|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online February 20, 2004
Journal of Experimental Biology 207, 1101-1111 (2004)
Published by The Company of Biologists 2004
doi: 10.1242/jeb.00858
Stimulation by cadmium of myohemerythrin-like cells in the gut of the annelid Nereis diversicolor
1 Laboratoire d'Ecologie Numérique et d'Ecotoxicologie UPRES EA 3570,
FR 1818 CNRS
2 Laboratoire de Neuroimmunité des Annélides UMR 97,
Université des Sciences et Technologies de Lille, F-59655 Villeneuve
d'Ascq Cedex, France
* Author for correspondence (e-mail: sylvain.demuynck{at}univ-lille1.fr)
Accepted 5 January 2004
| Summary |
|---|
|
|
|---|
Key words: annelid, Nereis diversicolor, myohemerythrin, MPII, cadmium-binding protein, midgut
| Introduction |
|---|
|
|
|---|
Nereis diversicolor (Hediste diversicolor, recent
denomination) is a polychaete living in the mud of estuaries which, in Europe,
is routinely contaminated by heavy metals. Previous work
(Nejmeddine et al., 1988
)
showed that in animals exposed to Cd the metal was bound to two pools of
proteins of high molecular mass (metalloprotein I, MPI, >67 kDa) and low
molecular mass (MPII, of about 20 kDa). MPI is the extracellular hemoglobin of
this annelid (Demuynck and
Dhainaut-Courtois, 1993
). The primary structure of MPII isolated
from whole worms was different from that of a metallothionein, consisting of
119 amino acid residues with only one cysteine residue
(Demuynck et al., 1993
), but
shares 80.8% identity with the myohemerythrin isolated by Takagi and Cox
(1991
) from the same species.
MPII is a Cd-binding protein but is not a metallothionein. Metallothioneins
are known to be induced by essential (Cu or Zn) and non-essential (Cd) metals
and are thought to be important both in the detoxification of trace metals and
in the metabolism of intracellular Cu and Zn, as in the scavenging of reactive
oxygen species (Palmiter,
1998
; Klaassen et al.,
1999
). However, MPII appeared to correspond to a
myohemerythrin-like pigment, known to play a mainly respiratory role and with
no known function of detoxification. Immunocytochemical studies showed that
MPII is located in granulocytes I
(Dhainaut-Courtois et al.,
1987
; Porchet-Henneré
et al., 1987
), a specific type of coelomic cells
(Dhainaut, 1984
; Dhainaut and
Porchet-Henneré, 1986). Electron microscopy revealed that the protein
was located in the cytoplasmic granules of these cells
(Dhainaut-Courtois et al.,
1987
). In addition, Salzet-Raveillon et al.
(1993
) showed, by in
situ hybridization, that MPII mRNA is located in perineural and oblique
muscles and in clusters of free cells in the coelom, thought to differentiate
later into type I granulocytes, which would contain the MPII protein without
the corresponding mRNA.
MPII can be also observed in other cell types, however, such as cells from intestine epithelium. In fact, in the present work, we show that intestine epithelium cells are immunoreactive with MPII mAb. Our biochemical approach has been to confirm the presence of MPII (or MPII-like protein) in the gut and to verify the Cd-binding capacity of this molecule on exposure of the worms to this metal. The cells were identified by electron microscopy, and variations in MPII levels in the gut of animals in response to acute or chronic exposure to Cd were investigated by enzyme-linked immunosorbent assay (ELISA). Finally, the gene expression was studied in the gut of non-exposed and Cd-exposed animals by in situ hybridization and northern blotting using a specific probe in order to see whether or not there is transcriptional regulation of the MPII gene after Cd intoxication.
| Materials and methods |
|---|
|
|
|---|
Immunohistochemical procedure
The worm stubs were immersed for 12 h in BouinHollande fixative and
embedded in cytoparaffin. The immunohistochemical method was performed as
described previously (Engelhardt et al.,
1982
). In brief, 8 µm sections were prepared and mounted on
chrome alum/gelatin-coated slides and briefly air-dried. A monoclonal antibody
raised against MPII (MPII mAb) produced previously
(Porchet-Henneré et al.,
1987
) and used as pure culture supernatant was applied for 24 h at
4°C. After washing with Coons buffer, pH 7.2, horseradish
peroxidase-conjugated anti-mouse immunoglobulin was applied at 1:40 dilution
for 2 h. The peroxidase activity was revealed by allowing the sections to
react with 0.01% H2O2:40% 4-chloro-1-naphthol (w/v) in
0.1 mol l1 Tris-HCl buffer, pH 7.6.
Electron microscopy
Small pieces of gut were fixed for 3 h at 4°C with 3% glutaraldehyde,
2.5% NaCl in 0.1 mol l1 phosphate buffer, pH 7.4. They were
then washed for 24 h with the phosphate buffer in presence of 0.33 mol
l1 sucrose, post-fixed for 1 h with 1% osmium tetroxide in
the buffer and embedded in Epon resin. The sections were stained with uranyl
acetate and observed using a Jeol 100 CX electron microscope (Peabody,
USA).
Preparation of samples for biochemical analysis
The guts were isolated by dissection under a stereo microscope. For each
experimental sample, guts from 25 worms were pooled to reduce individual
variation and homogenized in 4 ml of 10 mmol l1 Tris-HCl
buffer, pH 8.6 using a polytron. The homogenate was then centrifuged at
4°C for 1 h at 15 000g. The pellet was discarded and the
supernatant used for chromatographic analysis.
Chromatography
2 ml of the supernatant were loaded onto a 16/60 Hi- Load Superdex 75 Prep
grade (separation range 370 kDa) column (Amersham Pharmacia Biotech,
Uppsala, Sweden) equilibrated with the homogenization buffer. The elution was
then performed at 1 ml min1 using FPLC system (Amersham
Pharmacia Biotech). The absorbance at 280 nm was read continuously.
Electrophoresis
Equal amounts of proteins from peak II chromatographic fractions derived
from gut supernatants of both control and acute Cd-exposed worms were analysed
by SDS-polyacrylamide gradient gel electrophoresis (SDS-PAGGE) on a
525% acrylamide gradient slab gel (0.75 mm thick) under reducing
conditions (5% v/v ß-mercaptoethanol). The migration was performed at 15
mA for 4 h. Half of the gel was then stained for proteins with Coomassie
Brilliant Blue R 250. The second part was processed for the immunodetection of
proteins.
Western blotting
Proteins were blotted onto an Immobilon P membrane (Millipore, Billerica,
USA) activated in methanol for a few seconds, washed in milli-Q water
(Millipore) for 10 min then equilibrated for 10 min in 25 mmol
l1 Tris, pH 8.3, containing 192 mmol l1
glycine and 10% methanol. The conditions used were 250 mA for 4 h.
Immunodetection of proteins
The membrane was first saturated with 1% low-fat powdered milk, 0.05% Tween
20 in Tris-buffered saline (TBS; 20 mmol l1 Tris-HCl, pH
7.4, containing 150 mmol l1 NaCl) for 1 h and then incubated
for 12 h with the MPII mAb used as the pure culture supernatant. The membrane
was then rinsed four times with 0.05% Tween 20 in TBS (TBS-Tween) and
incubated for a further 2 h with anti-mouse antibody labelled with peroxidase
diluted 1/1000 in the buffer. The peroxidase activity was revealed with a
solution composed of 50 ml TBS, 3 ml 0.3% 4-chloro-1-naphthol in methanol and
10 µl H2O2.
Metal analysis
Chromatographic fractions were analysed for their Cd content by Flame
Absorbance Spectrometry using a Perkin-Elmer 2380 (Boston, USA)
spectrophotometer.
Enzyme-linked immunosorbent assay (ELISA)
Chromatographic fractions derived from the gut of acute Cd-exposed worms
and gut supernatant from both control and acute Cd-exposed and chronically
Cd-exposed worms were analysed by ELISA using the MPII mAb. In brief, 96-well
plates were coated with 100 µl of the different samples for 12 h at
4°C. The saturation was realized for 2 h at ambient temperature with 200
µl of a 2% bovine serum albumin (BSA) in 0.01 mol l1
phosphate-buffered saline (PBS) at pH 7.4. After four rinses with 0.1% BSA;
0.05% Tween 20 in PBS, 100 µl of the monoclonal antibody were added to each
well and incubated for 2 h at 37°C. After four rinses with the previous
buffer, 100 µl of peroxidase-labelled second antibody diluted 1/10 000 in
TBS-Tween were added and incubated for 2 h. Finally, peroxidase activity was
revealed by the addition of 100 µl of a solution containing 0.04% (w/v)
O-phenylene diamine in 0.1 mol l1 sodium
citratecitric acid buffer, pH 5.5, and 0.83% (v/v)
H2O2. The reaction was stopped after 30 min at 37°C
by adding 100 µl 1 mol l1 HCl. Absorbance of the plate at
490 nm was read. The results obtained were corrected for protein content.
Since this protein has not yet been purified from this tissue and is not
available from commercial sources, the results of the ELISA were not expressed
in terms of MPII concentration but as absorption only.
Protein content determination
The protein content of supernatants and chromatographic fractions was
determined using protein reagent (Biorad, Hercules, USA) by the method of
Bradford (1976
) using 96-well
plates.
Data analysis
The results obtained by ELISA for the supernatants were compared for mean
statistical differences by one-way analysis of variance (ANOVA) and
StudentNewmanKeuls comparison post tests. P<0.05 was
considered significant.
Cloning of MPII probe for northern blot and in situ hybridization
Poly(A)+ RNA was extracted from stubs of Nereis
diversicolor using the Quick Prep mRNA Purification kit (Amersham
Pharmacia Biotech). 2 µg of RNA was reverse-transcribed with 1 µmol
l1 of oligo(dT)1218 primer, 0.5 mmol
l1 dNTPs, 10 i.u. RNase inhibitor and 4 i.u. Omniscript
reverse transcriptase (Qiagen, Valencia, USA) for 1 h at 37°C. A 333-base
pair (bp) fragment was amplified with 5' CCATATAAGCAGGACGAGTC 3'
and 5' TCCCTTGTAGCCGAAGTCGG 3' primers
(Deloffre et al., 2003
) using
2 µl of cDNA, 100 ng of each primer, 1.5 mmol l1
MgCl2, 0.2 mmol l1 dNTPs, 1x Taq polymerase
buffer and 1 i.u. of Taq DNA polymerase (Promega, Madison, USA). Amplification
conditions were: 5 min at 94°C, 40 cycles consisting of 1 min at 94°C,
1 min at 55°C and 1 min at 72°C, and a final elongation step of 10 min
at 72°C. The resulting 333 bp fragment was cloned in pGEM-T Easy vector
(Promega) and both strands were sequenced to verify the orientation of the
insert.
Northern blot analysis
RNA from guts of Nereis diversicolor was prepared using
Tri-Reagent (Molecular Research Centre, Cincinnati, USA), and quantitated
spectrophotometrically. 15 µg of RNA were denatured in formaldehyde,
fractionated on a 1.2% agarose gel, and then transferred to nitrocellulose
membranes (Hybond C extra, Amersham Biosciences, Uppsala, Sweden). The MPII
333 bp and the leech 18S (generous gift from Dr Christophe Lefebvre) probes
were labeled with 32P deoxy-CTP using the Megaprime DNA labelling
system (Amersham). The membranes were washed twice in 2x SSC, 0.1% SDS
at 42°C for 20 min, followed by two washes in 0.5x SSC, 0.1% SDS at
50°C. Membranes were finally exposed for several hours (18S probe) or days
(MPII probe) to Hyperfilm (Amersham) at 80°C with two intensifying
screens.
Preparation of probes for in situ hybridization
Sense and anti-sense digoxygenin (DIG)-labelled riboprobes were transcribed
from SP6 and T7 RNA polymerase promoters, respectively, from 1 µg of
linearized template following the conditions of Roche Diagnostics (DIG RNA
Labelling kit, Basel, Switzerland). The labelling yield of each probe was then
estimated after purification by comparison with a DIG-labelled control
RNA.
Tissue preparation
Pieces (several mm in length) from worm guts were rinsed in PBS, then fixed
in 4% paraformaldehyde in PBS for 12 h at 4°C, rinsed in PBS and
dehydrated in a graded ethanol series. Pieces were then transferred into
butanol and embedded in Paraplast (VWR International, West Chester, USA).
Frontal sections (7 µm) were prepared and stored at 4°C until in
situ hybridization.
In situ hybridization
After deparaffinization of sections and hydration, slides were treated with
10 µg of proteinase K (Sigma) for 30 min at 37°C, post-fixed in 4%
paraformaldehyde in PBS, washed in PBS, acetylated by 0.25% acetic anhydride
in 0.1 mol l1 triethanolamine, and incubated for
prehybridization for 2 h at 37°C in 4x SSC containing 50% formamide.
Hybridization was then performed overnight at 42°C in 100 µl of
hybridization solution per slide (40% formamide, 10% dextran sulfate, 1x
Denhardt's solution, 4x SSC, 10 mmol l1 DTT, 1 mg
ml1 yeast t-RNA, 1 mg ml1 denaturated
salmon sperm DNA containing 20 ng of denaturated DIG-labelled RNA probe).
Posthybridization and immunological detection
First washes were performed at 37°C, twice for 15 min with 2x
SSC, and twice for 15 min with 1x SSC. Sections were incubated for 30
min at 37°C in 0.5 mol l1 NaCl, 10 mmol
l1 Tris, 1 mmol l1 EDTA, pH 8.0,
containing 20 µg ml1 RNase A. Additional washes were
performed at 52°C with 2x SSC containing 50% formamide.
Immunological detection was then performed according to the manufacturer's
instructions (Roche Diagnostics, Basel, Switzerland).
| Results |
|---|
|
|
|---|
|
The metal content of the eluted fractions
(Fig. 1B) wasdetermined by
Flame Absorption Spectrometry and revealed that Cd was bound to three types of
ligands: (i) a high molecular mass fraction (>70 kDa) present in peak I
that would correspond to hemoglobin
(Demuynck and Dhainaut-Courtois,
1993
), (ii) lower molecular mass component(s) appearing as a
shoulder of peak I, already seen in the case of an acute Cd stress of the
worms (Demuynck and Dhainaut-Courtois,
1994
), and (iii) a third fraction present in peak II. Finally,
ELISA was performed on all the eluted fractions and revealed that the
immunoreactivity was mainly associated with peak II
(Fig. 1C). These results showed
that Cd was actually bound to the animals' gut and coeluted with a MPII or a
MPII-like molecule.
Electrophoresis and immunodetection of proteins
There were no significant differences between the peak II proteins from
control and Cd-exposed worms, as determined by electrophoretic analysis and
subsequent Coomassie Blue staining (Fig.
2, lanes 1 and 2, respectively). After westernblotting using mAb
anti-MPII, a main reactive band of quite similar intensity was obtained from
both controls and Cd-exposed worms (Fig.
2, lanes 4 and 5, respectively). According to the molecular mass
markers used (Fig. 2, lane 3),
this immunoreactive band would be slightly smaller than 14.4 kDa, which is in
agreement with the previously determined molecular mass of 13.7 kDa of the
MPII (Demuynck et al., 1993
).
An additional band was observed in the region of about 40 kDa that would
correspond to the artefactual polymerized MPII molecules.
|
Immunocytochemistry
Examination of the sections processed for immunohistochemistry revealed
that the wall of the midgut or intestine of Nereis diversicolor is
composed of a pseudostratified epithelium laying on a basal lamina that is
frequently in contact with blood sinus. In addition to the MPII cells
(MPII-C), the intestinal epithelium contains absorptive cells (enterocytes)
interspersed with a few mucous cells. The immunoreactive MPII-containing cells
(MPII-C) are numerous and rather regularly distributed in the midgut. They are
specially abundant in the folds of the epithelium
(Fig. 3A). The apex of these
cells reaches the intestinal lumen. The nucleus is located in the lower part
of the epithelium near the basal lamina and contains a single large nucleolus,
which is very typical of this cell type
(Fig. 3B). Identification of
these MPII-C was checked in a sipunculid species Sipunculus nudus,
whose hemerythocytes are immunoreactive with the MPII mAb
(Demuynck et al., 1991
). In
contrast to N. diversicolor, immunohistochemistry in S.
nudus did not reveal a positive reaction in the epithelium, but only in
rounded cells quite similar to hemerythrocytes in the blood sinus of the
connective tissue surrounding the intestinal epithelium
(Fig. 3C). In Nereis
diversicolor, light microscopy did not reveal any significant differences
in the number of immunoreactive cells in the gut of control and Cd-exposed
animals (data not shown).
|
In situ hybridization
We performed in situ hybridization to identify synthesis sites of
MPII RNA in the midgut of control worms. As shown in
Fig. 4A, labelling was observed
in cells of the pseudo-stratified epithelium. According to their particular
location (in the folds of the epithelium) and their shape, these cells seem to
correspond to MPII cells. The specificity of this labelling was confirmed by
the absence of labelling in the control
(Fig. 4B).
|
Electron microscopy
MPII-C were characterized by electron microscopy. Detection of this cell
type was facilitated by their characteristic nucleolus. The cytoplasm of these
cells contains numerous mitochondria localized around the nucleus and also
near the apex of the cell. The cisternae of rough endoplasmic reticulum are
poorly extended and specially distributed near the nucleus
(Fig. 5A). In the same region,
the Golgi apparatus shows flat saccules containing a moderate dense material
(not shown). Granules of dense electron material are distributed in the
cytoplasm. They have an irregular size and their material shows a homogenous
structure (see Fig. 5B). In the
nucleus, chromatine elements are scarce. The central core of the nucleolus
contains moderately dense material of fibrillar structure
(Fig. 5A). It is surrounded by
granular material comprising 1520 nm granules. Dense fibrillogranular
material, probably associated with chromatin, is distributed at the periphery
of the nucleolus. By contrast with control worms, several ultrastructural
modifications were observed in the MPII-C of worms exposed to Cd, of which the
most typical one occurred in acute Cd-exposed worms; similar but more discrete
modifications were recorded in chronically Cd-exposed worms. These
modifications concern the appearance, in the cytoplasm, of long ribbons of
endoplasmic reticulum (ER) surrounding the nucleus. In addition, the Golgi
complex shows dilated saccules containing dense material related to the
development of secretion granules (Fig.
5C). In the nucleolus, granular material becomes more extensive
and appears to be either integrated with the fibrillar component
(Fig. 5B) or an important
network around the central core (Fig.
5D).
|
Estimation of MPII content by ELISA
The MPII (or an MPII-like) content in gut extracts from control and
Cd-exposed worms was estimated by ELISA, where a significantly higher
reaction, and so a higher content, was obtained from gut extracts of both
chronically (Fig. 6B) and acute
(Fig. 6C) Cd-exposed worms
compared to controls (Fig.
6A).
|
Northern blot
Semi-quantitative analysis of MPII expression was undertaken by northern
blotting using RNA from guts of both control and acute or chronically
Cd-exposed worms. The results (Fig.
7) are the means of two independent experiments and were obtained
using Quantity One software (Bio-Rad) after normalization relative to 18S RNA
expression level. The data (Fig.
7B) show that the MPII mRNA expression level in Cd-exposed worms
remained almost unchanged from control levels. Thus, acute or chronic exposure
to cadmium did not induce expression of MPII mRNA.
|
| Discussion |
|---|
|
|
|---|
In comparison with control animals, no abnormal structures such as necrosis
or degenerative patterns were observed in the gut epithelium of individuals
exposed to Cd. However, cytological observations seemed to indicate the
appearance of a real cellular activation process, viewed by the structural
modification of the nucleolus. The nucleolus is the site of rRNA synthesis
processing and ribosome assembly (reviewed in
Hadjiolov, 1985
). It is
generally agreed that the granular component of nucleoli represents a region
where ribosomes are assembled and from which they pass out of the nucleolus
(reviewed in Goessens, 1984
).
In the cytoplasmic region of MPII-C, the increased importance of rough
endoplasmic reticulum and the secretory activity of the Golgi apparatus
suggested that the effect of Cd on these cells resulted in a synthesis of
proteins. The MPII or MPII-like content of the gut was shown by ELISA to be
increased in the case of Cd exposure, so these ultrastructural modifications
could reflect an increased synthesis of MPII. In addition, the detection of
MPII mRNA transcripts, realized by in situ hybridization, in the
cells of the intestine of control worms indicates clearly that this organ is
implicated in the synthesis of this protein, which would play a role in the
normal metabolism of this worm.
A possible role for MPII could be involvement in the binding of an
essential metal Fe during hemoglobin metabolism. In fact, metallothionein of
the digestive gland of the winkle was thought to be associated with regulation
of the essential metal Cu during metabolism of hemocyanin
(Bebianno et al., 1992
;
Bebianno and Langston, 1995
;
Langston and Zhou, 1987
).
However, comparison of the relative abundance of MPII mRNA transcripts in the
gut of non-exposed and Cd-exposed worms realized by northern blotting did not
reveal any changes in the expression levels of MPII mRNA following exposure to
Cd. These findings seem to indicate that MPII is apparently not
transcriptionally regulated when cadmium levels are high (compared to control
worms), but there is nevertheless synthesis of the protein in acute and
chronically intoxicated worms.
In contrast with metallothionein mRNA, which has been proposed as a
biomarker in the field of environmental toxicology
(Chan, 1995
;
Tom et al., 1999
), MPII mRNA
does not seem to be a good candidate. This kind of regulation at the protein
level appears similar to that reported for mammalian ferritin, an iron-storage
protein. In this case, there is translational regulation of ferritin synthesis
in response to iron but not transcriptional regulation. When cellular iron
content is low, an iron-regulatory protein (IRP) is able to bind to the
5' untranslated region of the ferritin mRNA and thus repress the
translation. When cellular iron content is high, in the absence of new
transcription, ferritin is thus synthesized
(Harrison and Arosio,
1996
).
The higher levels of MPII in Cd-exposed worms could also be explained by a
longer half-life of the molecule when bound to Cd. In fact, Bebianno and
Langston (1998
) reported that
the half-life of metallothionein induced by exposure to Cd in the digestive
gland of the winkle is very long and probably linked to the formation of a
very stable complex of Cd and metallothionein. In addition, it was reported
that the turnover rates of metallothionein induced by exposure to Cd (a
non-essential metal) are slow by comparison with those induced by copper or
zinc that are essential metals.
An alternative hypothesis from these results is that protein synthesis of
products reactive to the mAb used in this study does occur, but without an
increase in MPII mRNA expression, as the specific probe used in the molecular
biology experiments revealed that there was not any relevant change in MPII
mRNA levels after stimulation with Cd. We can speculate that the mAb used here
could recognize several isoforms of MPII, since at least two isoforms have
actually been identified in N. diversicolor, whereas the probe used
for northern blot and in situ hybridization is specific for only one
kind of MPII RNA, as shown by the controls. It is thus possible that we
detected the modulation of one isoform at the protein level. In fact, Lemoine
and Laulier (2003
), studying
the metallothionein mRNA level in the mussel Mytilus edulis following
metal exposure, found different induction patterns of mRNA for two different
metallothioneins.
There are several hypotheses concerning the role of this MPII. MPII
isolated from whole worms by Demuynck et al.
(1993
) showed 80.8% identity
with N. diversicolor myohemerythrin
(Takagi and Cox, 1991
), so
MPII could be considered as an isoform of this myohemerythrin. Thus, the
present molecule (MPII or MPII-like) detected in the intestine, can be
considered to be similar. However, the physiological function of a
myohemerythrin-like molecule in digestive cells is quite puzzling. The
literature reveals two related respiratory pigment candidates: hemerythrins
and myohemerythrins.
Hemerythrins are multisubunit, non-heme-iron, O2-carrying
proteins distributed among species of four groups of invertebrates, especially
sipunculids (Klippenstein,
1972
; Loehr et al.,
1978
), but also in brachiopods, priapulids
(Terwilliger, 1998
;
Kurtz, 1992
) and one
polychaete annelid, Magelona
(Benham, 1897
). They are
localized in free blood cells called hemerythrocytes, where they act as
high-affinity dioxygen carrier molecules
(Mangum, 1976
).
Myohemerythrins are monomeric proteins resembling hemerythrin subunits in
structure. They were first described in sipunculids as a storage form for
dioxygen in the muscles of the trunk, and then reported in various annelids,
including the polychaete annelid Nereis diversicolor
(Takagi and Cox, 1991
;
Demuynck et al., 1991
,
1993
), the oligochaete species
Allolobophora caliginosa
(Nejmeddine et al., 1992
) and
two species of achaete worms, Theromyzon tessulatum
(Coutte et al., 2001
) and
Hirudo medicinalis (Wang et al.,
2002
). Depending on the animal group, the localization of this
molecule differs. Thus, in the leech T. tessulatum, the molecule was
purified from yolk granules and coelomic fluid
(Baert et al., 1992
) but the
site of synthesis was not reported by the authors. By contrast, in the species
H. medicinalis (Wang et al.,
2002
), myohemerythrin was seen to be expressed in serotonergic
neurons (Retzius cells). For oligochaetes, as described here for N.
diversicolor, the molecule was recorded in the gut of the earthworm
(Nejmeddine et al., 1992
) and
it was also able to bind Cd. In Nereis diversicolor the intestine
constitutes an additional location for this type of molecule, since it was
first recorded in cytoplasmic granules of one type of coelomic cells: the
granulocytes I (Dhainaut-Courtois et al.,
1987
; Porchet-Henneré
et al., 1987
).
At this time, the exact role of these proteins MPII remains unclear. In
fact, although ability to bind dioxygen was not determined for the MPII
(Demuynck et al., 1993
) or for
the myohemerythrin (Takagi and Cox
1991
), both amino acid sequences contained the hemerythrin
signature sequence and the iron ligand residues of Themiste
zostericola myohemerythrin (Sheriff
et al., 1987
) or of Themiste dyscritum hemerythrin
subunit (Stenkamp et al.,
1984
). In addition, both proteins contain a leucine residue at
position 104 that would be necessary for the binding of dioxygen
(Xiong et al., 2000
). For
these reasons in Nereis diversicolor, although the main
O2-carrier is a giant extracellular hemoglobin present in a complex
vascular system including blood sinus surrounding the gut, MPII could act as a
dioxygen supplier. Its activity would perhaps occur in internal compartments
of the body (i.e. the intestine or the coelom). Since MPII is devoid of Fe
atoms when it is linked to Cd, probably because of competition with Fe and/or
a particular interaction with amino acids of this myohemerythrin-like molecule
(Demuynck et al., 1993
),
binding of Cd to the MPII should be considered as detrimental for the organism
and so could explain the increased level of MPII in the gut following cadmium
treatment of the worms. Thus, Cd binding to this molecule would represent a
biological sign of exposure. However, since no significant differences in gut
MPII levels were observed between acute and chronically exposed worms, MPII
level could not be viewed as a potential biomarker of Cd exposure. Nor does it
seems that MPII mRNA is a biomarker since its level was unchanged in
non-exposed and Cd-exposed worms.
On another hand, if we consider that this molecule is not able to carry
dioxygen, its function could be to serve as a trap for excess essential or
non-essential free metal ions in order to protect the integrity of the worm.
Thus, the status of this protein would be to play a role in the detoxification
of metals, like the metallothioneins. In fact, many invertebrates can react to
metallic stress by increasing metallothionein synthesis. However, the
mechanisms by which metallothioneins are regulated in invertebrates are still
poorly understood (Lemoine and Laulier,
2003
) and the primary function of metallothionein remains
enigmatic (Vasak and Hasler,
2000
). The presence of metallothioneins was reported in
oligochaetes (Furst and Nguyen,
1989
), located in the gut
(Morgan et al., 1989
).
However, to date, no metallothioneins have been isolated from Nereids. In
fact, metabolic labelling using 35S-cysteine and subsequent
separation of the proteins from Cd-exposed N. diversicolor by
two-dimensional electrophoresis failed to detect metallothioneins in this
species (Ruffin et al., 1994
).
Since Nereis diversicolor is characterized by a high resistance to
trace metals, the hypothesis of a function for MPII in detoxification of trace
metals is possible. In fact, the LC50 of Cd is about 100 mg
l1 after 192 h of exposure
(Bryan, 1976
), in contrast to
0.110 mg l1 for most marine invertebrates
(Cossa and Lassus, 1989
). The
particular location of MPII or MPII-like protein in the midgut, considered as
the main route for metal entry into the body, and the synthesis of this
molecule in the case of metal exposure, could be interpreted as a defence
mechanism to regulate the uptake of metal via the gut. Additional
experiments have to be performed to determine which hypothesis is correct.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Amiard, J.-C. and Cosson, R. P. (1997). Les métallothionéines. In Biomarqueurs en Écotoxicologie: Aspects Fondamentaux (ed. L. Lagadic, T. Caquet, J.-C. Amiard and F. Ramade), pp. 53-66. Paris: Masson.
Amiard, J.-C., Amiard-Triquet, C., Berthet, B. and Métayer, C. (1987). Comparative study of the patterns of bioaccumulation of essential (Cu, Zn) and non-essential (Cd, Pb) trace metals in various estuarine and coastal organisms. J. Exp. Mar. Biol. Ecol. 106,73 -89.
Baert, J.-L., Britel, M., Sautière, P. and Malécha, J. (1992). Ovohemerythrin, a major 14-kDa yolk protein distinct from vitellogenin in leech. Eur. J. Biochem. 209,563 -569.[Medline]
Bebianno, M. J. and Langston, W. J. (1995). Induction of metallothionein synthesis in the gill and the kidney of Littorina littorea exposed to cadmium. J. Mar. Biol. Assn. UK 75,173 -186.
Bebianno, M. J. and Langston, W. J. (1998). Cadmium and metallothionein in different tissues of the gastropod Littorina littorea. Talanta. 46,301 -313.[CrossRef]
Bebianno, M. J., Langston, W. J. and Simkiss, K. (1992). Metallothionein induction in Littorina littorea (Mollusca: Prosobranchia) on exposure to cadmium. J. Mar. Biol. Assn. UK 72,329 -342.
Benham, W. B. (1897). The blood of Magelona. Quart. J. Microsc. Sci. 39, 1-19.
Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72,248 -254.[CrossRef][Medline]
Bryan, G. W. (1976). Heavy metal contamination in the sea. In Marine Pollution (ed. R. Johnston), pp.185 -302. New York: Academic Press.
Chan, K. M. (1995). Metallothionein: potential biomarker for monitoring heavy metal pollution in Fish around Hong Kong. Mar. Pollut. Bull. 31,411 -415.[CrossRef]
Cossa, D. and Lassus, P. (1989). Le cadmium en milieu marin. Biogéochimie et écotoxicologie. Rapports Scientifiques et Techniques no. 16. Issy-les-Moulineaux, France: IFREMER.
Coutte, L., Slomianny, M.-C., Malecha, J. and Baert, J.-L. (2001). Cloning and expression analysis of a cDNA that encodes a leech hemerythrin. Biochem. Biophys. Acta 1518,282 -286.[Medline]
Dakhama, A. and Dhainaut, A. (1985). Dégénérescence cellulaire intestinale chez l'annélide polychète Perinereis cultrifera au cours de l'épitoquie et après ablation du cerveau. Repr. Nutr. Dev. 25,556 -566.
Deloffre, L., Salzet, B., Vieau, D., Andries, J.-C. and Salzet, M. (2003). Antibacterial properties of hemerythrin of the sand worm Nereis diversicolor. Neuroendocrinol. Lett. 24, 40-46.[CrossRef]
Demuynck, S., Sautière, P., Van Beemen, J. and Dhainaut-Courtois, N. (1991). Homologies entre les hémérythrines des sipunculiens et une métalloprotéine complexant le cadmium (MPII) d'une annélide polychète, Nereis diversicolor. C. R. Acad. Sci. Paris 312,317 -322.[Medline]
Demuynck, S., Li, K.-W., Van der Schors, R. and Dhainaut-Courtois, N. (1993). Amino acid sequence of the small cadmium-binding protein (MPII) from Nereis diversicolor (Annelida polychaeta). Evidence for a myohemerythrin structure. Eur. J. Biochem. 217,151 -156.[Medline]
Demuynck, S. and Dhainaut-Courtois, N. (1993). Identification of extracellular hemoglobin as the major high molecular weight cadmium binding protein of the polychaete annelid Nereis diversicolor.Comp. Biochem. Physiol. 106C,467 -472.
Demuynck, S. and Dhainaut-Courtois, N. (1994). Metal-protein binding patterns in the polychaete worm Nereis diversicolor during short-term acute cadmium stress. Comp. Biochem. Physiol. 108C,59 -64.[CrossRef]
Dhainaut, A. (1984). Aspects cytophysiologiques des coelomocytes de Néréidiens (Annélides Polychètes). Arch. Anat. microsc. Morph. exp. 73,133 -150.
Dhainaut, A. and Porchet-Henneré, E. (1988). Haemocytes and coelomocytes. In The Ultrastructure of Polychaeta. Microfauna Marina, vol4 (ed. W. Westheide and C. Q. Hermans), pp.215 -230. Stuttgart, New York: Gustav Fischer Verlag.
Dhainaut-Courtois, N., Nejmeddine, A., Baert, J.-L. and Dhainaut, A. (1987). Localisation immunocytochimique en microscopie électronique d'une protéine complexant le cadmium chez un ver marin (Nereis diversicolor O. F. Müller). C. R. Acad. Sci. Paris 305,237 -241.
Engel, D. W. and Roesijadi, G. (1987). Metallothionein: a monitoring tool. In Pollution Physiology of Estuarine Organisms (ed. W. B. Vernberg, A. Calabrese, F. P. Thurberg, and J. Verneberg), pp. 421-438. Columbia: University of South Carolina Press.
Engelhardt, R.-P., Dhainaut-Courtois, N. and Tramu, G. (1982). Immunohistochemical demonstration of a CCK-like peptide in the nervous system of a marine annelid worm, Nereis diversicolor O. F. Müller. Cell Tissue Res. 227,401 -411.[CrossRef][Medline]
Furst, A. and Nguyen, Q. (1989). Cadmium induced metallothionein in earthworm (Lumbricus terrestris). Biol. Trace Element Res. 21, 81-85.[Medline]
George, S. G. (1990). Biochemical and cytological assesments of metal toxicity in marine animals. In Heavy Metals in the Marine Environment (ed. R. W. Furness and P. S. Rainbow), pp. 123-142. Boca Raton: CRC Press.
Goessens, G. (1984). Nucleolar structure. Int. Rev. Cytol. 87,107 -158.[Medline]
Hadjiolov, A. A. (1985). The Nucleolus and Ribosome Biogenesis. New York: Springer-Verlag.268 pp.
Harrison, P. M. and Arosio, P. (1996). The ferritins: molecular properties, iron storage function and cellular regulation. Biochim. Biophys. Acta 1275,161 -203.[Medline]
Klaassen, C. D., Liu, J. and Choudhuri, S. (1999). Metallothionein: an intracellular protein to protect against cadmium toxicity. Annu. Rev. Pharmacol. Toxicol. 39,267 -294.[CrossRef][Medline]
Klippenstein, G. L. (1972). Molecular variants of Golfingia gouldii hemeythrin. The primary structure of the variants arising from five amino acid interchanges. Biochemistry 11,372 -379.[CrossRef][Medline]
Kurtz, D. M., Jr (1992). Molecular structure function relathionships of hemerythrins. In Advances in Comparative and Environmental Physiology, vol. 13 (ed. C. P. Mangum), pp. 151-171. Berlin, Heidelberg: Springer-Verlag.
Langston, W. J. and Zhou, M. (1987). Cadmium accumulation, distribution and elimination in the bivalve Macoma balthica: neither metallothionein nor metallothionein-like proteins are involved. Marine Environ. Res. 21,225 -237.[CrossRef]
Lemoine, S. and Laulier, M. (2003). Potential use of the levels of the mRNA of a specific metallothionein isoform (MT-20) in mussel (Mytilus edulis) as a biomarker of cadmium contamination. Mar. Pollut. Bull. 46,1450 -1455.[CrossRef][Medline]
Loehr, J. S., Lammers, P. J., Brimhall, B. and Hermodson, M.
A. (1978). Amino acid sequence of hemerythrin from
Themiste dyscritum. J. Biol. Chem.
253,5726
-5731.
Mangum, C. P. (1976). Primitive respiratory adaptations. In Adaptation to Environment: Assays on the Physiology of Marine Animals (ed. R. Newell), pp.191 -278. London: Butterworths.
Mason, A. Z. and Jenkins, K. D. (1995). Metal detoxication in aquatic organisms. In Metal Speciation and Bioavailability in Aquatic Systems, vol. 3 (ed. A. Tessier and D. R. Turner), pp. 479-608. Chichester: Wiley.
Michel, C. and Devillez, E. J. (1979).
Secretion of trypsin in the oesophagus of Nereis virens Sars
(Polychaeta Errantia). A biochemical and histological study. Biol.
Bull. 156,224
-232.
Morgan, J. E., Norey, C. G., Morgan, A. J. and Kay, J. (1989). A comparison of cadmium binding proteins isolated from the posterior alimentary canal of the earthworms Dendrodrilus rubidus and Lumbricus rubellus. Comp. Biochem. Physiol. 92C,15 -21.[CrossRef]
Nejmeddine, A., Dhainaut-Courtois, N., Baert, J.-L., Sautière, P., Fournet, B. and Boulenguer, P. (1988). Purification and characterization of a cadmium-binding protein from Nereis diversicolor (Annelida polychaeta). Comp. Biochem. Physiol. 89C,321 -326.[CrossRef]
Nejmeddine, A., Sautière, P., Dhainaut-Courtois, N. and Baert, J.-L. (1992). Isolation and characterization of a Cd-binding protein from Allolobophora calliginosa (Annelida Oligochaeta). Distinction from metallothioneins. Comp. Biochem. Physiol. 101C,601 -605.[CrossRef]
Palmiter, R. D. (1998). The elusive function of
metallothioneins. Proc. Natl. Acad. Sci. USA
95,8428
-8430.
Porchet-Henneré, E., Nejmeddine, A., Baert, J.-L. and Dhainaut-Courtois, N. (1987). Selective immunostaining of type 1 granulocytes of the polychaete annelid Nereis diversicolor by a monoclonal antibody against a cadmium-binding protein (MPII). Biol. Cell. 60,259 -261.
Punin, M. Y. and Lukyanova, E. L. (1984). Midgut epithelium organisation of the errant polychaete Nereis virens. 1 Absorptive and secretory cells. Citologia 26,60 -67.
Rainbow, P. S. (1985). Accumulation of Zn, Cu and Cd by crabs and barnacles. Estuar. Coastal Shelf Sci. 21,669 -686.[CrossRef]
Rainbow, P. S. (1998). Phylogeny of trace metal accumulation in crustaceans. In Metal Metabolism in Aquatic Environments (ed. W. J. Langston and M. J. Bebianno), pp.285 -319. London: Chapman and Hall.
Ruffin, P., Demuynck, S., Hilbert, J.-L. and Dhainaut, A. (1994). Stress proteins in the polychaete annelid Nereis diversicolor induced by heat shock or cadmium exposure. Biochimie 76,423 -427.[Medline]
Salzet-Raveillon, B., Rentier-Delrue, F. and Dhainaut, A. (1993). Detection of mRNA encoding an antibacterial metalloprotein (MPII) by in situ hybridization with a cDNA probe generated by polymerase chain reaction in the worm Nereis diversicolor. Cell. Mol. Biol. 39,105 -114.[Medline]
Saunier-Michel, C. (1992). Polychaeta digestive system. In Microscopic Anatomy of Invertebrates, vol.7 (ed. F. W. Harrison and S. L Gardiner), pp.53 -69. New York: Wiley-Liss.
Septier, F., Demuynck, S., Thomas, P. and Dhainaut-Courtois, N. (1991). Bioconcentration des métaux lourds chez une Annélide polychète estuarienne: Nereis diversicolor.Océanol. Acta II,263 -274.
Sheriff, S., Hendrickson, W. A. and Smith, J. L. (1987). Structure of myohemerythrin in the azidomet state at 1.7/1.3 A resolution. J. Mol. Biol. 197,273 -296.[CrossRef][Medline]
Stenkamp, R. E., Sieker, L. C. and Jensen, L. H. (1984). Binuclear iron complexes in methemerythrin and azidomethemerythrin at 2.0-A resolution. J. Am. Chem. Soc. 106,618 -622.[CrossRef]
Terwilliger, N. B. (1998). Functional adaptations of oxygen-transport proteins. J. Exp. Biol. 201,1085 -1098.[Abstract]
Takagi, T. and Cox, J. A. (1991). Primary structure of myohemerythrin from the annelid Nereis diversicolor.FEBS Lett. 285,25 -27.[CrossRef][Medline]
Tom, M., Jakubov, E., Rinkevitch, B. and Herut, B. (1999). Monitoring of hepatic metallothionein mRNA levels in the Fish Lithognathus mormurus evaluation of transition metal pollution in a Mediterranean coast. Mar. Pollut. Bull. 38,503 -508.[CrossRef]
Vasak, M. and Hasler, D. W. (2000). Metallothioneins: news functional and structural insight. Curr. Opin. Chem. Biol. 4,177 -183.[CrossRef][Medline]
Wang, W.-Z., Christoffers, K., Emes, R. and Blackshaw, S. E. (2002). Gene regulated 24 h after axotomy in identified 5-HT neurons in Hirudo medicinalis. J. Physiol. 539P, 107P.
Xiong, J., Phillips, R. S., Kurtz, D. M. Jr, Jin, S., Ai, J. and Sanders-Loehr, J. (2000). The O2 binding pocket of myohemerythrin: role of a conserved leucine. Biochemistry 39,8526 -8536.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
Related articles in JEB:
This article has been cited by other articles:
![]() |
K. Arney ARE WORMS HEAVY METAL FANS? J. Exp. Biol., March 1, 2004; 207(7): 1055 - 1056. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||