|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online January 25, 2005
Journal of Experimental Biology 208, 433-438 (2005)
Published by The Company of Biologists 2005
doi: 10.1242/jeb.01420
Pigmentation in the sensory organs of the ascidian larva is essential for normal behavior
1 Department of Molecular, Cellular and Developmental Biology, University of
California, Santa Barbara, California 93106, USA
2 Department of Life Science, Graduate School of Life Science, University of
Hyogo, 3-2-1 Kouto, Kamigori, Ako-gun, Hyogo 678-1297, Japan
Author for correspondence (e-mail: w_smith{at}lifesci.ucsb.edu)
Accepted 1 December 2004
| Summary |
|---|
|
|
|---|
Key words: ascidian, pigmentation, melanin, settlement, behavior, ocellus, otolith
| Introduction |
|---|
|
|
|---|
The behavior of the ascidian larva has long been of interest to ecologists
and developmental biologists (Svane and
Young, 1989
). Early work on ascidian larvae described conserved
phototactic and geotactic behaviors across the majority of ascidian species.
Free-swimming larvae are geonegative for the majority of the larval dispersal
period until shortly before settlement, when they begin to swim towards
gravity. The larvae become photosensitive
4 h after hatching, responding
to decreased light intensity by swimming more actively and seeking out shaded
locations (Svane and Young,
1989
). Recent work has suggested that the pigmented cells of the
ocellus and otolith are necessary for sensing light and gravity, respectively,
although the role of the pigment itself, particularly in gravity sensation is
unresolved (Sakurai et al.,
2004
; Tsuda et al.,
2003c
). The development of these cells has been studied
extensively, and the lineage, structure and melanogenesis are well understood
(Dilly, 1962
;
Dilly, 1964
;
Nishida and Satoh, 1989
;
Sato and Yamamoto, 2001
;
Whittaker, 1966
). However, a
direct proof for the essential role of pigmentation in ascidian larval
physiology is still lacking. We describe here two mutant lines of C.
savignyi that are unable to make melanin, and thus lack pigment in the
larval sensory structures. The absence of melanin results in profound
behavioral abnormalities in mutant larvae.
| Materials and methods |
|---|
|
|
|---|
60%)
of the wild-collected C. savignyi produce self-fertilized broods when
spawned in this way. Self-fertilized eggs were collected from the cups and
cultured at 18°C in 15 mm x 60 mm dishes containing 20 ml seawater
with 50 mg ml-1 of kanamycin and streptomycin. Hatched larvae,
24 h post-fertilization, were screened for developmental defects. Those
adults producing broods with developmental defects (including the unpigmented
lines described here) were crossed to wild-type adults to produce a second
heterozygous generation that was again screened for the phenotype.
spotless
The mutant line spotless was identified in a screen for
ethylnitroso urea (ENU)-induced mutations (Sigma, St Louis, MO, USA). The ENU
treatment was essentially as described before
(Moody et al., 1999
), with
minor modifications. Briefly, animals to be mutagenized were first screened
for pre-existing recessive mutations by self-fertilization (see above).
Animals that did not carry obvious recessive mutations were injected with 50
µl of 100 mmol l-1 ENU into the gonads and then incubated in
seawater containing 3 mmol l-1 ENU for 1 h. This treatment was
performed once a week for 3 weeks. Animals that survived treatment were
allowed to recover for 3 weeks. Sperm from ENU-treated animals was collected
by dissection and used to cross to wild-type eggs to generate an F1
generation. F2 broods produced by self-fertilization from each
F1 individual were screened for developmental phenotypes.
F1 adults potentially carrying recessive mutations of interest were
crossed to wild-type animals and the progeny re-screened.
Imaging and immunohistochemical staining
Larvae were mounted on glass slides either alive or fixed in 10% formamide
in seawater. Images of the ocellus and otolith were taken at 630x or
1000x magnification on an Isoskope 2 binocular microscope (Carl Zeiss,
Jena, Germany). Wild-type and mutant larvae were fixed in 10% formaldehyde in
sea water at 4°C for 3 h, washed in phosphate-buffered saline (PBS) + 0.1%
Triton X-100 and dehydrated to 80% ethanol. Larvae were then stained using
antibodies against Ci-opsin1 and Ci-arrestin as described
previously (Tsuda et al.,
2003b
).
Behavioral assays
Geotaxis
Wild-type and pigmentation mutant embryos were raised at 18°C in the
dark. Newly hatched larvae, or embryos just before hatching, were transferred
to a 15 cm Petri dish containing 60 ml filtered seawater with antibiotics. A
second Petri dish was suspended on top of the first dish at a height of 1 cm
to sandwich the larvae between two potential settling surfaces. Larvae were
incubated for 24 h at 18°C in the dark. At the end of the incubation,
larvae attached to the top or bottom of the dish were counted.
Phototaxis
Wild-type and mutant embryos were raised at 18°C in the dark until
hatching. The newly hatched larvae were transferred to one half of a 15 cm
Petri dish that was shaded with black tape and aluminum foil, while the other
half was left transparent. The apparatus was maintained at 18°C and
continuously illuminated from above. After 24 h, larvae attached to the light
or shaded areas were counted.
Tyrosinase assay
Wild-type and mutant larvae were fixed in cold 70% ethanol at 4°C for 1
h. Larvae were incubated in 4 mmol l-1
KH2PO4, 11 mmol l-1
Na2HPO4 with or without 3.8 mmol l-1
L-dopa (Sigma) for 4 h. Unreacted L-dopa was removed by
soaking in 70% ethanol for 6 h at room temperature before imaging.
Genetics
The sequence of C. savignyi tyrosinase was identified by a
translated BLAST search of the C. savignyi genome
(http://www.broad.mit.edu/annotation/ciona/index.html)
using the Halocynthia roretzi tyrosinase protein sequence. Specific
primers, 5' TCAGCCCAGTTTCCAAGGAGG and 3' AGAGCAGCAGCTCTGTTTTCT,
were used to isolate Cs-tyrosinase cDNA from both wild-type and
spotless embryo total RNA and cloned into pCR II (Invitrogen,
Carlsbad, CA, USA). DNA sequencing was performed using the ABI Big Dye
Terminator Sequencing Kit at the Iowa State University sequencing facility.
The identified mutation was then confirmed by sequencing the genomic region
isolated from spt by PCR and cloned into pCR II (PCR primers: '
CAACTTCACCATGTTCAGGACAGTGTTACCAG and 3'
CTGTGCAGGCTGATACAATGTCCTGTCGCCCC; sequencing primer: GTCCTATCTGCCGTTGCG).
Rescue
A 10.5 kb genomic fragment containing the C. savignyi tyrosinase
gene and ' flanking DNA extending to the start of the immediate upstream
putative gene was amplified by PCR (primers: '
GGCATTTCATGTGAAGTGATTGATATGGTGACC and 3'
GGGGCGACAGGACATTGTATCAGCCTGCACAG) using LA Taq (Takara, Shiga, Japan) from
wild-type genomic DNA. The PCR product was cloned into pCR-XL-TOPO
(Invitrogen, Carlsbad, CA, USA). This plasmid was electroporated (100
µg/electroporation) into fertilized eggs from crossed spt
homozygous adults as previously described
(Corbo et al., 1997
). The
electroporated embryos were allowed to develop to the swimming tadpole stage
according to standard protocols.
| Results |
|---|
|
|
|---|
|
The pigmented structures seen in normal larvae
(Fig. 2A) are components of two
sensory organs, the otolith and the ocellus, found within the sensory vesicle.
The otolith is composed of a large spherical cell attached to the ventral wall
of the sensory vesicle by a narrow stalk. It contains a single pigment granule
that occupies most of the cell body. The ocellus lies posterior to the otolith
along the dorsal wall of the sensory vesicle. It is composed of three lens
cells, a single cup-shaped cell containing numerous small pigment granules and
15-20 photoreceptor cells (Dilly,
1962
; Dilly, 1964
;
Eakin and Kuda, 1971
;
Sakurai et al., 2004
). In both
mutants, Nomarski imaging indicated these structures are properly formed
despite the absence of pigment (Fig.
2B-G). The structure of the ocellus in both mutants was also
assessed by immunostaining with antibodies to opsin1 and arrestin, which stain
the outer segments of the photoreceptors and the entire photoreceptor cell
body, respectively. The staining patterns with these antibodies were
indistinguishable between the mutants and the wild type
(Fig. 3).
|
|
Complementation assays indicated that imc and spt
disrupted different genes. Furthermore, while we were unable to detect any
pigmentation in spt larvae, a trace amount of melanin could be
detected in the ocellus, but not the otolith, of imc embryos when
examined at high magnification, also suggesting that the two mutations may
disrupt different steps in melanin biosynthesis
(Fig. 2E). Tyrosinase (dopa
oxidase) has been shown to be the key enzyme necessary for melanogenesis in
the ascidian pigment cells. It is known to oxidize both L-tyrosine
and L-dopa to produce dopaquinone, which in turn spontaneously
forms insoluble melanin (Whittaker,
1966
). Homozygous mutant larvae were assayed for tyrosinase
activity by soaking them in exogenous L-dopa
(Whittaker, 1966
). In this
assay, melanin could be detected in both the ocellus and otolith of
imc larvae, indicating the presence of tyrosinase activity
(Fig. 4B). Additionally, the
level of tyrosinase gene expression as detected by in situ
hybridization in imc larvae was indistinguishable from wild type
(data not shown). spt larvae, however, failed to synthesize melanin
in the presence of L-dopa (Fig.
4C). This suggests that the pigmentation defect in spt is
due to a deficiency in tyrosinase activity, while imc is a defect in
some unknown aspect of the pigmentation process, most probably upstream of
tyrosinase.
|
Three tyrosinase-like genes, tyrosinase and tyrosinase-related proteins 1
and 2, are found in the C. savignyi genome. cDNAs for all three genes
were sequenced from homozygous imc embryos, and no significant
differences from the nucleotide sequence provided by the C. savingyi
genome project were found (data not shown). However, sequencing of a
tryrosinase cDNA from homozygous spt larvae uncovered a single
nucleotide substitution that results in a premature stop codon before two
copper binding sites known to be essential for tyrosinase function
(Oetting and King, 1999
)
(Fig. 5A). The presence of the
nucleotide substitution was confirmed by sequencing a genomic fragment
PCR-amplified from homozygous spt DNA. To confirm that the mutant
tyrosinase gene was responsible for the spt phenotype, a 10.5 kb
genomic DNA fragment containing the wild-type tyrosinase gene and its upstream
region was electroporated into spt homozygous embryos.
Electroporation into Ciona typically results in variable uptake of
exogenous DNA. In the brood of electroporated spt homozygous embryos,
we observed a range of phenotypes from no pigmentation, to pigmentation of
only one of the sensory organs, to pigmentation of both sensory organs
(Fig. 5B,C). The ability of the
electroporated genomic fragment to rescue pigmentation led us to conclude that
the spt phenotype was due to the mutation of the tyrosinase gene.
|
The major purposes of the shorted-lived larval stage of ascidians is first
dispersal, then selecting an appropriate settling site, and finally
attachment. To test the role of pigmentation in the behavior of the larvae, we
assayed for final settling position on substrates in different gravitational
orientations, and in light and dark environments. Ciona larvae become
photosensitive
4 h after hatching, as indicated by their vigorous swimming
response to shade (Mast, 1921
;
Nakagawa et al., 1999
). We
subjected imc and spt larvae to repeated exposures of bright
and dim light and found that, like wild type, their swimming frequency
increased in dim light (data not shown). To assay for phototaxis, larvae from
crossed heterozygous imc or crossed heterozygous spt were
placed in the shaded half of a half-shaded, half-illuminated 15 cm Petri dish
(Fig. 6A,B). The larval broods,
which consisted of both pigmented and unpigmented offspring of the
heterozygous parents, were allowed to settle for 24 h. The number of
non-pigmented offspring (homozygous mutant) and their pigmented siblings
(heterozygous and homozygous wild type) that had settled on the dark and
illuminated sides of the dish were counted. Pigmented larvae preferentially
settled on the shaded side (81.3% and 81.9% for the spt and
imc experiments, respectively), while neither homozygous imc
nor spt larvae showed preference for shaded over illuminated areas,
settling in the shaded area at the frequencies of 49.4% and 54.4%,
respectively (Fig. 6D,E).
Unpigmented larvae showed no deficiency in their ability to swim, and the
assay used required larvae to swim from the shaded areas before settling in
the illuminated half. This result suggests that non-pigmented larvae are
unable to detect the source of light, and consequently are unable to seek out
the shaded location preferred by their wild-type siblings.
|
In a second experiment, the geotactic behavior of the non-pigmented mutants was assayed. Newly hatched larvae from crossed heterozygous imc or crossed heterozygous spt adults were placed into an apparatus that would allow attachment either to the bottom of the lower dish or to the underside of a floating dish (Fig. 6C). The apparatus was kept in the dark for 24 h to allow larvae to settle. Pigmented larvae from the crossed heterozygous imc and spt adults attached to the upper dish at a frequency of 85.7% and 80.2%, respectively. In contrast, homozygous imc and spt larvae settled at the top of the apparatus at frequencies of only 13.5% and 30.9%, respectively (Fig. 6F,G). One would expect the majority of larvae that were indifferent to gravity to settle to the bottom, as we observed. Our data demonstrate that the pigmentation is essential for the negative geotactic behavior of Ciona larvae.
| Discussion |
|---|
|
|
|---|
Although the ascidian visual system is remarkably simple, it nevertheless
bears many similarities to vertebrate eyes. As in the vertebrate eye, light
traveling through the ascidian lens cells is focused onto the outer segments
of the photoreceptor cells. The eye socket in the vertebrate skull acts to
restrict the angle of light able to pass through the lens and onto the retina.
In addition, the retinal pigmented epithelia in vertebrate eyes absorb any
stray light that has passed through the photoreceptors, thereby preventing
visual over-stimulation. In contrast to vertebrates, the ascidian larva is
completely transparent. In order to detect the direction of light, the
ascidian larvae must restrict the angle of light that gains access to the
photoreceptor cells. The cup-shaped pigment cell of the ascidian ocellus
surrounds the outer segments of the photoreceptor cells and restricts light
intake to a single direction. This restriction of light, along with the
spiraling motion while swimming, allows the larvae to determine the direction
of light input (Mast, 1921
).
Our pigmentation mutants demonstrate the essential role of pigmented cells in
detecting the direction of light. Our assay is different from the `shadow
response' assays employed in previous behavioral studies of ascidian larvae
(Mast, 1921
;
Nakagawa et al., 1999
;
Tsuda et al., 2003a
). Some
investigators placed emphasis on this response in the context of the search
for a dark or shaded location to settle
(Svane and Young, 1989
).
However, other studies have challenged the importance of the shadow response
by showing that fluctuating light was insufficient to induce tadpoles to
locate shaded habitats in most of the solitary ascidian species tested
(Young and Chia, 1985
).
Therefore, how ascidians seek out dark places to settle remains unknown.
The second behavioral characteristic of free-swimming ascidian larvae is
their sensitivity to gravity. Strong negative geotaxis exhibited during the
greater part of the swimming period is thought to contribute to the dispersal
of progeny (Millar, 1971
). It
has been suggested that the pigmented vesicle within the otolith moves in
response to gravitational forces, thereby deforming the cell body and
stimulating spring-like structures that extend from the sensory vesicle wall
and attach to the otolith near the stalk
(Dilly, 1962
;
Eakin and Kuda, 1971
;
Sakurai et al., 2004
). Here we
show C. savignyi larvae lacking pigmentation do not behave properly
in response to gravity. Our results show unequivocally that the melanization
of tyrosine within the granule of the otolith is essential in this process.
While melanin itself is insoluble and heavier than water, the otolith has also
been shown to concentrate metal ions, which may contribute to its density
(Sakurai et al., 2004
).
Previous studies have demonstrated that the content of the otolith is denser
than the rest of the body (Dilly,
1962
). We propose that the greater density achieved by
melanization of tyrosine provides the crucial mass needed for the otolith
vesicle to be efficiently influenced by gravitational forces.
Since gravity is a universal cue on earth, many organisms, from single
cells to metazoans, utilize different georeceptors to orient themselves and to
navigate. The calcareous statolith in ctenophores, calcium carbonate
inclusions in snails, air bubbles trapped in certain passageways in a number
of aquatic insects, and fluid flow in the mammal inner ear represent a few
strategies that animals use in receiving the gravitational pull
(Anken and Rahmann, 2002
;
Brusca and Brusca, 2003
). The
use of melanin in geotaxis has not been found in other metazoans, and thus
appears to be unique to ascidians. How the melanization biochemical pathway
was co-opted into the otolith is unknown.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Anken, R. H. and Rahmann, H. (2002). Gravitational zoology: how animals use and cope with gravity. In Astrobiology. The Quest for the Conditions of Life (ed. G. Horneck and C. Baumstark-Khan), pp.315 -333.Berlin: Springer.
Brusca, R. C. and Brusca, G. J. (2003). Invertebrates. Sunderland, USA: Sinauer Associates.
Corbo, J. C., Levine, M. and Zeller, R. W. (1997). Characterization of a notochord-specific enhancer from the Brachyury promoter region of the ascidian, Ciona intestinalis.Development 124,589 -602.[Abstract]
Dilly, P. N. (1962). Studie on the receptors in the cerebral vesicle of the ascidian tadpole. I. The otolith. Q. J. Microsc. Sci. 103,393 -398.
Dilly, P. N. (1964). Studie on the receptors in the cerebral vesicle of the ascidian tadpole. II. The ocellus. Q. J. Microsc. Sci. 105,13 -20.
Eakin, R. M. and Kuda, A. (1971). Ultrastructure of sensory receptors in ascidian tadpoles. Z. Zellforsch. 112,287 -312.[Medline]
Mast, S. O. (1921). Reactions to light in the larvae of the ascidians, Amaroucium constellatum and Amaroucium pellucidum with special reference to photic orientation. J. Exp. Zool. 34,148 -187.
Millar, R. H. (1971). The biology of ascidians. In Advances in Marine Biology, vol.9 (eds. F. S. Russel and M. Yonge), pp.1 -100.New York: Academic Press.
Moody, R., Davis, S. W., Cubas, F. and Smith, W. C. (1999). Isolation of developmental mutants of the ascidian Ciona savignyi. Mol. Gen. Genet. 262,199 -206.[CrossRef][Medline]
Nakagawa, M., Miyamoto, T., Ohkuma, M. and Tsuda, M. (1999). Action spectrum for the photophobic response of Ciona intestinalis (Ascidieacea, Urochordata) larvae implicates retinal protein. Photochem. Photobiol. 70,359 -362.[Medline]
Nishida, H. and Satoh, N. (1989). Determination and regulation in the pigment cell lineage of the ascidian embryo. Dev. Biol. 132,355 -367.[CrossRef][Medline]
Oetting, W. S. and King, R. A. (1999). Molecular basis of albinism: mutations and polymorphisms of pigmentation genes associated with albinism. Hum. Mutat. 13, 99-115.[CrossRef][Medline]
Sakurai, H., Goda, M., Kohmura, Y., Horie, T., Iwamoto, H., Ohtsuki, H. and Tsuda, M. (2004). The role of pigment cells in the brain of ascidian larva. J. Comp. Neurol. 475, 70-82.[CrossRef][Medline]
Sato, S. and Yamamoto, H. (2001). Development of pigment cells in the brain of ascidian tadpole larvae: insights into the origins of vertebrate pigment cells. Pigment Cell Res. 14,428 -436.[Medline]
Satoh, N. (1994). Developmental Biology of Ascidians. Cambridge: Cambridge University Press.
Svane, I. and Young, C. M. (1989). The ecology and behaviour of ascidian larvae. Oceanogr. Mar. Biol. Annu. Rev. 27,45 -90.
Tsuda, M., Kawakami, I. and Shiraishi, S. (2003a). Sensitization and habituation of the swimming behavior in ascidian larvae to light. Zool. Sci. 20, 13-22.[CrossRef][Medline]
Tsuda, M., Kusakabe, T., Iwamoto, H., Horie, T., Nakashima, Y., Nakagawa, M. and Okunou, K. (2003b). Origin of the vertebrate visual cycle: II. Visual cycle proteins are localized in whole brain including photoreceptor cells of a primitive chordate. Vision Res. 43,3045 -3053.[Medline]
Tsuda, M., Sakurai, D. and Goda, M. (2003c).
Direct evidence for the role of pigment cells in the brain of ascidian larvae
by laser ablation. J. Exp. Biol.
206,1409
-1417.
Whittaker, J. R. (1966). An analysis of melanogenesis in differentiating pigment cells of ascidian embryos. Dev. Biol. 14,1 -39.[CrossRef][Medline]
Young, C. M. and Chia, F.-S. (1985). An experimental test of shadow response function in ascidian tadpoles. J. Exp. Mar. Biol. Ecol. 85,165 -175.[CrossRef]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||