect, is the classical endocrinological approach to demonstrate the
presence of a hormone, and the evidence presented here points to the presence
of a CA repressor in the eyestalks of the green crab. Eyestalk ablation in the
absence of a low salinity stimulus also results in CA induction in blue crabs
(Henry and Borst, 2006
),
suggesting that inhibitory regulation of CA expression could be a common
mechanism in crustaceans. It should be noted that while changes in CA activity
are correlated with changes in CA mRNA abundance, it cannot be stated with
absolute certainty whether the putative CA repressor acts at the level of
transcription or translation. That question is currently under
investigation.
In addition to abolishing the ESA-stimulated CA induction at 32 p.p.t.,
injection of eyestalk extract into intact or eyestalk ablated green crabs
inhibits the normal low salinity mediated CA induction, either over a 4- or
7-day time course. This further strengthens the hypothesis that CA induction
is under inhibitory control by a repressor substance found in the eyestalk.
From the current evidence, it would appear that CA expression in high salinity
acclimated crabs is kept at low, baseline levels by the presence and action of
a CA repressor, found in the eyestalk. At the critical low salinity at which
the crab makes the transition from osmoconformity to osmoregulation (27
p.p.t.) (Henry, 2005
), the
repressor, or its effect, is removed, allowing CA induction to occur. Adding
this substance back, through the injections of eyestalk extract, prevents that
induction.
The majority of studies on the regulation of transport proteins have up
until now focused on compounds or regulatory agents that stimulate ion uptake
or specific proteins such as the Na+/K+-ATPase.
Furthermore, these regulatory agents appear to function in the rapid,
short-term modulation of activity of existing enzyme, and not in long-term
changes in expression (Savage and
Robinson, 1983
; Sommer and
Mantel, 1988
; Morohashi et
al., 1991
; Eckhardt et al.,
1995
; Lucu and Flik,
1999
; Spanings-Pierrot et al.,
2000
; Serrano et al.,
2003
). More recent studies have shown, however, that transport
protein expression does change in response to low salinity exposure (e.g.
Towle et al., 2001
;
Luquet et al., 2005
), but the
mechanism by which changes in expression are regulated has not been examined.
This is the first report of the upregulation of a transport protein being
controlled by inhibition (repression) of expression at high salinity and the
removal of that repression, rather than activation of expression, at low
salinity. The natural state of CA at high salinity appears to be under
repressor control. Rather than being activated, the inhibition of CA
expression is released in response to low salinity, allowing CA induction to
proceed.
That inhibitory regulation of CA expression should be found is not that
surprising. This is a similar mechanism to those found for endocrine control
of other physiological processes in crustaceans. Molting, vitellogenesis, and
the function of the mandibular gland are all known to be under inhibitory
regulation by neuropeptides found in the sinus gland of the eyestalk. These
hormones, molt inhibiting hormone (MIH), vitellogenesis inhibiting hormone
(VIH) and mandibular organ inhibiting hormone (MOIH), are all inhibitory
neuropeptides belonging to the crustacean hyperglycemic hormone (CHH) family
(Chang, 2001
). From a purely
functional standpoint, it is therefore plausible that the putative CA
repressor could also be a related inhibitory neuropeptide. This possibility is
currently being investigated.
Finally, these results address the fundamental question of the necessity of
CA induction during low salinity adaptation. Branchial CA activity, even in
crabs acclimated to high salinity, is in excess of branchial ion transport
rates in crabs transferred to low salinity
(Henry, 2001
), yet CA activity
is induced to a higher degree than that of other transport proteins. Based
solely on turnover rate and transport kinetics, CA induction is theoretically
not needed to maintain the supply of counterions for Na+ and
Cl uptake. Yet, experimental evidence indicates CA induction
is, in fact, necessary. When CA induction was inhibited up to 50% by injection
of eyestalk extract, hemolymph osmolality was unaffected. However, when crabs
were injected with twice the normal dosage of eyestalk extract, CA induction
was reduced by 66% and hemolymph osmolality was significantly depressed as
well. This strongly suggests that below a certain level of induction, CA
activity cannot support the levels of ion uptake needed to maintain hemolymph
osmolality at normal levels above ambient. One potential answer, which is
speculative at this point, may be that the ion uptake process, which takes
place at the apical branchial membrane, is limited by the intracellular
diffusion of H+ and HCO3. High levels
of CA may be necessary to keep the supply of counterions from being limiting
in the intracellular boundary layer of the gill. Boundary layers are known to
function as separate fluid compartments, especially with regard to diffusive
transport (e.g. Gutknecht et al.,
1977
), and membrane CA is believed to facilitate both
CO2 and NH3 transport
(Henry, 1996
). This has not
been proven yet, but circumstantial evidence tends to support this idea.
Cytoplasmic CA in fish gills appears to be concentrated close to the apical
membrane (Conley and Mallatt,
1988
), and CA is directly coupled to the band-3 anion exchange
protein in the membrane boundary layer of red blood cells to facilitate
Cl/HCO3 exchange
(Sterling et al., 2001
). It is
not implausible to suggest that the high levels of branchial cytoplasmic CA
are necessary to supply counterions to transporters located within the gill
boundary layer.
In summary, CA induction is a function of changes in CA mRNA expression, and the process appears to be under regulatory control by the major endocrine complex of the crab, the eyestalk. The mechanism of regulation of CA expression is under negative control by a CA repressor, possibly an inhibitory neuropeptide, located in the eyestalk.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bottcher, K., Siebers, D. and Becker, W. (1990). Carbonic anhydrase in branchial tissues of osmoregulating shore crabs, Carcinus maenas. J. Exp. Zool. 255,251 -261.[CrossRef]
Cameron, J. N. (1979). Effects of inhibitors on
ion fluxes, trans-gill potential and pH regulation in freshwater blue crabs,
Callinectes sapidus. J. Comp. Physiol. B133
, 219-225.
Chang, E. (2001). Crustacean hyperglycemic hormone family: old paradigms and new perspectives. Am. Zool. 41,380 -388.
Conley, D. M. and Mallatt, J. (1988). Histochemical localization of Na+-K+ ATPase and carbonic anhydrase activity in gills of 17 fish species. Can. J. Zool. 66,2398 -2405.
Eckhardt, E., Pierrot, C., Thuet, P., Van Herp, F., Charmantier-Daures, M., Trilles, J.-P. and Charmantier, G. (1995). Stimulation of osmoregulating processes in the perfused gill of the crab Pachygrapsus marmoratus (Crustacea, Decapods) by a sinus gland peptide. Gen. Comp. Endocrinol. 99,169 -177.[CrossRef][Medline]
Evans, D. H., Piermarini, P. M. and Choe, K. P.
(2005). The multifunctionalfish gill: dominant site of gas
exchange, osmoregulation, acid-base regulation, and excretion of nitrogenous
waste. Physiol. Rev. 85,97
-177.
Gutknecht, R. A., Bisson, M. A. and Tosteson, F. C. (1977). Diffusion of carbon dioxide through lipid bilayer membranes: effects of carbonic anhydrase, bicarbonate, and unstirred layers. J. Gen. Physiol. 69,779 -794.
Henry, R. P. (1984). The role of carbonic anhydrase in blood ion and acid-base balance. Am. Zool. 24,241 -253.
Henry, R. P. (1988). Subcellular distribution of carbonic anhydrase activity in the gills of the blue crab, Callinectes sapidus. J. Exp. Zool. 245,1 -8.[CrossRef]
Henry, R. P. (1991). Techniques for measuring carbonic anhydrase in vitro: the electrometric delta pH and the pH stat methods. In The Carbonic Anhydrases: Cellular Physiology and Molecular Genetics (ed. S. F. Dodgson, R. E. Tashian, G. Gros and N. D. Carter), pp. 119-126. New York: Plenum.
Henry, R. P. (1996). Multiple roles of carbonic anhydrase in cellular transport and metabolism. Annu. Rev. Physiol. 58,523 -538.[CrossRef][Medline]
Henry, R. P. (2001). Environmentally mediated carbonic anhydrase induction in the gills of euryhaline crustaceans. J. Exp. Biol. 204,991 -1002.[Abstract]
Henry, R. P. (2005). Critical salinity, sensitivity, and commitment of salinity-mediated carbonic anhydrase induction in the gills of two euryhaline species of decapod crustaceans. J. Exp. Zool. A Comp. Exp. Biol. 303,45 -56.[Medline]
Henry, R. P. and Borst, D. W. (2006). Effects of eystalk ablation on carbonic anhydrase activity in the euryhaline blue crab, Callinectes sapidus: neuroendocrine control of enzyme expression. J. Exp. Zool. A Comp. Exp. Biol. 305, 23-31.[Medline]
Henry, R. P. and Cameron, J. N. (1982a). The
distribution and partial characterization of carbonic anhydrase in selected
aquatic and terrestrial decapod crustaceans. J. Exp.
Zool. 221,309
-321.
Henry, R. P. and Cameron, J. N. (1982b).
Acidbase balance in Callinectes sapidus during acclimation
from high to low salinity. J. Exp. Biol.
101,255
-264.
Henry, R. P. and Cameron, J. N. (1983). The
role of carbonic anhydrase in respiration, ion regulation, and acidbase
balance in the aquatic crab Calllinectes sapidus and the terrestrial
crab Gecarcinus lateralis. J. Exp. Biol.
103,205
-223.
Henry, R. P. and Kormanik, G. A. (1985). Carbonic anhydrase activity and calcium deposition during the molt cycle of the blue crab, Callinectes sapidus. J. Crust. Biol. 5, 234-241.[CrossRef]
Henry, R. P. and Watts, S. A. (2001). Early carbonic anhydrase induction in the gills of the blue crab, Callinectes sapidus, during low salinity acclimation is independent of ornithine decarboxylase activity. J. Exp. Zool. 289,350 -358.[CrossRef][Medline]
Henry, R. P. and Wheatly, M. G. (1988). Dynamics of salinity adaptations in the euryhaline crayfish, Pacifasticus leniusculus. Physiol. Zool. 61,260 -271.[CrossRef][Medline]
Henry, R. P., Campoverde, M. and Borst, D. (2000). Effects of eyestalk ablation on carbonic anhydrase activity in the gills of Carcinus maenas and Cancer irroratus.Bull. Mt. Desert Isl. Biol. Lab. Salisb. Cove Maine 39, 21-22.
Henry, R. P., Garrelts, E. E., McCarty, M. M. and Towle, D. W. (2002). Differential induction of branchial carbonic anhydrase and Na+/K+ ATPase activity in the euryhaline crab, Carcinus maenas, in response to low salinity exposure. J. Exp. Zool. 292,595 -603.[CrossRef][Medline]
Henry, R. P., Gehnrich, S., Weihrauch, D. and Towle, D. W. (2003). Salinity-mediated carbonic anhydrase induction in the gills of the euryhaline green crab, Carcinus maenas. Comp. Biochem. Physiol. 136A,243 -258.[CrossRef][Medline]
Henry, R. P., Thomaston, K. L. and Towle, D. W. (2006). Quantitative changes in branchial carbonic anhydrase activity and expression in the euryhaline green crab, Carcinus maenas, in response to low salinity exposure. J. Exp. Zool. In Press.
Kirschner, L. B. (1979). Control mechanisms in crustaceans and fishes. In Mechanisms of Osmoregulation in Animals: Maintenance of Cell Volume (ed. R. Gilles), pp.157 -222. New York: J. Wiley and Sons.
Kotlyar, S., Weihrauch, D., Paulsen, R. S. and Towle, D. W. (2000). Expression of arginine kinase enzymatic activity and mRNA in gills of the euryhaline crabs Carcinus maenas and Callinectes sapidus. J. Exp. Biol. 203,2395 -2404.[Abstract]
Lovett, D. L, Tanner, C. A., Ricart, T. M. and Towle, D. W. (2003). Modulation of Na+,K+-ATPase expression during acclimation to salinity change in the blue crab, Callinectes sapidus. Bull. Mt. Desert Isl. Biol. Lab. Salisb. Cove Maine 42,83 -84.
Lucu, C. and Flik, G. (1999).
Na+-K+-ATPase and Na+/Ca2+
exchange activities in gills of hyperregulating Carcinus maenas.Am. J. Physiol. 276,R490
-R499.
Luquet, C. M., Genovese, G., Rosa, G. A. and Pellerano, G. N. (2002). Ultrastructural changes in the gill epithelium of the crab Chasmagnathus granulatus (Decapoda: Grapsidae) in diluted and concentrated seawater. Mar. Biol. 141,753 -760.[CrossRef]
Luquet, C., Senek, M. and Towle, D. W. (2003). Na+/K+/2Cl cotransporter and Na+ K+-ATPase mRNA expression in the South American rainbow crab (Chasmagnathus granulatus) after acclimation to low and high salinity. Bull. Mt. Desert Isl. Biol. Lab. Salisb. Cove Maine 42,63 .
Luquet, C. M., Weihrauch, D., Senek, M. and Towle, D. W.
(2005). Induction of branchial ion transporter mRNA expression
during acclimation to salinity change in the euryhaline crab Chasmagnathus
granulatus. J. Exp. Biol.
208,3627
-3636.
Maren, T. H. (1967). Carbonic anhydrase:
chemistry, physiology and inhibition. Physiol. Rev.
47,595
-781.
Morohashi, M., Tsuchiya, K., Mita, T. and Kawamura, M. (1991). Identification of (Na,K) ATPase inhibitor in brine shrimp Artemia salina, as long-chain fatty acids. J. Comp. Physiol. B 161,69 -72.[CrossRef][Medline]
Mykles, D. L. (2001). Interactions between limb regeneration and molting in decapod crustaceans. Am. Zool. 41,399 -406.[CrossRef]
Perry, S. F. (1997). The chloride cell: Structure and function in the gills freshwater fishes. Annu. Rev. Physiol. 59,325 -347.[CrossRef][Medline]
Pillar, S. C., Henry, R. P., Doeller, J. E. and Kraus, D. W. (1995). A comparison of the gill physiology of two euryhaline crab species, Callinectes sapidus and Callinectes similis: energy production, transport-related enzymes, and osmoregulation as a function of acclimation salinity. J. Exp. Biol. 198,349 -358.
Savage, J. P. and Robinson, G. D. (1983). Inducement of increased gill Na+-K+ ATPase activity by a hemolymph factor in hyper-osmoregulating Callinectes sapidus. Comp. Biochem. Physiol. 75A,65 -69.[CrossRef]
Serrano, L., Gaelle, B., Soyez, D., Charmantier, G., Grousset,
E., Aujoulat, F. and Spanings-Pierrot, C. (2003).
Putative involvement of crustacean hyperglycemic hormone isoforms in the
neuroendocrine mediation of osmoregulation in the crayfish Astacus
leptodactylus. J. Exp. Biol.
206,979
-988.
Sommer, M. J. and Mantel, L. H. (1988). Effect of dopamine, cyclic AMP, and pericardial organs on sodium uptake and Na/K ATPase activity in gills of the green crab Carcinus maenas. (L). J. Exp. Zool. 248,272 -277.[CrossRef]
Spanings-Pierrot, C. and Towle, D. W. (2004). Salinity-related expression of the Na+/K+/2Clcotransporter and V-type H+-ATPase in gills of the euryhaline crab, Pachygrapsus marmoratus. Bull. Mt. Desert Isl. Biol. Lab. Salisb. Cove Maine 43,6 -8.
Spanings-Pierrot, C., Soyez, D., Van Herp, F., Gompel, M., Skaret, G., Grousset, E. and Charmantier, G. (2000). Involvement of crustacean hyperglycemic hormone in the control of gill ion transport in the crab Pachygrapsus marmoratus. Gen. Comp. Endocrinol. 119,340 -350.[CrossRef][Medline]
Sterling, D., Reithmeier, R. A. F. and Casey, J. R. (2001). A transport metabolon: functional interaction of carbonic anhydrase II and chloride/bicarbonate exchangers. J. Biol. Chem. 2761,47886 -47894.
Towle, D. W., Paulsen, R. S., Weihrauch, D., Kordylewski, M.,
Salvador, C., Lignot, J.-H. and Spanings-Pierrot, C.
(2001). Na++K+-ATPase in gills of the blue
crab Callinectes sapidus: cDNA sequencing and salinity-related
expression of
-subunit mRNA and protein. J. Exp.
Biol. 204,4005
-4012.
Wheatly, M. G. and Henry, R. P. (1987).
Branchial and antennal gland Na+/K+-dependent ATPase and
carbonic anhydrase activity during salinity acclimation of the euryhaline
crayfish Pacifastacus leniusculus. J. Exp. Biol.
133, 73-86.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
L. Serrano, K. M. Halanych, and R. P. Henry Salinity-stimulated changes in expression and activity of two carbonic anhydrase isoforms in the blue crab Callinectes sapidus J. Exp. Biol., July 1, 2007; 210(13): 2320 - 2332. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||