|
| ![]() |
|
||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online September 9, 2005
Journal of Experimental Biology 208, 3609-3622 (2005)
Published by The Company of Biologists 2005
doi: 10.1242/jeb.01795
Cloning, characterization and expression of escapin, a broadly antimicrobial FAD-containing L-amino acid oxidase from ink of the sea hare Aplysia californica

1 Department of Biology, Georgia State University, Atlanta, GA 30302-4010,
USA
2 Center for Behavioral Neuroscience, Georgia State University, Atlanta, GA
30302-4010, USA
3 Department of Chemistry, Georgia State University, Atlanta, GA 30302-4010,
USA
4 Department of Zoology, University of Washington, Seattle, WA 98195-1800,
USA
Author for correspondence at address Department of Biology, Georgia State
University, Atlanta, GA 30302-4010, USA (e-mail:
cderby{at}gsu.edu)
Accepted 13 July 2005
| Summary |
|---|
|
|
|---|
Key words: toxin, chemical defense, flavin, gastropod, inking, Opisthobranchia
| Introduction |
|---|
|
|
|---|
In this study, we have isolated, cloned and sequenced a 60 kDa monomeric
antimicrobial protein from the purple ink of the sea hare Aplysia
californica (Fig. 1A) and
named it `escapin', because of its potential role in sea hare defence, because
it is only released when a sea hare is attacked by predators and it has
cytotoxic effects against a predatory sea anemone (Johnson et al.,
2001
,
2003
;
Johnson, 2002
). When attacked
by natural predators, A. californica releases secretions from two
glands in its mantle cavity: a purple secretion from its ink gland, and a
sticky white secretion from its opaline gland
(Johnson and Willows, 1999
).
Nearly 30% of the dry mass of A. californica ink is protein
(Troxler et al., 1981
; MacColl
et al., 2000) while the remaining portion is algal-derived pigments from the
sea hare's seaweed diet (Chapman and Fox,
1969
). The ink-opaline secretion of A. californica is an
effective deterrent against predatory sea anemones
(Nolen et al., 1995
;
Kicklighter et al., 2005
), and
escapin is the major protein component of ink. Thus, as an abundant and
potentially bioactive protein in ink, escapin may play a role in sea hare
chemical defence.
|
| Materials and methods |
|---|
|
|
|---|
Collection of purple ink
Purple ink from A. californica was collected by agitating the
animals over a flask or by gently squeezing dissected ink glands in a Petri
dish with the blunt end of a scalpel handle. The secretion was then frozen at
-80°C until used.
Purification of proteins from purple ink
Proteins were isolated and purified using an ÄKTA 100 Automated FPLC
(Amersham Pharmacia Biotech, Piscataway, NJ, USA). A preparative grade Hi-Load
Superdex 200 16/60 column (Amersham Pharmacia Biotech) or an in-house-packed
Sephacryl 300 HR 26/60 column was used for initial size separation with
fractions collected in an automated fraction collector. Fractions identified
to have activity by bacterial assay (described in the next section) were
concentrated using a Biomax 5K NMWL membrane Ultrafree Centrifugal Filter
Device (Millipore, Billerica, MA, USA). Active fractions were further purified
on a cation exchange Mono S column, and fractions were collected, assayed,
concentrated and frozen at -80°C. One purified protein of interest, which
we call `escapin', was bright yellow. Escapin's concentration was determined
by Bradford (1976
) assay using
bovine serum albumen (BSA) as a standard. The molecular mass of purified
escapin was determined by gel filtration using a Superose-6 10/30 column
(Amersham Pharmacia Biotech) eluted with 50 mmol l-1 potassium
phosphate buffer (pH 7.2) containing 150 mmol l-1 KCl at a flow
rate of 0.5 ml min-1. The molecular mass markers were BSA (67 kDa),
ovalbumen (43 kDa) and chymotrypsinogen A (25 kDa).
Protein sequencing
Aplysia californica ink was analyzed for protein content using
sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) on 12%
gels. A single dominant protein band was found at about 60 000 Da, and was
named escapin. This band was blotted from the polyacrylamide gel to a PVDF
membrane using CAPS (transfer buffer) and determined by protein
microsequencing and proteomic mass spectrometry (University of Massachusetts
Medical School Proteomic Mass Spectrometry Lab:
http://www.umassmed.edu/proteomic/leszyk).
After identifying peptide fragments from escapin, a BLAST search was conducted
to find homologous protein fragments. N-terminal sequencing of escapin was
carried out in GSU protein sequencing facility using a protein sequencer
(Procise 492; Applied Biosystems, Foster City, CA, USA).
To isolate intact mRNA from A. californica ink glands, animals
were dissected in MgCl2/diethylpyrocarbonate solution isotonic with
seawater in a 4°C cold room. Ink glands were removed and immediately
transferred to liquid N2. Glands were ground with a mortar and
pestle while still in liquid N2. This material was transferred to
an RNase-free tube, and mRNA was isolated following the manufacturer's
protocols (Roche mRNA Isolation Kit, Cat. No.1-741-985, Indianapolis, IN,
USA). Two primers from the N-terminal sequence (TTCGAGTTCTGCGACCGGGT) and
C-terminal sequence (CCAAGGCTGGTCAAAGGTCA) of cyplasin L (GenBank accession
no. AJ304802; Petzelt et al.,
2002
) were designed based on the results of homologous sequences
recovered following the BLAST search. Primers were used for RT-PCR following
the manufacturer's protocols (Roche Titan One Tube RT-PCR System, Best
Nr.1-888-382) using an Eppendorf Mastercycler Gradient thermocycler. The
resultant RT-PCR product, which was >900 bp, was then cloned in a pGEM
T-vector (Promega, Madison, WI, USA), amplified and sequenced. This sequence
was verified by alignment with homologous sequences from GenBank using
MacVector 6.5.3 (Accelrys, San Diego, CA, USA).
5'/3' rapid amplification of cDNA ends (RACE)-PCR
5'/3' RACE-PCR was conducted to complete the cDNA clone of the
>900 bp RT-PCR product described above. 1 µg mRNA was used with the
5'/3' RACE Kit (Roche Cat. No. 1-734-792), and the manufacturer's
protocol was followed. Three specific primers were designed from the original
RT-PCR isolated fragment and used in 5' RACE: one for first strand cDNA
synthesis (SP1=GTTCACGTCGGGTGTGTTGGGCAGC), one for dA-tailed cDNA
amplification (SP2= TGGTAGGTGAACAGACGGCC), and one for nesting PCR
(SP3=CCCGGTCGCAGAACTCGAAA). A final primer was used for the 3' RACE
reaction (SP4=ATCTACACCCTGGAGGAAGG). All PCR products were analyzed on a 1%
agarose gel. PCR products that appeared to be of appropriate size were
subcloned into pGEM-T vector (Promega) and sequenced as described above.
Isolation and identification of the yellow pigment associated with escapin
Purified escapin was heated at 70°C for 15 min followed by
centrifugation at 25 000 g for 20 min to separate the pigment
from the protein. Yellow pigment in the supernatant was purified by high
pressure liquid chromatography (HPLC) according to Light et al.
(1980
), using a Beckman system
equipped with a 168 photodiode array set at 200-600 nm with a Phenomenex Luna
C18 (0.46 x250 mm) column (Phenomenex, Torrance, CA, USA). Isocratic
reversed phase chromatography was performed using 5 mmol l-1
ammonium acetate and 20% methanol in water as a mobile phase with a flow rate
of 1 ml min-1. Retention times of a FAD standard (Sigma, St Louis,
MO, USA) and the yellow pigment were compared by co-injection. ESI-TOF mass
spectrometry was performed using an Applied Biosystems QSTAR XL and run in
positive ion mode. ESI samples were injected into a flow of 50/50
water/acetonitrile containing 0.2% formic acid. NMR spectra were acquired on a
500 MHz Bruker Avance NMR (Rheinstetten, Germany) equipped with a triple
resonance cryoprobe. 1 µmol l-1 of FAD standard was purified
using the same method as for the yellow pigment. Spectra were recorded in
D2O at 309 K. Spectra for the FAD standard were obtained under
identical conditions except the experimental time. Proton assignments for the
FAD standard were based on established 2D NMR methods (COSY, ROESY). The
amount of FAD in the supernatant of heated protein was calculated based on an
extinction coefficient value,
450, for FAD of 11.3 mmol
l-1 cm-1 (Whitby,
1953
).
Detection of glycosylation of escapin
GelCode Glycoprotein Staining Kit (Pierce Biotechnology, Rockford, IL, USA)
and DIG Glycan Detection Kit (Roche) were used to determine the carbohydrate
component of escapin. 5 µg of escapin, BSA and E. coli protein
(negative controls, since they lack glycosylation), and various concentrations
of horseradish peroxidase (a positive control and standard, since it is 15%
carbohydrate by mass) were analyzed by SDS-PAGE followed by staining for
carbohydrates according to the manufacturers' protocols, as well as by
Coomassie Blue labeling of proteins.
L-amino acid oxidase (LAAO) assay
LAAO activity of escapin was determined by an enzyme-coupled assay
(MacHeroux et al., 2001
).
Purified escapin in 50 mmol l-1 phosphate buffer and 150 mmol
l-1 KCl was added to a 100
l reaction mixture containing 0.1
mol l-1 Tris-HCl, pH 7.6, 10 µg horseradish peroxidase, 0.2 mmol
l-1 O-dianisidine, and indicated concentration of
various L-amino acids. Reactions were performed at room temperature
for 1-60 min; the activity was monitored by absorbance at 436 nm and the
increase in absorbance was transformed into molar concentration of end product
based on
of O-dianisidine=8.31 x103 mol
l-1. The Km and Vmax values
were determined by Lineweaver-Burk plots.
Bacterial expression of the precursor of escapin
Primers were designed to amplify the whole coding sequence so that escapin
could be over-expressed in E. coli. The 5' primer included a
BamHI restriction site to allow in-frame insertion into the
amplification and expression vectors
(5'GGATCCCATGTCGTCTGCTTTCCTTC3'). The 3' end included an
extra HindIII restriction site
(5'AAGCTTGAGGAAGTAGTCGTTGATGA3'). PCR was conducted using Expand
High Fidelity PCR System (Roche). The resultant whole gene fragment of
expected size was cloned into pGEM-T vector (Promega), and the plasmids were
amplified. The plasmids were then cut with BamHI and
HindIII, and the gene was subcloned into the pET-20b expression
vector (Novagen, Madison, WI, USA) using the same enzymes. The sequence was
confirmed by DNA sequencing using an ABI sequencer. For over-expression, the
plasmid was transformed into E. coli strain BL21 (
DE3). 26
liters of these cells were grown in Luria-Bertani (LB) medium in a Pilot Plant
fermenter (New Brunswick Scientific, Edison, NJ, USA) at 37°C until
reaching an A600 of 0.5, at which point they were induced with 0.5
mmol l-1 isopropyl-ß-D-thiogalactopyranoside (IPTG) for 2 h.
The cells were harvested and concentrated by centrifugation (5000
g at 4°C); a portion was resuspended in 0.1 mol
l-1 phosphate buffer containing 1 mmol l-1 PMSF protease
inhibitor, and broken on a Sim-Aminco French pressure cell at 16 000 psi. The
resultant mixture was centrifuged at 127 000 g for 1 h in a
Beckman Coulter Optima XL-100K ultracentrifuge. SDS-PAGE was used to identify
the location of escapin, which formed an inclusion body and was found in the
pellet. The inclusion body was first dissolved in denaturing buffer (8 mol
l-1 urea, 20 mmol l-1 phosphate buffer, pH 7.2) and the
supernatant was loaded onto an anion exchange column, Mono Q 10/10 (Amersham
Pharmacia Biotech) using 8 mol l-1 urea, 20 mmol l-1
PPB, pH 7.2, and 1 mmol l-1 DTT (A buffer) and the same buffer plus
1 mol l-1 NaCl (B buffer) to elute escapin. Escapin was again
identified by size using SDS-PAGE, and the resultant band was analyzed for
MALDI-TOF MS (Emory University School of Medicine Microchemical and Proteomics
Facility,
http://corelabs.emory.edu/home.cfm#mcf)
to verify the identity of the protein as escapin. Soluble escapin precursor
could be obtained when protein was induced at a lower temperature (20°C)
for 5-18 h, and tested for antimicrobial activities.
Antiserum preparation
An antiserum against escapin was obtained by injecting rabbits with
denatured recombinant escapin purified from the E. coli expression
extracts. The first injection was conducted using 1:1 mixed escapin and
Freund's Complete Adjuvant (DIFCO, BD, Franklin Lakes, NJ, USA) followed by
4-5 injections using Freund's Incomplete Adjuvant (DIFCO).
Expression of escapin without signal peptide in E. coli
Similar methods to those described above were used to amplify and clone
escapin in E. coli. The escapin gene without signal peptide was
subcloned to NdeI and HindIII sites of pET 29a vector
(Novagen). Plasmid was then transformed into BL21 (
DE3) strain, and
proteins were induced by 0.5 mmol l-1 IPTG at A600=0.8,
followed by incubation at 20°C for 5-18 h.
Microbial species and strains
Eleven species or strains of microbes were examined for antimicrobial
activity of escapin. These are the following: Gram-negative bacteria
Escherichia coli (MC4100), Pseudomonas aeruginosa (PAO1),
and Salmonella typhimurium (AA140), Vibrio harveyi BB170 (a
marine species), Gram-positive bacteria Bacillus subtilis (2 strains,
168 and WB600), Streptococcus pyogenes (NZ131), and
Staphylococcus aureus (6835; a pathogenic species); yeast Candida
krusei and Saccharomyces cerevisiae (BY4761); and fungus
Cladosporium sphaerospermum.
Antimicrobial assay
Antimicrobial effects, which can be bacteriostatic and/or bactericidal,
were determined for escapin using a combination of two assays. In the first
assay, which measured inhibition, microbes were incubated on solid medium in
the presence of escapin or controls, followed by assessment of escapin's
effects either by direct observation of zones of inhibition or by turbidity
measurements of cell density (measured as A600 in a
spectrophotometer). In the second assay, bacteria were incubated in liquid
medium in the presence of escapin or controls, followed by plating onto
agar-filled Petri dishes and counting viable colonies. No effect on bacterial
growth in the first assay indicated that the compound was not antimicrobial -
neither bacteriostatic nor bactericidal. If there was inhibition of growth
according to the first assay but no reduction in number of colonies according
to the second assay, then bacteriostasis was indicated. If there was
inhibition of growth according to the first assay and a reduction in number of
colonies according to the second assay, then bactericidal effects were
indicated.
In the first assay, growth inhibition plate assays, various bacteria species and strains were plated as a lawn of ca. 1-2 x108 cells on Petri dishes with solid medium in 1.5% agar. Growth inhibition was examined by spotting 1 µl of escapin onto the plate, incubating overnight at 37°C or room temperature, and assaying for the presence of a clear zone around at the spot. In this assay, different microbes were cultured in an appropriate medium. E. coli cells were cultured in either minimal medium (e.g. M9+glucose) or enriched medium [e.g. Tryptone Peptone (Try) or LB]. Other bacteria species were cultured in LB medium, except for Streptococcus pyogenes, which was cultured in Todd Hewitt broth. Fungi were cultured in Sabouraud Dextrose medium. Yeast were cultured in YEPD solid medium (1% yeast extract, 2% peptone, 2% dextrose).
In the second assay, using liquid medium, bacteriostatic or bactericidal activity was determined by co-incubating bacteria in liquid medium with supplements and escapin, followed by measuring bacterial cell density either by turbidity measurement at A600 or by counting the number of viable colonies after incubating on Petri dishes with solid medium.
Assay of antimicrobial shelf-life at room temperature
Long-term stability of the antimicrobial activity of escapin was evaluated
to aid in determining its potential as a practical antimicrobial agent. 250
µg ml-1 of escapin in buffer containing 50 mmol l-1
PPB (pH 8.0) and 150 mmol l-1 KCl was diluted at 1:1 ratio in the
same buffer with or without 100% glycerol, separated into portions, and stored
at room temperature for time intervals of more than 5 months. Control escapin
was kept frozen at -80°C until used. The shelf-life of escapin was
determined by twofold serial dilutions on a solid LB medium antibacterial
assay using E. coli or B. subtilis, as described elsewhere
in Materials and methods.
| Results |
|---|
|
|
|---|
Cloning and sequence analysis of escapin cDNA
Two trypsin-digested fragments from purified escapin were determined by
microsequencing, and the primers were made to probe the ink gland cDNA (see
Materials and methods). The sequence of escapin cDNA was obtained by 5'
and 3' RACE-PCR as described in Materials and methods. The cDNA of
escapin was 1879 bp in length (GenBank accession no. AY615888) and had an open
reading frame encoding 535 amino acid (aa) residues
(Fig. 2). Based on the deduced
aa sequence, a signal peptide cleavage site between the 18th and 19th aa
residues was predicted by SignalIP
(http://www.cbs.dtu.dk/services/SignalP-2.0/).
This was verified by N-terminal aa sequencing of native escapin isolated from
sea hare ink.
|
A BLAST search found that escapin shared identity with a number of
L-amino acid oxidase (LAAO) flavoproteins
(Fig. 2). Escapin had highest
identity (93%) with APIT, a protein from the purple ink secretion of the sea
hare Aplysia punctata (GenBank accession nos 442281, 442282, 4422883;
Butzke et al., 2004
). Escapin
shared 61% identity with cyplasin L (Accession no. AJ304802;
Petzelt et al., 2002
), likely
isolated from an ink-opaline secretion of A. punctata. Escapin shared
61% and 60% identity with aplysianin A precursor protein isolated from albumen
glands of A. kurodai (Accession no. D83255;
Kamiya et al., 1986
) and
A. californica (Accession no. AY161041;
Cummins et al., 2004
),
respectively. Escapin also had 48% identity with achacin precursor, an
antibacterial protein isolated from a land snail Achatina fulica
(Accession no. X64584; Obara et al.,
1992
). It also showed 21% identity with other L-amino
acid oxidases from various species, including apoxin I from the venom gland of
the pit viper Crotalus atrox (Accession no. AF093248;
Torii et al., 2000
).
The alignment results indicate that the two characteristic sequence motifs
of flavoproteins - `GG' (RxGGRxxS/T) and ß
ß
dinucleotide-binding (DMB) motifs - are well conserved among these proteins
(Fig. 2). Glycosylation is
commonly observed among LAAOs and is reported to be critical for the enzyme's
activity (Ogawa et al., 1999
;
Torii et al., 2000
;
Ehara et al., 2002
). However,
only one possible N-glycosylation site (Thr 463) was predicted for escapin
using the analytical program NetOGlyc
(http://www.cbs.dtu.dk/services/NetOGlyc/).
We directly examined the level of glycosylation of purified escapin using two
glycoprotein staining methods. With the GelCode Glycoprotein Staining Kit,
which has a sensitivity of 1.5% carbohydrate by mass, no carbohydrate was
detected. Using the DIG Glycan Detection Kit, escapin contained <0.03%
carbohydrate by mass and even less than dactylomelin-P (a homologue of escapin
in Aplysia dactylomela, which has been reported to have <0.05%
carbohydrate); however, this assay yielded false positives for our negative
control E. coli proteins, so it is questionable whether any
glycoprotein was present. We also attempted to identify glycoproteins in
purified dactylomelin-P using a ConA-sepharose column (Amersham Pharmacia
Biotech), and again we did not identify any glycoproteins. We also attempted
to identify carbohydrates from purified dactylomelin-P, using the University
of Georgia Complex Carbohydrate Research Center
(http://www.ccrc.uga.edu/home.html);
this assay, which is extremely sensitive, yielded negative results.
Collectively, our results predict that escapin has one N-glycosylation site,
but this prediction could not be experimentally confirmed. Thus, we conclude
that escapin is minimally glycosylated, if at all. In addition, we found no
evidence that the glycosylation is essential to escapin's antimicrobial
activity (see Bacteria-expressed escaping, below).
Escapin is a member of the flavoprotein family
Amino acid sequence analysis suggested that escapin is a member of the
flavoprotein family, and contains `GG' (RxGGRxxS/T) and
ß
ßdinucleotide-binding (DMB) motifs. Purified homogeneous
escapin was bright yellow, and it was assumed that this yellow pigment was the
flavin. Since flavin adenine dinucleotide (FAD) is the typical flavin cofactor
for this protein family, we used NMR, ESI-TOF mass spectroscopy, and HPLC to
detect for the presence of FAD. The aromatic region of the 1H NMR
spectrum of the yellow pigment isolated from escapin showed essentially
identical resonances to the FAD standard, although the spectrum of the yellow
pigment contained signals of impurity at 8.45 p.p.m.
(Fig. 3A). Similar features
were also obtained for the aliphatic region of the FAD standard and the yellow
pigment (data not shown). Particularly noteworthy is the observation that two
of the aromatic protons (7.8 p.p.m.) that have long T1 relaxation times in FAD
are also observed for the pigment. A high-resolution ESI-TOF mass spectrum of
purified yellow pigment from escapin showed a peak with an
m/z value of 786.2 (Fig.
3B); this corresponds to the molecular formula
C27H34N9O15P2, which
was designated as a (M+H)+ ion of FAD. ESI-TOF mass spectrum of the
yellow pigment also showed peaks at m/z of 808.1 and 830.1,
which correspond to the (M+Na)+ and (M-H+2Na)+ ions of
FAD (Fig. 3B). In this
spectrum, signals below 400 m/z were due to solvents, and
signals of 400-600 m/z were not identified. Ions
corresponding to another flavin, FMN (molecular mass=478.3), were not found.
In addition, in reversed phase HPLC, the yellow pigment had the same retention
time (17.6 min) as FAD, and co-injection of the yellow pigment and FAD showed
only one peak. The UV-visible absorbance spectrum of the peak of the yellow
pigment showed absorbance at 263, 375 and 450 nm, which is characteristic for
FAD. Thus, the yellow pigment released from escapin is FAD. Based on
450 values, 17.2 nmoles FAD were extracted from 16.7 nmoles
of purified escapin, yielding an escapin:FAD molar ratio of about 1:1.
|
|
|
|
|
Escapin preferentially killed bacteria in early-log growth phase over resting cells (Fig. 6), and therefore acts on growing rather than stationary phase cells. Escapin also killed bacteria in a concentration-dependent manner (Fig. 6).
Escapin can be either bacteriostatic or bactericidal against E. coli. The bacteriostatic effect occurs in either minimal medium (e.g. M9+glucose) or in enriched medium (e.g. LB). Fig. 7A shows this effect, in which growth in the absence of escapin (`Control') is indicated as a line with a positive slope, and an absence of growth in the presence of escapin (`Esc') is indicated by a flat line. Hydrogen peroxide, which is produced under the conditions of this assay, appears to be necessary for bacteriostasis, since the addition of catalase, a scavenger of hydrogen peroxide and other free radicals, strongly reduced bacteriostasis in a concentration-dependent manner (Fig. 7A). The observation that catalase alone (in the absence of escapin) actually enhanced bacterial growth (Fig. 7A: compare `2 mg ml-1 Cat' vs `Control') might result from the catalase scavenging naturally produced hydrogen peroxide or other free radicals. Escapin's bactericidal effect in enriched medium is shown in Fig. 7B. Killing occurred rapidly, within 10 min, and was maintained for up to 2 h when cells were incubated at 37°C (Fig. 7B). No killing occurred at 0°C (Fig. 7B). Hydrogen peroxide was also produced under these assay conditions (see earlier results).
|
|
The strong enhancement of escapin's bactericidal effect on E. coli also occurred by adding L-lysine to minimal medium. L-lysine at 50 mmol l-1 dramatically enhanced escapin's bactericidal effect (Fig. 8B). L-arginine and L-histidine at 50 mmol l-1 produced a small enhancement of escapin's bactericidal effect, whereas L-valine or other amino acids did not affect escapin's bactericidal effects (Fig. 8B). A similar large enhancement of escapin's bactericidal effect by L-lysine but not by L-arginine or other L-amino acids was also seen for Staphylococcus aureus incubated in LB medium. The killing effect by escapin on S. aureus in LB medium was not apparent, presumably because of the presence of a naturally occurring catalase (Fig. 8C).
|
In contrast, the bactericidal effect of escapin occurred in a concentration-dependent fashion only for L-lysine (Fig. 9B). L-arginine at any concentration did not mediate escapin's bactericidal effect, even though L-arginine is a good substrate for escapin's LAAO activity. L-arginine's inability to mediate escapin's bactericidal effect is similar to L-tyrosine, which unlike L-tyrosine is a poor substrate for escapin's LAAO activity (Fig. 9B). In addition, hydrogen peroxide at 8-11 mmol l-1 had no to little bactericidal effects on E. coli (Fig. 8B), even though L-lysine is an excellent substrate for escapin's generation of hydrogen peroxide at 8-11 mmol l-1 greatly enhanced escapin's bactericidal effects (Fig. 9B).
|
Finally, since some of escapin's antibacterial effects depend on the concentration of L-lysine in the growth medium, and since the microbes tested in this study (Table 1) used different growth media, we wanted to know whether the different inhibitory efficacies of escape were dependent on the lysine concentration in the media. So, we analyzed the concentration of lysine and other free amino acids in the media, using an ion exchange, post-column ninhydrin detection system (Beckman Model 6300/7300 Amino Acid Analyzer, The Scientific Research Consortium, Inc.: www.aminoacids.com). We found that the media contained the following concentrations of lysine: tryptone peptone medium (for bacteria), 2.636 mmol l-1; YEPD (for yeast), 4.980 mmol l-1; and Sabouraud Dextrose (SD) medium (for fungus), 0.812 mmol l-1. Thus, the lysine concentration was different in the media. But even so, lysine concentration cannot explain the lower inhibitory efficacy of yeast compared to bacteria because yeast has lower efficacy even though yeast medium has a higher lysine concentration: yeast MIC of 5 µg ml-1 at 4.980 mmol l-1 lysine, E. coli MIC of 0.62 µg ml-1 at a lysine concentration of 2.636 mmol l-1. We increased the concentration of L-lysine in SD medium to 4.980 mmol l-1, and found that its inhibitory efficacy against fungus increased (MIC of 62 µg ml-1 in 0.812 mmol l-1 lysine, and 15 µg ml-1 in 4.980 mmol l-1). Thus, the inhibitory efficacy of escapin against different types of microbes is dependent on lysine concentration, with greater inhibition at higher lysine concentrations (results not shown). But nonetheless, escapin has different efficacies against different microbes that are independent of lysine concentration, with the relatively efficacies being bacteria>yeast>fungi for the species tested.
|
DE3) strain and expressed as described in the
Materials and methods. Soluble recombinant proteins with lower expression
levels were obtained when proteins were induced at lower temperature
(20°C) and at a shorter time. Approximately 0.2 mg of soluble rEsc was
expressed per liter of bacterial culture medium. In contrast, inclusion bodies
with higher expression levels were obtained under induction at 37°C. Thus,
denatured recombinant escapin precursor (r-proEsc) was used for production of
antiserum. Expressed r-proEsc and rEsc were confirmed by western blot to be
present in the E. coli cell lysate
(Fig. 11A). As expected,
r-proEsc containing a signal peptide showed the highest molecular mass.
However, rEsc ran slightly lower on the gel than did native or wild-type
escapin (wEsc). Antibacterial activity of the recombinant proteins was
determined using plate assays with lawns of cells grown on solid LB medium.
For the Gram-negative E. coli, rEsc had antibacterial activity
(Fig. 11B), although its
activity was 3-4 times less than that of wEsc. r-proEsc had no activity on
E. coli. Similar results were obtained when these expression products
were tested against the Gram-positive bacterium Staphylococcus aureus
(data not shown). | Discussion |
|---|
|
|
|---|
L-amino acid oxidase (LAAO) activity of antimicrobial and
antineoplastic agents from a variety of species has been reported as a major
(Iijima et al., 1995
;
Suhr and Kim, 1996
;
Torii et al., 1997
;
Ehara et al., 2002
;
Lu et al., 2002
;
Wei et al., 2003
;
Butzke et al., 2004
) or partial
(Jimbo et al., 2003
;
Kanzawa et al., 2004
)
mechanism for their effects. Escapin also possesses LAAO activity: it shows
strong and rapid activity under our assay conditions when using arginine or
lysine as a substrate, with reactions being completed within 30 s at room
temperature (Fig. 4). Similar
to other LAAOs from snails and snakes, escapin is a flavoprotein. We show that
the flavin in escapin is FAD (Fig.
3). Escapin has one potential glycosylation site, but this is
probably not essential for its antimicrobial activity, since
bacterial-expressed escapin is bioactive
(Fig. 11). Dactylomelin-P, a
homologue of escapin in Aplysia dactylomela, was likewise found to
have no or minimal glycosylation (<0.05% carbohydrate by mass;
Melo et al., 2000
) and was
still fully functional. This is in contrast to other reports that for related
LAAOs, the sugar moiety is necessary for antimicrobial effects
(Obara et al., 1992
;
Takamatsu et al., 1995
;
Ogawa et al., 1999
;
Torii et al., 2000
;
Petzelt et al., 2002
).
Escapin has a broad antimicrobial spectrum compared to many known antimicrobial agents, and thus far escapin has been effective against all tested microorganisms (Table 1). It was most effective against the bacteria found in the marine environment (Vibrio harveyi and Staphylococcus aureus), so it can be highly active against microbes that occur in the environment in which escapin normally acts. Escapin was also effective against pathogenic species (Staphylococcus aureus, Streptococcus pyogenes, and Pseudomonas aeruginosa), demonstrating its potential in use against medically important species.
Escapin is an effective inhibitor of many microbes (Table 1), but we mostly used E. coli in our characterization of antimicrobial effects of escapin. Escapin is highly stable, having no or little loss of activity after multiple freeze-thaw cycles and after more than 5 months storage at room temperature (Fig. 5). Its activity is concentration dependent (Fig. 6). Escapin exerts its bactericidal effects preferentially against fast growing cells (Fig. 6) and does so very quickly within 10 min (Fig. 7).
Escapin is bacteriostatic in minimal media and bactericidal in enriched
media (Fig. 7). Unlike previous
reports of similar proteins isolated from sea hares
(Kisugi et al., 1989
;
Yamazaki et al., 1990
; Melo et
al., 1998
,
2000
), we demonstrate that
substrates determined the bactericidal or bacteriostatic effects of escapin.
Bacteria cultured in M9 and glucose medium without high levels (50 mmol
l-1) of selected amino acids or without Tryptone Peptone
supplements were not killed (Figs
7,
8). Escapin's bacteriostatic
effect seems to be mediated through its oxidation of the L-amino
acids lysine and/or arginine and the consequent subsequent production of
hydrogen peroxide. Both lysine and arginine are substrates for escapin's
oxidase activity (Fig. 4).
Hydrogen peroxide is sufficient to cause bacteriostasis, and does so with a
concentration dependency and threshold (ca. 3 mmol l-1) similar to
that of amino acids as substrates for escapin
(Fig. 9A). Thus, hydrogen
peroxide appears to be both necessary (Fig.
7) and sufficient (Fig.
9) for bacteriostasis under our conditions, and likely mediates
escapin's bacteriostatic effects.
We have identified L-lysine as a major cofactor in escapin's bactericidal effect. Lysine is much more effective than arginine in enhancing escapin's bactericidal activity. Lysine's effect is over three-log units greater than that of arginine at the same concentration (50 mmol l-1; Fig. 8B), and lysine mediates the bactericidal effect with a threshold of ca. 3 mmol l-1 whereas arginine is ineffective in killing bacteria at concentrations as high as 50 mmol l-1 (Fig. 9B). This is true even though arginine and lysine have similar LAAO activities (Fig. 4) and similar thresholds for bacteriostasis (Fig. 9A). In addition, arginine's limited enhancement of escapin's bactericidal effect is similar to that of histidine (Fig. 8), even though arginine has much greater LAAO activity than histidine (Fig. 4). Thus LAAO activity alone, and the resultant production of hydrogen peroxide, cannot explain escapin's pronounced killing effect in the presence of lysine as compared to arginine. Hydrogen oxide production thus plays little to no direct role in escapin's bactericidal effect. We are currently examining escapin's bactericidal mechanisms.
Analysis of the free amino acids found in the opaline secretion of
Aplysia californica show that it has a very high lysine concentration
(65 mmol l-1), while the purple ink secretion, containing escapin,
has none (Kicklighter et al.,
2005
). Only small amounts of arginine (<0.4 mmol
l-1) are found in opaline and none in ink
(Kicklighter et al., 2005
).
This raises the possibility that the lysine is mixed with escapin, which is
only in ink, when ink and opaline are released and mixed by sea hares
following attack by predators. In fact, ink and opaline are normally
co-released and mixed in the sea hare's mantle cavity, then pumped toward the
attacking predator (Johnson and Willows,
1999
). It should be noted, however, that the lack of any
detectible lysine or arginine in the ink could also be a result of stores
being used as substrates by escapin by the time we collect the ink and thus
prior to analysis of free amino acids. We are currently conducting experiments
to evaluate this and related hypotheses. Understanding the natural roles that
escapin plays for sea hares will likely aid our understanding of how it may
function as a practical antimicrobial or antineoplastic agent.
Given our finding of a lysine-dependent antimicrobial effect for E. coli, it may be that the different inhibitory efficacies of escapin against the species of microbes tested (Table 1) were due to the concentration of lysine in their growth media (which are necessarily different). Although the concentration of lysine did influence the efficacy of escapin against a fungus to a small degree (Table 1), nonetheless escapin had different efficacies against different microbes when tested in media with similar lysine concentrations, with escapin being most potent against bacteria and least against fungi for the species tested.
Although the mechanisms of antimicrobial activity of escapin are not yet
known in detail, our results give some suggestions. Escapin preferentially
kills bacteria that are metabolically active (i.e. in log-growth phase
vs stationary growth phase; Fig.
6). An interesting observation was that although escapin exerted
its bactericidal effect in a concentration-dependent manner, the killing never
reached 100% as the protein concentration increased or over longer time
periods (Figs 6,
7). In addition, these cells
were not resistant to escapin, since they were sensitive to more cycles of
killing when re-inoculated with fresh medium (data not shown). These results
suggest the existence of persister cells, which neither grow nor die in the
presence of microbial antibiotics (Keren
et al., 2004
), and that more persisters were produced in
stationary phase than in log-growth phase at the same protein concentration
(as in other studies: Balaban et al.,
2004
; Keren et al.,
2004
). Thus, it appears that escapin preferentially kills cells
that are metabolically active. In this way, escapin is similar to other
antimicrobial agents such as penicillin, streptomycin, ampicillin and
O-oxacin in being bactericidal on log-growth phase cells and not
stationary cells, in contrast to bismuth, which is bactericidal on stationary
cells but not log-growth phase cells (Davis
et al., 1990
; Coudron and
Stratton, 1995
; Herbert et
al., 1996
).
The existence of persister cells in our cultures of E. coli may
explain why several sea hare homologues of escapin, including aplysianin-E
(Kisugi et al., 1989
),
aplysianin-P (Yamazaki et al.,
1990
) and dactylomelin-P isolated from purple fluid of Aplysia
dactylomela (Melo et al.,
2000
), have been characterized as bacteriostatic and not
bactericidal, whereas we found escapin to be bactericidal. To test this idea,
we extracted and purified dactylomelin-P from Aplysia dactylomela and
found that it was also bactericidal under our assay conditions; K.-C. Ko and
H. Yong, unpublished data). These differences in our results with escapin and
dactylomelin-P vs those of the earlier studies of related proteins
could be due to the presence of persister cells in our culture conditions;
other explanations could include methodological differences such as the
concentrations of lysine in culture media or the species and strains of
microbes used.
In addition to escapin's preferential killing of bacteria that are
metabolically active, escapin also kills cells in the presence of
chloramphenicol to stop protein synthesis
(Fig. 10), and it does so
without lysing the cells. Comparison of the mechanisms of action of escapin
with other antimicrobial agents can give some clues as to escapin's mode of
action. Streptomycin, which affects ribosomes and cell membrane, is similar to
escapin in that it kills bacteria without lysing cells but dissimilar in
requiring protein synthesis for its bactericidal effect
(Davis et al., 1990
;
Coudron and Stratton, 1995
).
Penicillin, which inhibits cell wall formation, is more dissimilar to escapin
in that it kills bacteria through lysis and requires protein synthesis for its
effect (Davis et al., 1990
;
Coudron and Stratton,
1995
).
In summary, escapin is both bacteriostatic and bactericidal, and its bactericidal effect does not require protein synthesis or cytolysis. A more complete understanding of the cellular mechanism of escapin's bactericidal effects awaits further investigation.
Finally, we expressed bioactive recombinant escapin in a bacterial system, the first reported success of this for snail and snake LAAOs. Our expression level for soluble recombinant escapin was ca. 0.2 mg l-1 culture medium. This level may be relatively low for two reasons. First, this level is for soluble escapin, while much of the escapin is present in insoluble inclusion bodies. Second, the escapin inhibits growth of E. coli and other bacteria at doses below 1 mg l-1 (Table 1), and this would likely inhibit the levels of bacterial expression. The fact that bacterially expressed recombinant escapin is bioactive shows that glycosylation of escapin, which is at best minimal, is not essential for its antimicrobial activity. The fact that recombinant escapin is 3-4 times less effective against bacteria than is wild-type escapin might be because the recombinant form contains inactive escapin, which could also explain the double band for recombinant escapin in Fig. 11A. This could be tested by examining the specific activity of the recombinant and wild-type forms, but this will require higher levels of bacterial expression of recombinant escapin than we presently have. We are currently working on further improving expression of bioactive recombinant escapin in E. coli and S. aureus, and hope that this will enhance its viability as a new antimicrobial agent.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Balaban, N. Q., Merrin, J., Chait, R., Kowalik, L. and Leibler,
S. (2004). Bacterial persistence as a phenotypic switch.
Science 305,1622
-1625.
Bradford, M. M. (1976). A rapid and sensitive assay for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72,248 -254.[CrossRef][Medline]
Butzke, D., Machuy, N., Thiede, B., Hurwitz, R., Goedert, S. and Rudel, T. (2004). Hydrogen peroxide produced by Aplysia ink toxin kills tumor cells independent of apoptosis via peroxiredoxin I sensitive pathways. Cell Death Differ. 11,608 -617.[Medline]
Chapman, D. J. and Fox, D. L. (1969). Bile pigment metabolism in the seahare Aplysia. J. Exp. Mar. Biol. Ecol. 4,71 -78.
Coudron, P. E. and Stratton, C. W. (1995). Utilization of time-kill kinetic methodologies for assessing the bactericidal activities of ampicillin and bismuth, alone and in combination, against Helibacter pylori in stationary and logarithmic growth phases. Antimicrob. Agents CH 39, 66-69.[Abstract]
Cummins, S. F., Nichols, A. E., Amare, A., Hummon, A. B.,
Sweedler, J. V. and Nagle, G. T. (2004). Characterization of
Aplysia enticin and temptin, two novel water-borne protein pheromones
that act in concert with attractin to stimulate mate attraction. J.
Biol. Chem. 279,25614
-25622.
Davis, B. D., Dulbecco, R., Eisen, H. N. and Ginsberg, H. S. (1990). Microbiology. 4th edn. Philadelphia, USA: J. B. Lippincott.
Du, X. Y. and Clemetson, K. J. (2002). Snake venom L-amino acid oxidases. Toxicon 40,659 -665.[Medline]
Ehara, T., Kitajima, S., Kanzawa, N., Tamiya, T. and Tsuchiya, T. (2002). Antimicrobial action of achacin is mediated by L-amino acid oxidase activity. FEBS Lett. 531,509 -512.[CrossRef][Medline]
Herbert, D., Paramasivan, C. N., Venkatesan, P., Kubendiran, G., Prabhakar, R. and Mitchinson, D. A. (1996). Bactericidal action of O- oxacin, sulbactam-ampicillin, rifampin, and isoniazid on logarithmic- and stationary-phase cultures of Mycobacterium tuberculosis. Antimicrob. Agents CH 40,2296 -2299.[Abstract]
Iguchi, S. M., Aikawa, T. and Matsumoto, J. J. (1982). Antibacterial activity of snail mucus mucin. Comp. Biochem. Physiol. 72A,571 -574.[CrossRef]
Iijima, R., Kisugi, J. and Yamazaki, M. (1995). Antifungal activity of aplysianin E, a cytotoxic protein of sea hare (Aplysia kurodai) eggs. Dev. Comp. Immunol. 19, 13-19.[CrossRef][Medline]
Iijima, R., Kisugi, J. and Yamazaki, M. (2003). L-amino acid oxidase activity of an antineoplastic factor of a marine mollusk and its relationship to cytotoxicity. Dev. Comp. Immunol. 27,505 -512.[CrossRef][Medline]
Jimbo, M., Nakanishi, F., Sakai, R., Muramoto, K. and Kamiya, H. (2003). Characterization of L-amino acid oxidase and antimicrobial activity of aplysianin A, a sea hare-derived antitumor-antimicrobial protein. Fisheries Sci. 69,1240 -1246.[CrossRef]
Johnson, P. M. (2002). Multi-component chemical defense in seahares (Gastropoda: Opisthobranchia): antipredator compounds act as both honest and deceptive signals to multiple predator species. PhD thesis. University of Washington, USA.
Johnson, P. M. and Willows, A. O. D. (1999). Chemical defense in seahares (Gastropoda, Opisthobranchia, Anaspidea): multiple layers of protection from egg to adult. Mar. Freshw. Behav. Physiol. 32,147 -180.
Johnson, P. M., Yang, H., Paul, V. J., Tai, P. C. and Derby, C. D. (2001). Sea hare defensive secretions function by repelling some predators and attracting others. Amer. Zool. 41,1488 (abstract).
Johnson, P. M., Yang, H., Tai, P. C. and Derby, C. D. (2003). Escapin: an antipredator protein in the defensive secretion of Aplysia californica. Chem. Senses 28,A24 (abstract).
Kamiya, H., Muramoto, K. and Yamazaki, M. (1986). Aplysianin-A, an antibacterial and antineoplastic glycoprotein in the albumen gland of a sea hare, Aplysia kurodai. Experientia 42,1065 -1067.[CrossRef][Medline]
Kamiya, H., Muramoto, K., Goto, R., Sakai, M., Endo, Y. and Yamazaki, M. (1989). Purification and characterization of an antibacterial and antineoplastic protein secretion of a sea hare, Aplysia juliana. Toxicon 27,1269 -1277.[Medline]
Kanzawa, N., Shintani, S., Ohta, K., Kitajima, S., Ehara, T., Kobayashi, H., Kizaki, H. and Tsuchiya, T. (2004). Achacin induces cell death in HeLa cells through two different mechanisms. Arch. Biochem. Biophys. 422,103 -109.[CrossRef][Medline]
Keren, I., Kaldalu, N., Spoering, A., Wang, Y. and Lewis, K. (2004). Persister cells and tolerance to antimicrobials. FEMS Microbiol. Lett. 230, 13-18.[CrossRef][Medline]
Kicklighter, C. E., Shabani, S., Johnson, P. M. and Derby, C. D. (2005). Sea hares use novel antipredatory chemical defenses. Curr. Biol. 15,549 -554.[CrossRef][Medline]
Kisugi, J., Ohye, H., Kamiya, H. and Yamazaki, M. (1989). Biopolymers from marine invertebrates. X. Mode of action of an antibacterial glycoprotein, aplysianin E, from eggs of a sea hare, Aplysia kurodai. Chem. Pharm. Bull. (Tokyo) 37,3050 -3053.[Medline]
Kubota, Y., Watanabe, Y., Otsuka, H., Tamiya, T., Tsuchiya, T. and Matsumoto, J. J. (1985). Purification and characterization of an antibacterial factor from snail mucus. Comp. Biochem. Physiol. 82C,345 -348.[CrossRef]
Light, D. R., Walsh, C. and Marletta, M. A. (1980). Analytical and preparative high-performance liquid chromatography separation of flavin and flavin analog coenzymes. Anal. Biochem. 109,87 -93.[CrossRef][Medline]
Lu, Q. M., Wei, Q., Jin, Y., Wei, J. F., Wang, W. Y. and Xiong, Y. L. (2002). L-amino acid oxidase from Trimeresurus jerdonii snake venom: purification, characterization, platelet aggregation-inducing and antibacterial effects. J. Nat. Toxins 11,345 -352.[Medline]
MacColl, R., Galivan, J., Berns, D. S., Nimec, Z., Guard-Friar, D. and Wagoner, D. (1990). The chromophore and polypeptide composition of Aplysia ink. Biol. Bull. 179,326 -331.[Abstract]
MacHeroux, P., Seth, O., Bollschweiler, C., Schwarz, M., Kurfurst, M., Au, L. C. and Ghisla, S. (2001). L-amino-acid oxidase from the Malayan pit viper Calloselasma rhodostoma. Comparative sequence analysis and characterization of active and inactive forms of the enzyme. Eur. J. Biochem. 268,1679 -1686.[Medline]
Melo, V. M., Fonseca, A. M., Vasconcelos, I. M. and Carvalho, A. F. (1998). Toxic, antimicrobial and hemagglutinating activities of the purple fluid of the sea hare Aplysia dactylomela Rang, 1828. Braz. J. Med. Biol. Res. 31,785 -791.[Medline]
Melo, V. M., Duarte, A. B., Carvalho, A. F., Siebra, E. A. and Vasconcelos, I. M. (2000). Purification of a novel antibacterial and haemagglutinating protein from the purple gland of the sea hare, Aplysia dactylomela Rang, 1828. Toxicon 38,1415 -1427.[Medline]
Nolen, T. G., Johnson, P. M., Kicklighter, C. E. and Capo, T. (1995). Ink secretion by the marine snail Aplysia californica enhances its ability to escape from a natural predator. J. Comp. Physiol. A 176,239 -254.
Obara, K., Otsuka-Fuchino, H., Sattayasai, N., Nonomura, Y., Tsuchiya, T. and Tamiya, T. (1992). Molecular cloning of the antibacterial protein of the giant African snail, Achatina fulica Ferussac. Eur. J. Biochem. 209, 1-6.[Medline]
Ogawa, M., Nakamura, S., Atsuchi, T., Tamiya, T., Tsuchiya, T. and Nakai, S. (1999). Macromolecular antimicrobial glycoprotein, achacin, expressed in a methylotrophic yeast Pichia pastoris. FEBS Lett. 448, 41-44.[CrossRef][Medline]
Otsuka-Fuchino, H., Watanabe, Y., Hirakawa, C., Tamiya, T., Matsumoto, J. J. and Tsuchiya, T. (1992). Bactericidal action of a glycoprotein from the body surface mucus of giant African snail. Comp. Biochem. Physiol. 101C,607 -613.[CrossRef]
Otsuka-Fuchino, H., Watanabe, Y., Hirakawa, C., Takeda, J., Tamiya, T., Matsumoto, J. J. and Tsuchiya, T. (1993). Morphological aspects of achacin-treated bacteria. Comp. Biochem. Physiol. 104C,37 -42.[CrossRef]
Petzelt, C., Joswig, G., Stammer, H. and Werner, D. (2002). Cytotoxic cyplasin of the sea hare, Aplysia punctata, cDNA cloning, and expression of bioactive recombinants in insect cells. Neoplasia 4, 49-59.[CrossRef][Medline]
Suhr, S. M. and Kim, D. S. (1996). Identification of the snake venom substance that induces apoptosis. Biochem. Biophys. Res. Commun. 224,134 -139.[CrossRef][Medline]
Takamatsu, N., Shiba, T., Muramoto, K. and Kamiya, H. (1995). Molecular cloning of the defense factor in the albumen gland of the sea hare Aplysia kurodai. FEBS Lett. 377,373 -376.[CrossRef][Medline]
Torii, S., Naito, M. and Tsuruo, T. (1997).
Apoxin I, a novel apoptosis-inducing factor with L-amino acid oxidase activity
purified from Western diamondback rattlesnake venom. J. Biol.
Chem. 272,9539
-9542.
Torii, S., Yamane, K., Mashima, T., Haga, N., Yamamoto, K., Fox. J. W., Naito, M. and Tsuruo, T. (2000). Molecular cloning and functional analysis of apoxin I, a snake venom-derived apoptosis-inducing factor with L-amino acid oxidase activity. Biochemistry 39,3197 -3205.[CrossRef][Medline]
Troxler, R. R., Offner, G. D. and Capo, T. R. (1981). Structural studies on aplysioviolin. Biol. Bull. 161,339 (abstract).
Wei, J. F., Wei, Q., Lu, Q. M., Tai, H., Jin, Y., Wang, W. Y. and Xiong, Y. L. (2003). Purification, characterization and biological activity of an L-amino acid oxidase from Trimeresurus mucrosquamatus venom. Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai) 35,219 -224.
Whitby, L. G. (1953). A new method for preparing flavin-adenine dinucleotide. Biochem. J. 54,437 -442.[Medline]
Yamazaki, M. (1993). Antitumor and antimicrobial glycoproteins from sea hares. Comp. Biochem. Physiol. 105C,141 -146.[CrossRef]
Yamazaki, M., Kimura, K., Kisugi, J., Muramoto, K. and Kamiya,
H. (1989a). Isolation and characterization of a novel
cytolytic factor in purple fluid of the sea hare, Aplysia kurodai.
Cancer Res. 49,3834
-3838.
Yamazaki, M., Tansho, S., Kisugi, J., Muramoto, K. and Kamiya, H. (1989b). Purification and characterization of a cytolytic protein from purple fluid of the sea hare, Dolabella auricularia. Chem. Pharm. Bull. (Tokyo) 37,2179 -2182.[Medline]
Yamazaki, M., Ohye, H., Kisugi, J. and Kamiya, H. (1990). Bacteriostatic and cytolytic activity of purple fluid from the sea hare. Dev. Comp. Immunol. 14,379 -383.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
K. Nagaoka, F. Aoki, M. Hayashi, Y. Muroi, T. Sakurai, K. Itoh, M. Ikawa, M. Okabe, K. Imakawa, and S. Sakai L-Amino acid oxidase plays a crucial role in host defense in the mammary glands FASEB J, August 1, 2009; 23(8): 2514 - 2520. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-C. Ko, B. Wang, P. C. Tai, and C. D. Derby Identification of Potent Bactericidal Compounds Produced by Escapin, an L-Amino Acid Oxidase in the Ink of the Sea Hare Aplysia californica Antimicrob. Agents Chemother., December 1, 2008; 52(12): 4455 - 4462. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mai-Prochnow, P. Lucas-Elio, S. Egan, T. Thomas, J. S. Webb, A. Sanchez-Amat, and S. Kjelleberg Hydrogen Peroxide Linked to Lysine Oxidase Activity Facilitates Biofilm Differentiation and Dispersal in Several Gram-Negative Bacteria J. Bacteriol., August 1, 2008; 190(15): 5493 - 5501. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Derby Escape by Inking and Secreting: Marine Molluscs Avoid Predators Through a Rich Array of Chemicals and Mechanisms Biol. Bull., December 1, 2007; 213(3): 274 - 289. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Prince OPALINE GLAND ULTRASTRUCTURE IN APLYSIA CALIFORNICA (GASTROPODA: ANASPIDEA) J. Mollus. Stud., July 11, 2007; (2007) eym016v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Johnson, C. E. Kicklighter, M. Schmidt, M. Kamio, H. Yang, D. Elkin, W. C. Michel, P. C. Tai, and C. D. Derby Packaging of chemicals in the defensive secretory glands of the sea hare Aplysia californica J. Exp. Biol., January 1, 2006; 209(1): 78 - 88. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||