|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online December 3, 2004
Journal of Experimental Biology 207, 4573-4586 (2004)
Published by The Company of Biologists 2004
doi: 10.1242/jeb.01317
Functional characterisation of the Anopheles leucokinins and their cognate G-protein coupled receptor
Institute of Biomedical and Life Sciences, Division of Molecular Genetics, University of Glasgow, Glasgow G11 6NU, UK
* Author for correspondence (e-mail: j.a.t.dow{at}bio.gla.ac.uk)
Accepted 29 September 2004
| Summary |
|---|
|
|
|---|
Using a combination of computational and molecular approaches, a full-length cDNA for a candidate leucokinin-like receptor was isolated from A. stephensi, a close relative of A. gambiae. Alignment of the known leucokinin receptors all G protein-coupled receptors (GPCRs) with this receptor, identified some key conserved regions within the receptors, notably transmembrane (TM) domains I, II, III, VI and VII.
The Anopheles leucokinins and receptor were shown to be a functional receptor-ligand pair. All three Anopheles leucokinins caused a dose-dependent rise in intracellular calcium ([Ca2+]i) when applied to S2 cells co-expressing the receptor and an aequorin transgene, with a potency order of I>II>III.
Drosophila leucokinin was also found to activate the Anopheles receptor with a similar EC50 value to Anopheles leucokinin I. However, when the Anopheles peptides were applied to the Drosophila receptor, only Anopheles leucokinin I and II elicited a rise in [Ca2+]i. This suggests that the Anopheles receptor has a broader specificity for leucokinin ligands than the Drosophila receptor.
Antisera raised against the Anopheles receptor identified a doublet of approx. 65 and 72 kDa on western blots, consistent with the presence of four N-glycosylation sites within the receptor sequence, and the known glycosylation of the receptor in Drosophila. In Anopheles tubules, as in Drosophila, the receptor was localised to the stellate cells.
Thus we provide the first identification of Anopheles mosquito leucokinins (Anopheles leucokinins) and a cognate leucokinin receptor, characterise their interaction and show that Dipteran leucokinin signalling is closely conserved between Drosophila and Anopheles.
Key words: mosquito, Anopheles gambiae, Anopheles stephensi, aequorin, calcium, leucokinin
| Introduction |
|---|
|
|
|---|
Insect leucokinins elicit potent diuretic effects on the Malpighian tubules
of various insect species (Gade,
2004
) and have also been implicated in a number of other
physiological functions, such as the contraction of the hindgut
(Holman et al., 1999
;
Howarth et al., 2002
;
Veenstra et al., 1997
)
hence the term `myokinin'. In addition, recent studies have suggested the
involvement of leucokinins in dietary regulation and energy mobilisation
(Nachman et al., 2002
;
Seinsche et al., 2000
). As
such, the insect leucokinins have attracted a great deal of interest as lead
molecules for novel pesticides, including the development of
peptidase-resistant analogues of this family of peptides
(Teal et al., 1999
). Given the
diverse roles of insect leucokinins, elucidation of the mode of action of
these peptides via their cognate G protein-coupled receptors (GPCRs) is of
importance. Furthermore, as leucokinins have only been found in invertebrates,
it is likely that careful design of leucokinin antagonist or agonist analogues
will avoid interactions with mammalian species.
While identification of leucokinins and their cognate receptors has been
successfully undertaken in some insects
(Holman et al., 1984
;
Holman et al., 1999
;
Veenstra et al., 1997
),
including the genetically tractable Dipteran, Drosophila melanogaster
(Radford et al., 2002
;
Terhzaz et al., 1999
), less
progress has been made in studies of leucokinin signalling in biomedically
relevant insects.
The malaria mosquito, Anopheles gambiae, is one such insect.
Initial attempts to curb the spread of malaria involved the use of larvicides
and insecticides, against the mosquito vectors, and also the use of
chloroquine, which halts the progression of the disease in patients. Despite
these efforts, resistance has evolved in both the mosquitoes and in the
malaria parasites. Thus malaria, as other vector-borne diseases, is now
classed as a re-emerging disease (Gubler,
1998
). However, the sequencing of the A. gambiae genome
(Holt et al., 2002
) provides a
fresh direction for anti-malarial research. The action of leucokinins on the
Malpighian tubules of the yellow fever mosquito, Aedes aegypti, has
already been studied in great detail
(Beyenbach, 2003b
;
Veenstra et al., 1997
). Thus
in Anopheles, it is likely that leucokinins will also play an
important role in the regulation of water and ion homeostasis. An initial
survey of the completed Anopheles genome identified a single
leucokinin-like gene (Riehle et al.,
2002
). Approximately 37 neurohormone receptor-like-encoding
sequences were also identified in a survey of the GPCR repertoire of the
Anopheles genome (Hill et al.,
2002
). It is likely that one of these will represent a receptor
for Anopheles leucokinins.
In this study we identified three leucokinin peptides (Anopheles leucokinins I-III) from the A. gambiae genome and demonstrated effects on calcium signalling via a putative cognate GPCR-coupled receptor cloned from its close relative, A. stephensi. All Anopheles leucokinins increase intracellular calcium in a dose-dependent manner. Furthermore, the Anopheles leucokinin receptor is responsive to D. melanogaster Drosophila leucokinin, while the D. melanogaster leukokinin-like receptor (LKR) is only sensitive to Anopheles leucokinins I and II.
| Materials and methods |
|---|
|
|
|---|
Identification of A. gambiae leucokinin receptor: TBLASTN analysis
was carried out on the completed Anopheles gambiae genome using the
predicted protein product of the Drosophila leucokinin receptor,
CG10626 (Radford et al.,
2002
). The protein sequences of the Lymnaea stagnalis L.
(Cox et al., 1997
) and
Boophilus microplus Canestrini
(Holmes et al., 2003
)
leucokinin-like receptors were also used to confirm the sequence match. The
BLOSUM62 matrix (default settings) was used for all BLAST analysis as above.
This identified a sequence within the Anopheles genome that encoded a
putative protein of 377 amino acids (GenBank accession no. agCP10499, E-value
2x1059). No other good sequence matches were
identified in the completed genome sequence. However, this sequence only
represented a portion of a presumed GCPR, encompassing only the strictly
conserved TM domains. Efforts were made to identify a full-length transcript
by the use of the FgenesH gene prediction program, although subsequent
attempts to amplify the putative open reading frame (ORF) region by polymerase
chain reaction (PCR) from Anopheles cDNA failed. Therefore, a RACE
approach was undertaken in order to identify the correct cDNA sequence.
Insects
A. stephensi Liston and its close relative A. gambiae are
malaria-carrying anopheline mosquitoes. For reasons of availability, A.
stephensi was used as a source of cDNA in this study. Non-infective,
sugar-water-fed adults were a kind gift from Dr L. Ranford-Cartwright,
University of Glasgow, UK. Female animals were used upon receipt. If
mosquitoes were not used immediately, they were maintained over a 12 h:12 h
L:D photoperiod at 55% humidity at 22°C, on 5% sucrose (v/v) solution
ad libitum for a maximum of 3 days before use in experiments.
RT-PCR of putative leucokinin receptor
For cDNA preparations, total RNA was extracted (Sigma Tri-reagent,
Gillingham, Dorset, UK) from whole A. stephensi and reverse
transcribed with Superscript II (Invitrogen). 1 µl of the reverse
transcription reaction was used as a template for PCR containing the
gene-specific primer pairs given below. Additionally, to control against
genomic contamination in cDNA preps, primers were used that had been designed
around intron/exon boundaries of the predicted A. gambiae leucokinin
receptor gene. Use of such primers verified the quality of the cDNA used in
PCR reactions. Further controls were performed, which included non-reverse
transcribed template (i.e. no cDNA). The primers used were:
GGAATCTGCCCGAGTTTATGTG and GTTCTTCAGCATCGTAATGTCGC. PCR cycle conditions for
reactions were as follows: 93°C 3 min; 36 cycles of (93°C 30 s,
59°C 30 s, 72°C 1 min); 72°C (1 min). PCR products obtained from
such RT-PCR experiments were cloned into pCRII-TOPOTM using the
Invitrogen Topoisomerase (TOPO TA Cloning) system. Cloned plasmids were
purified using Qiagen kits and sequenced to confirm their identity.
5'-RACE and 3'-RACE of putative leucokinin receptor
Poly(A)+ RNA was purified from whole fly total RNA using the
magnetic Dynabeads® mRNA purification kit
(Dynal® Bromborough, UK) according to the manufacturers'
instructions. The RACE procedure was carried out using the SMARTTM RACE
cDNA Amplification kit (Clontech, Oxford, UK). This kit provides a method for
performing both 5'- and 3'-RACE. 5'- and 3'-RACE-ready
cDNAs are generated as separate cDNA samples, using 1 µg
poly(A)+ mRNA as starting material for each of the 5'- and
3'-RACE-ready cDNAs.
SMARTTM RACE PCR reactions were carried out according to the
manufacturers' instructions using Advantage 2 Polymerase Mix (Clontech). Both
5'- and 3'-RACE reactions were set up according to the protocol,
using 200 nmol l1 gene-specific primer and 2.5 µl
RACE-ready cDNA in the appropriate reaction mix. Gene-specific primers were
carefully designed in such a way that they had the following characteristics:
2328 nucleotides, 5070% GC, Tm
70°C.
To perform 5'-RACE PCR, an antisense primer was designed, and for
3'-RACE PCR a sense primer was designed. Primers were situated as close
as possible to the end of known cDNA sequence in order to keep the size of
RACE products to a minimum.
Designing primers with a Tm
70°C allowed the use
of touchdown PCR to improve the specificity of the amplification. This method
uses an annealing temperature during the initial PCR cycles that is higher
than the Tm of the universal primer, allowing only
gene-specific synthesis during these cycles. Cycling was performed in
thin-walled dome-topped 0.2 ml PCR tubes in a Hybaid PCR Express-Gradient
thermocycler. This was performed as follows: 94°C, 3 min; 5 cycles of
94°C 5 s, 72°C 3 min; 5 cycles of 94°C 5 s, 70°C 10 s,
72°C, 3 min; 2025 cycles of 94°C 5 s, 68°C 10 s, 72°C 3
min. Note that the extension time is dependent on the length of the fragment
being amplified; 3 min is suitable for cDNA fragments of 24 kb.
RACE products were then separated by agarose gel electrophoresis under standard conditions and individual products gel-purified. RACE products were then directly cloned into pCRII-TOPOTM vector and individual clones analysed by restriction enzyme digestion and automated sequencing.
Expression of Anopheles leucokinin receptor in S2 cells
The ORF of the A. stephensi leucokinin-like receptor was amplified
using the primers GCCCAGAAGAAATCATGCAAGCAACAG and
GCAAAACAGCTCACAGTTAATACACATTGCTCG, and A. stephensi whole fly cDNA as
template (see Fig. 3). This was
cloned into the pMT/V5-His TOPO® vector, and the correct
orientation determined by restriction enzyme digestion. Constructs were then
sequenced to confirm error free cloning of the ORF. The amplification product
included the native stop codon to prevent inclusion of the C-terminal V5-His
peptide in the expressed protein. S2 cells, cultured under standard conditions
(Radford et al., 2002
) were
transiently transfected with the apoaequorin ORF
(Radford et al., 2002
) and the
A. stephensi leucokinin-like receptor ORF constructs, and expression
induced using Cu2+ (Radford et
al., 2002
).
|
Peptide synthesis
The three putative Anopheles leucokinins identified in this work
were synthesised as C-terminally amidated peptides (Research
Genetics/Invitrogen Inc.). Peptides were dissolved in H2O to a
concentration of 1 mmol l1 and then diluted to the required
working concentration in Schneider's medium supplemented with 10% foetal calf
serum (FCS; Invitrogen Inc.).
Measurements of intracellular Ca2+ using aequorin
Transfected S2 cells were harvested and incubated with 2.5 µmol
l1 coelenterazine in the dark at room temperature (RT) for
12 h (Radford et al.,
2002
). 25,000 cells were then placed in 135 µl Schneider's
medium supplemented with 10% FCS in a well of a white polystyrene 96-well
plate (Berthold Technologies, Redbourn, UK). Bioluminescence recordings were
carried out using a Mithras LB940 automated 96-well plate reader (Berthold
Technologies) and MikroWin software. 15 µl of each of the
Anopheles leucokinin peptides was applied at the required
concentration. At the end of each recording samples were disrupted by the
addition of 100 µl lysis solution, and the Ca2+ concentrations
calculated as previously described (Rosay
et al., 1997
).
Generation of antibodies against Anopheles leucokinin receptor and immunolocalisation of the receptor
Rabbit anti-peptide antibodies were raised against the epitope
PHPDSGGESGGDGE (residues 531543; Genosphere Technologies, Paris,
France). An N-terminal cysteine residue was incorporated to permit conjugation
to bovine serum albumin (BSA). The antiserum to Anopheles leucokinin
receptor showed some background immunoreactivity and, therefore, was purified
on a HiTrap Protein A HP column (Amersham Pharmacia Biotech, Little Chalfont,
UK) according to the manufacturer's instructions. The protocol used for
immunohistology was as described previously
(Radford et al., 2002
).
Briefly, the IgG to Anopheles leucokinin receptor was diluted 1:1000
or the pre-immune serum diluted 1:500. Primary antibody incubations were
performed overnight. A Texas Red-conjugated affinity-purified goat anti-rabbit
antibody (Jackson Immunologicals, Westgrove, PA, USA) was used at a dilution
of 1:1000 for visualization of the primary antiserum. Prior to mounting on
slides, tubules were stained with 1 µg ml1 of
4',6'-diamidino-2-phenylindole hydrochloride (DAPI; Sigma-Aldrich,
Gillingham, UK). Slides were viewed using a Zeiss 510 META confocal microscope
and images were processed with a Zeiss LSM 5 Image Browser.
Western blot analysis
Protein samples were prepared from tubule or head tissues by homogenization
in ice-cold Tris lysis buffer (20 mmol l1 Tris, pH 7.5, 250
mmol l1 sucrose, 2 mmol l1 EDTA, 100 mmol
l1 NaCl, 50 mmol l1
ß-mercaptoethanol, 2% (w/v) SDS) with protease inhibitor cocktail
(P-8340, Sigma). Samples were centrifuged for 10 min at 13 000
g at 4°C to remove debris. Supernatants were removed to a
clean tube and assayed for protein concentration (Lowry protein assay). 15
µg of each sample were run on SDS-PAGE and blotted according to standard
methods. The filter was blocked for 3 h in PBS with 0.1% Tween 20 and 10%
non-fat dry milk and washed in PBS/Tween 20 once for 5 min. The filter was
incubated for 3 h at RT with IgG to Anopheles leucokinin receptor,
diluted 1:1000 (or the pre-immune serum diluted 1:500) in PBS/Tween 20/milk,
washed in PBS/Tween 20 three times for 10 min, and incubated for 1 h with
secondary antibody (1:5000 horseradish peroxidase-labelled anti-rabbit IgG
antibody; Amersham Biosciences) diluted in PBS/Tween 20/milk. The filter was
then washed in PBS for 1 h and protein bands visualized using enhanced
chemiluminescence (ECL, Amersham Biosciences).
Statistics
Where appropriate, statistical significance was assessed using Student's
t-test for unpaired samples, taking P<0.05 as the
critical value.
| Results |
|---|
|
|
|---|
|
The ORF of the A. gambiae leucokinin gene encodes a predicted
protein of 296 amino acids (Fig.
1). Analysis using the PROSITE program
(Bairoch et al., 1997
)
identified a putative 24-amino-acid signal peptide. Within the remaining
protein sequence there are three leucokinin peptides predicted, which have
been named according to their similarity to the three known Aedes
aegypti leucokinins. The Anopheles leucokinins I and III
(Anopheles leucokinins) are flanked by dibasic proteolytic cleavage
sites, and in all three peptides a C-terminal Gly is present, which is
predicted to be processed into a C-terminal amide group in the mature
peptides. A different proteolytic cleavage site is present at the N terminus
of Anopheles leucokinin II, consisting of a single Arg with a Lys at
residue 8. Four Cys residues are also present in the protein region
before to the leucokinin peptide sequences. The position of the four Cys
residues is identical in Aedes, suggesting that these residues may
play an important role in the function of the precursor protein, perhaps in
the formation of disulphide bridges
(Veenstra et al., 1997
). It
has been proposed that these residues are responsible for paraldehyde-fuchsin
staining observed in the leucokinin-immunoreactive neuroendocrine cells of the
abdominal ganglion in hemimetabolous insects
(Veenstra et al., 1997
). Owing
to the conservation of this staining between insect species, it was suggested
that this region of the precursor protein would be conserved between species.
However, alignment of the Anopheles and Aedes leucokinin
precursors revealed very little other sequence conservation within this
region.
Using the same technique, a leucokinin-like precursor gene was also identified in the available sequence of the Drosophila pseudoobscura genome. The D. pseudoobscura sequence encodes a putative protein of 176 amino acids, containing only a single leucokinin peptide sequence, identical to Drosophila leucokinin from D. melanogaster. A full-length mature transcript could not be reliably identified for D. pseudoobscura, although alignment of the protein with that from D. melanogaster (data not shown) suggested that the entire ORF had been identified.
Comparison of the sequence of the Anopheles leucokinin peptides
Anopheles leucokinin I is 15 residues in length, equal to
Drosophila leucokinin, the longest leucokinin known to date
(Fig. 2). It is also similar in
sequence, being identical to Drosophila leucokinin in the bioactive
C-terminal pentapeptide
PheHisSerTrpGlyamide.
Unsurprisingly, Anopheles leucokinin is most similar across its
entire length to Aedes leucokinin I, being identical at 10 residues.
Significant similarity can also be seen to another mosquito leucokinin,
culekinin III. Similar to Aedes aegypti and Culex
salinarius, there are three leucokinins present in Anopheles.
The shortest of the three, Anopheles leucokinin II (7 residues), is
identical to culekinin I, with only one residue different from Aedes
leucokinin II (Fig. 2). In
addition, the C-terminal pentapeptide is identical to Drosophila
leucokinin and Anopheles leucokinin I. The third peptide,
Anopheles leucokinin III, is 10 residues in length, 1 longer than
Aedes leucokinin III, but equal to culekinin II
(Fig. 2). The C-terminal core
is more divergent in Anopheles leucokinin III, although it retains
the essential
PheX1X2TrpGlyamide
motif, the His being replaced by a Tyr and the Ser being replaced by a Pro.
This is identical to the C-terminal cores of Aedes leucokinin III and
culekinin II, although less similarity is seen in the more N-terminal
residues.
|
Insect leucokinin gene families
This characterisation of a leucokinin peptide-encoding gene within the
A. gambiae genome shows that, as in the yellow fever mosquito,
Aedes aegypti (Veenstra et al.,
1997
), three leucokinin peptides are encoded by a single
transcript. Three leucokinins have also been identified in Culex
salinarius (Meola et al.,
1998
), suggesting that this may be a conserved feature among
mosquitoes. By contrast, only one leucokinin is found in Drosophila
melanogaster (Terhzaz et al.,
1999
), Drosophila pseudoobscura (this work) and Musca
domestica (Coast et al.,
2002
). This division reflects Dipteran taxonomy: Anopheles,
Aedes and Culex are all members of the family Culicidae, whereas
Drosophila and Musca are both Schizophora. The two groups
thus diverge at the suborder level (Nematocera and Brachycera, respectively);
so it is possible that both at the gene organisation level and their proposed
modes of action (Beyenbach,
1998
; Dow and Davies,
2003
), the leucokinins may plausibly differ between mosquitoes and
Drosophila.
In non-Dipteran insects, the numbers of known leucokinins vary widely:
three leucokinins have been isolated from the moth Helicoverpa zea;
eight from Leucophaea maderae and five from Acheta
domesticus and Periplaneta Americana
(Torfs et al., 1999
). It would
be interesting to determine whether the leucokinin peptides from non-mosquito
species are also contained within one precursor protein.
The putative Anopheles leucokinin receptor is a GPCR
Having identified a putative leucokinin receptor from the A.
gambiae genome, RT-PCR primers were designed within regions of high
sequence similarity to CG10626 and PCR carried out on A.
stephensi cDNA. Successful PCR showed bands of expected product sizes for
A. gambiae cDNA and genomic DNA (470 bp and 632 bp, respectively;
data not shown). Cloning and sequencing of these bands confirmed that the
identified Anopheles sequence is expressed. Primers were then
designed within the identified gene sequence to carry out 5'-RACE and
3'-RACE analysis to determine the full transcript sequence of the
putative leucokinin receptor gene. Three primers were designed for each
direction and RACE-ready cDNAs were prepared from A. stephensi whole
fly poly(A)+ mRNA. Discrete products were amplified using the AnLKR
5' RACE 1 (
1.2 kb), 2 (
1.4 kb) and 3 (
1.9 kb), and
3' RACE 2 (
1.1 kb) and 3 (
1.8 kb) primers (data not shown).
Amplified products were gel extracted, cloned into the
pCRII-TOPO® vector and sequenced in full. From this information
the full transcript of the putative A. stephensi leucokinin receptor
gene was assembled.
Analysis of the sequence identified from 5'-RACE and 3'-RACE
experiments suggests that the sequence of the full mature transcript for this
gene has been identified. It is a 2684 bp transcript containing the coding
sequence of 1722 bp, a 962 bp 5'-UTR and a 181 bp 3'-UTR. The
sequence (bases 14) contains a portion of a consensus sequence for the
initiation of transcription. The lack of known genomic sequence for A.
stephensi precluded the analysis of upstream sequence in order to
identify further regulatory sequences. However, no downstream promoter element
(DPE)-dependent promoter sequences could be identified in the transcript
sequence, as has been found in the Drosophila genomic sequence for
LKR (Radford et al., 2002
). A
single ATG start codon was identified, beginning at base 963 and terminating
at a stop codon at position 2682. Upstream of this presumed start codon there
are 17 in-frame stop codons. A polyadenylation signal is also present within
the 3'-UTR of the sequence (AATAAA, 18 bp from the polyadenylation
site). By alignment of the A. stephensi transcript with the A.
gambiae genome it is likely that at least six introns are contained
within this gene. There is less conservation of the nucleotide sequence within
the 5'-UTR, and so the presence of additional introns within this region
cannot be ruled out. Again, by inference from the A. gambiae genome,
the transcript is thought to be contained within approximately a 7.5 kb
genomic region.
The ORF of the A. stephensi leucokinin-like receptor transcript
encodes a 574 amino acid protein, which has an estimated molecular mass of 65
kDa. Analysis using the TMHMM program
(Krogh et al., 2001
) suggests
that this predicted protein exhibits the conserved 7 TM domain structure,
consistent with it being a functional GPCR
(Fig. 3). Other conserved GPCR
motifs are also present, such as a triplet motif Asp-Tyr-His at residues
136138, just downstream of the putative third TM domain. Also two
conserved Cys residues, Cys112 and Cys201, located in
the first and second extracellular loops respectively, are predicted to form a
disulphide bond. There are also four potential N-glycosylation sites
within the protein sequence, Asn14 and Asn18 in the
N-terminal region, and Asn190 and Asn195 in the putative
second extracellular loop. Interestingly, a difference exists between the
C-terminal domain of the A. stephensi leucokinin receptor and that of
the D. melanogaster LKR: it does not contain the epitope used to
raise the anti-CG10626 (D. melanogaster LKR) antibody
(Radford et al., 2002
).
Alignment and comparison of the known leucokinin receptors
The protein sequences of the known leucokinin-like receptors, the
Drosophila LKR (CG10626; Radford
et al., 2002
), the lymnokinin receptor (GenBank accession
AAD11810 Cox et al., 1997
),
the B. microplus receptor (AAF72891
Holmes et al., 2003
) and the
putative A. stephensi receptor
(Fig. 3) were aligned using the
CLUSTAL X program (Thompson et al.,
1994
). The sequence alignment was annotated using BioEdit
(Hall, 1999
)
(Fig. 4). The alignment
demonstrates that there is considerable similarity between the four protein
sequences, particularly within the TM domain-containing regions, with the N-
and C-terminal regions being more divergent
(Fig. 4). However, the sequence
similarity is not as high within TM domains IV and V. The size and spacing of
the TM domains is also consistent between the proteins, with only the second
extracellular loop being variable in size. Interestingly, the first
extracellular loop also appears highly conserved within these proteins,
suggesting possible involvement in ligand binding. Several key residues are
also conserved. A typical GPCR triplet motif is present immediately after the
third TM domain as either an AspArgTyr or
AspArgHis sequence. Cys residues, thought to form a disulphide
bridge in GPCRs, are also present in the first and second extracellular loops
of all but the lymnokinin receptor. Similarly putative
N-glycosylation sites in the second extracellular loop are present in
all proteins except the lymnokinin receptor. Although there is a great deal of
sequence diversity within the C-terminal domains, several Ser and Thr residues
appear conserved, representing possible sites of phosphorylation.
|
TBLASTN analysis using the putative A. stephensi receptor was also
used to identify a similar sequence in the A. gambiae genome
sequence. In addition, Drosophila LKR was used to identify a similar
sequence within the partially sequenced D. pseudoobscura genome.
Without experimental confirmation the C-terminal domains could not be reliably
predicted for the A. gambiae and D. pseudoobscura proteins.
Therefore, the putative seven TM domain-containing regions of all the protein
sequences were determined using the TMHMM program, and then aligned as before.
From the resulting output dnd file a dendrogram was created using the TREEVIEW
program (Page, 1996
)
(Fig. 5). The percentage
identity and similarity of each were also calculated using BioEdit and were
scored on the BLOSUM62 matrix (Table
1). This was carried out for the TM domain-containing regions and
for the four known full-length proteins.
|
|
The dendrogram of the TM domain regions of the leucokinin-like receptors reflects the phylogeny of the species concerned (Fig. 5). The D. melanogaster and D. pseudoobscura sequences are closely related, as are the A. stephensi and A. gambiae sequences. These four sequences are more closely related to each other than to the Boophilus sequence, with the molluscan Lymnaea sequence being the least similar. This ancestral relationship is verified by the identity and similarity values for each sequence comparison (Table 1).
The Anopheles leucokinins act on the Anopheles leucokinin receptor to raise intracellular calcium
Having identified both leucokinins and a leucokinin-like receptor within
Anopheles, it was important to establish that they are a functional
receptorligand pairing. S2 cells were transiently transfected with the
apoaequorin ORF and the A. stephensi leucokinin-like
receptor ORF constructs, and their expression induced, as previously
described (Radford et al.,
2002
). The S2 cells were then subsequently assayed for
agonist-dependent activation by monitoring [Ca2+]i
levels. An agonist-dependent response in [Ca2+]i level
was observed for each of the three Anopheles leucokinin peptides,
with an order of potency of I>II>III for this particular concentration
(Fig. 6). [Ca2+]i levels increased from basal levels of 50 nmol
l1 to a peak concentration of 365 nmol l1,
325 nmol l1 and 300 nmol l1, respectively,
upon addition of Anopheles leucokinin I, II or III, representing a 6-
to 7.3-fold increase. The [Ca2+]i responses were
biphasic in nature, with a primary Ca2+ spike followed by a
secondary wave that peaked at approximately 175 nmol l1, for
all three peptides, 2030 spost-stimulation.
|
Doseresponse curves were then generated for the action of each
Anopheles leucokinin on the A. stephensi leucokinin
receptor. The receptor responds to all three Anopheles leucokinins in
a dose-dependent manner (Fig.
7). Anopheles leucokinin I appears to be slightly more
potent at stimulating the receptor, with an EC50 value of 2.0 nmol
l1, compared to values of 7.4 nmol l1 and
8.4 nmol l1 for the action of Anopheles leucokinin
II and III, respectively. The EC50 values for the actions of these
peptides on the A. stephensi receptor are considerably higher than
the value for the action of Drosophila leucokinin on the
Drosophila LKR, 56.5 pmol l1
(Radford et al., 2002
).
Similar EC50 values were determined for the effect of the eight
known leucokinins on Leucophaea maderae hindgut contraction
(Cook et al., 1989
;
Cook et al., 1990
). The
existence of a higher affinity leucokinin receptor within Anopheles
cannot be ruled out, although it is likely that this sequence would also have
been identified from the genomic sequence. Nonetheless, it should be
remembered that the action of Aedes leucokinins on Aedes
tubules were consistent with the existence of more than one receptor
(Veenstra et al., 1997
); and
that the broad concentration range of Drosophila leucokinin on
Drosophila tubule was also taken as suggestive of multiple receptor
classes (Terhzaz et al.,
1999
).
|
Cross-specific leucokinin signalling
The effects of the Anopheles leucokinins on S2 cells expressing
the Drosophila LKR, CG10626
(Radford et al., 2002
) were
also established. As this was assessing cross-specific activity, relatively
high concentrations of peptide were used (106 mol
l1 and 107 mol l1). The
application of both Anopheles leucokinin I (15 amino acids) and
Anopheles leucokinin II (7 amino acids) produced a
concentration-dependent increase in [Ca2+]i in the S2
cells (Fig. 8).
Anopheles leucokinin III (10 amino acids) did not produce any
observable [Ca2+]i response at either concentration
tested. This is probably because Anopheles leucokinin III possesses a
C-terminal pentapeptide, which diverges from the
PheHisSerTrpGlyamide present in
Drosophila leucokinin. Both Anopheles leucokinin I and II
contain a C-terminal pentapeptide identical to that of Drosophila
leucokinin. The fact that only the Anopheles receptor responds to the
divergent Anopheles leucokinin III peptide suggests that the
Anopheles receptor has a broader specificity than the
Drosophila receptor. The only extracellular regions of these proteins
that are considerably different in sequence are the short N-terminal domain
and the second extracellular loop. It is tempting to speculate that
differences in these regions may define the specificity of the receptor-ligand
interaction. Although responses to Anopheles leucokinin I and II were
seen at both 106 mol l1 and
107 mol l1, the response to
106 mol l1 was significantly larger. At
this concentration, [Ca2+]i levels were seen to increase
from basal levels of 5060 nmol l1 to a peak
concentration of 250 nmol l1 (Anopheles leucokinin
I) and 208 nmol l1 (Anopheles leucokinin II),
approximately a four- and fivefold increase, respectively. It was not possible
to determine whether these were maximal responses because the high
concentrations required meant that doseresponse curves could not be
generated. For both peptides the [Ca2+]i response was
biphasic in nature, with a primary Ca2+ spike and evidence of a
sustained secondary wave that peaked at approximately 130 nmol
l1 2030 s post-stimulation. Although the primary
[Ca2+]i responses to 107 mol
l1 Anopheles leucokinin I and II were different,
the secondary responses were similar.
|
The effects of Drosophila leucokinin
(Terhzaz et al., 1999
) on S2
cells expressing the A. stephensi leucokinin receptor were also
ascertained. Drosophila leucokinin was found to stimulate the A.
stephensi receptor in a similar manner to the Anopheles
leucokinins, displaying an EC50 value of 1.1 nmol
l1, very similar to that of Anopheles leucokinin I
(Fig. 9).
|
The Anopheles leucokinin receptor is expressed in stellate cells of the Malpighian tubule
Antisera against the Anopheles leucokinin receptor identified a
band of the predicted size of 65 kDa on western blots, together with a heavier
band of approximately 72 kDa (Fig.
10). A similar doublet was observed in Drosophila, and
was shown to be due to N-glycosylation of the receptor
(Radford et al., 2002
).
Consistent with this, four potential N-glycosylation sites are
present within the receptor sequence.
|
Immunocytochemistry of adult Anopheles tubule revealed staining specific to the stellate cells (Fig. 11), as has previously been reported for the Drosophila leucokinin receptor.
|
| Discussion |
|---|
|
|
|---|
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bairoch, A., Bucher, P. and Hofmann, K. (1997).
The PROSITE database, its status in 1997. Nucleic Acids
Res. 25,217
-221.
Beyenbach, K. W. (1998). Reversible paracellular permeability changes in insect Malpighian tubules induced by the neuropeptide leucokinin. FASEB J. 12, 5869.
Beyenbach, K. W. (2003a). Regulation of tight junction permeability with switch-like speed. Curr. Opin. Nephrol. Hypertens. 12,543 -550.[Medline]
Beyenbach, K. W. (2003b). Transport mechanisms
of diuresis in Malpighian tubules of insects. J. Exp.
Biol. 206,3845
-3856.
Coast, G. M., Zabrocki, J. and Nachman, R. J. (2002). Diuretic and myotropic activities of N-terminal truncated analogs of Musca domestica kinin neuropeptide. Peptides 23,701 -708.[CrossRef][Medline]
Cook, B. J., Holman, G. M., Wagner, R. M. and Nachman, R. J. (1989). Pharmacological actions of a new class of neuropeptides, the leucokinins I-IV, on the visceral muscles of Leucophaea maderae.Comp. Biochem. Physiol. 93C,257 -262.[CrossRef]
Cook, B. J., Holman, G. M., Wagner, R. M. and Nachman, R. J. (1990). Comparative pharmacological actions of leucokinins V-VIII on the visceral muscles of Leucophaea maderae. Comp. Biochem. Physiol. 95C,19 -24.[CrossRef]
Cox, K. J., Tensen, C. P., Van der Schors, R. C., Li, K. W., van
Heerikhuizen, H., Vreugdenhil, E., Geraerts, W. P. and Burke, J. F.
(1997). Cloning, characterization, and expression of a
G-protein-coupled receptor from Lymnaea stagnalis and identification
of a leucokinin-like peptide, PSFHSWSamide, as its endogenous ligand.
J. Neurosci. 17,1197
-1205.
Dow, J. A. T. and Davies, S. A. (2001). The Drosophila melanogaster Malpighian tubule. Adv. Insect Physiol. 28,1 -83.
Dow, J. A. T. and Davies, S. A. (2003).
Integrative physiology and functional genomics of epithelial function in a
genetic model organism. Physiol. Rev.
83,687
-729.
Gade, G. (2004). Regulation of intermediary metabolism and water balance of insects by neuropeptides. Annu. Rev. Entomol. 49,93 -113.[CrossRef][Medline]
Gubler, D. J. (1998). Resurgent vector-borne diseases as a global health problem. Emerg. Infect Dis. 4,442 -450.[Medline]
Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41, 95-98.
Hill, C. A., Fox, A. N., Pitts, R. J., Kent, L. B., Tan, P. L.,
Chrystal, M. A., Cravchik, A., Collins, F. H., Robertson, H. M. and Zwiebel,
L. J. (2002). G protein-coupled receptors in Anopheles
gambiae. Science 298,176
-178.
Holman, G. M., Cook, B. J. and Wagner, R. M. (1984). Isolation and partial characterization of five myotropic peptides present in head extracts of the cockroach, Leucophaea maderae.Comp. Biochem. Physiol. 77C,1 -5.
Holman, G. M., Nachman, R. J. and Coast, G. M. (1999). Isolation, characterization and biological activity of a diuretic myokinin neuropeptide from the housefly, Musca domestica.Peptides 20,1 -10.[CrossRef][Medline]
Holmes, S. P., Barhoumi, R., Nachman, R. J. and Pietrantonio, P. V. (2003). Functional analysis of a G protein-coupled receptor from the southern cattle tick Boophilus microplus (Acari: Ixodidae) identifies it as the first arthropod myokinin receptor. Insect Mol. Biol. 12,27 -38.[CrossRef][Medline]
Holt, R. A., Subramanian, G. M., Halpern, A., Sutton, G. G.,
Charlab, R., Nusskern, D. R., Wincker, P., Clark, A. G., Ribeiro, J. M.,
Wides, R. et al. (2002). The genome sequence of the malaria
mosquito Anopheles gambiae. Science
298,129
-149.
Howarth, C. J., Prince, R. I., Dyker, H., Losel, P. M., Seinsche, A. and Osborne, R. H. (2002). Structure-activity relationship of contractile effects induced by helicokinins in the isolated gut of the lepidopteran caterpillar Spodoptera frugiperda. J. Insect Physiol. 48,75 -82.[CrossRef][Medline]
Krogh, A., Larsson, B., von Heijne, G. and Sonnhammer, E. L. (2001). Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J. Mol. Biol. 305,567 -580.[CrossRef][Medline]
Meola, S. M., Clottens, F. L., Holman, G. M., Nachman, R. J., Nichols, R., Schoofs, L., Wright, M. S., Olson, J. K., Hayes, T. K. and Pendleton, M. W. (1998). Isolation and immunocytochemical characterization of three tachykinin-related peptides from the mosquito, Culex salinarius. Neurochem. Res. 23,189 -202.[CrossRef][Medline]
Nachman, R. J., Strey, A., Isaac, E., Pryor, N., Lopez, J. D., Deng, J. G. and Coast, G. M. (2002). Enhanced in vivo activity of peptidase-resistant analogs of the insect kinin neuropeptide family. Peptides 23,735 -745.[CrossRef][Medline]
Page, R. D. M. (1996). TREEVIEW: An application
to display phylogenetic trees on personal computers. Comput. Appl.
Biosci. 12,357
-358.
Radford, J. C., Davies, S. A. and Dow, J. A. T.
(2002). Systematic GPCR analysis in Drosophila
melanogaster identifies a leucokinin receptor with novel roles.
J. Biol. Chem. 277,38810
-38817.
Riehle, M. A., Garcynski, S. F., Crim, J. W., Hill, C. A. and
Brown, M. R. (2002). Neropeptides and peptide hormones in
Anopheles gambiae. Science
298,172
-175.
Rosay, P., Davies, S. A., Yu, Y., Sozen, A., Kaiser, K. and Dow, J. A. T. (1997). Cell-type specific calcium signalling in a Drosophila epithelium. J. Cell Sci. 110,1683 -1692.[Abstract]
Seinsche, A., Dyker, H., Losel, P., Backhaus, D. and Scherkenbeck, J. (2000). Effect of helicokinins and ACE inhibitors on water balance and development of Heliothis virescens larvae. J. Insect Physiol. 46,1423 -1431.[CrossRef][Medline]
Teal, P. E., Meredith, J. A. and Nachman, R. J. (1999). Development of amphiphylic mimics of insect neuropeptides for pest control. Ann. NY Acad. Sci. 897,348 -360.[CrossRef][Medline]
Terhzaz, S., O'Connell, F. C., Pollock, V. P., Kean, L., Davies, S. A., Veenstra, J. A. and Dow, J. A. T. (1999). Isolation and characterization of a leucokinin-like peptide of Drosophila melanogaster. J. Exp. Biol. 202,3667 -3676.[Abstract]
Thompson, J. D., Higgins, D. G. and Gibson, T. J.
(1994). CLUSTAL W: improving the sensitivity of progressive
multiple sequence alignment through sequence weighting, position-specific gap
penalties and weight matrix choice. Nucleic Acids Res.
22,4673
-4680.
Torfs, P., Nieto, J., Veelaert, D., Boon, D., van de Water, G., Waelkens, E., Derua, R., Calderon, J., de Loof, A. and Schoofs, L. (1999). The kinin peptide family in invertebrates. Ann. NY Acad. Sci. 897,361 -373.[CrossRef][Medline]
Veenstra, J. A., Pattillo, J. M. and Petzel, D. H.
(1997). A single cDNA encodes all three Aedes
leucokinins, which stimulate both fluid secretion by the Malpighian tubules
and hindgut contractions. J. Biol. Chem.
272,10402
-10407.
Yu, M. J. and Beyenbach, K. W. (2004). Effects
of leucokinin-VIII on Aedes Malpighian tubule segments lacking stellate cells.
J. Exp. Biol. 207,519
-526.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
G. M. Coast Neuroendocrine control of ionic homeostasis in blood-sucking insects J. Exp. Biol., February 1, 2009; 212(3): 378 - 386. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Davies and S. Terhzaz Organellar calcium signalling mechanisms in Drosophila epithelial function J. Exp. Biol., February 1, 2009; 212(3): 387 - 400. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. T. Dow Integrative physiology, functional genomics and the phenotype gap: a guide for comparative physiologists J. Exp. Biol., May 1, 2007; 210(9): 1632 - 1640. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Patrick, K. Aimanova, H. R. Sanders, and S. S. Gill P-type Na+/K+-ATPase and V-type H+-ATPase expression patterns in the osmoregulatory organs of larval and adult mosquito Aedes aegypti J. Exp. Biol., December 1, 2006; 209(23): 4638 - 4651. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kaufmann, J. C. Mathai, W. G. Hill, J. A. T. Dow, M. L. Zeidel, and J. L. Brodsky Developmental expression and biophysical characterization of a Drosophila melanogaster aquaporin Am J Physiol Cell Physiol, August 1, 2005; 289(2): C397 - C407. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||