spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online December 3, 2004
Journal of Experimental Biology 207, 4573-4586 (2004)
Published by The Company of Biologists 2004
doi: 10.1242/jeb.01317
This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Radford, J. C.
Right arrow Articles by Dow, J. A. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Radford, J. C.
Right arrow Articles by Dow, J. A. T.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CALCIUM COMPOUNDS
*CALCIUM, ELEMENTAL
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Functional characterisation of the Anopheles leucokinins and their cognate G-protein coupled receptor

Jonathan C. Radford, Selim Terhzaz, Pablo Cabrero, Shireen-A. Davies and Julian A. T. Dow*

Institute of Biomedical and Life Sciences, Division of Molecular Genetics, University of Glasgow, Glasgow G11 6NU, UK

* Author for correspondence (e-mail: j.a.t.dow{at}bio.gla.ac.uk)

Accepted 29 September 2004


    Summary
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Identification of the Anopheles gambiae leucokinin gene from the completed A. gambiae genome revealed that this insect species contains three leucokinin peptides, named Anopheles leucokinin I-III. These peptides are similar to those identified in two other mosquito species, Aedes aegypti and Culex salinarius. Additionally, Anopheles leucokinin I displays sequence similarity to Drosophila melanogaster leucokinin.

Using a combination of computational and molecular approaches, a full-length cDNA for a candidate leucokinin-like receptor was isolated from A. stephensi, a close relative of A. gambiae. Alignment of the known leucokinin receptors – all G protein-coupled receptors (GPCRs) – with this receptor, identified some key conserved regions within the receptors, notably transmembrane (TM) domains I, II, III, VI and VII.

The Anopheles leucokinins and receptor were shown to be a functional receptor-ligand pair. All three Anopheles leucokinins caused a dose-dependent rise in intracellular calcium ([Ca2+]i) when applied to S2 cells co-expressing the receptor and an aequorin transgene, with a potency order of I>II>III.

Drosophila leucokinin was also found to activate the Anopheles receptor with a similar EC50 value to Anopheles leucokinin I. However, when the Anopheles peptides were applied to the Drosophila receptor, only Anopheles leucokinin I and II elicited a rise in [Ca2+]i. This suggests that the Anopheles receptor has a broader specificity for leucokinin ligands than the Drosophila receptor.

Antisera raised against the Anopheles receptor identified a doublet of approx. 65 and 72 kDa on western blots, consistent with the presence of four N-glycosylation sites within the receptor sequence, and the known glycosylation of the receptor in Drosophila. In Anopheles tubules, as in Drosophila, the receptor was localised to the stellate cells.

Thus we provide the first identification of Anopheles mosquito leucokinins (Anopheles leucokinins) and a cognate leucokinin receptor, characterise their interaction and show that Dipteran leucokinin signalling is closely conserved between Drosophila and Anopheles.

Key words: mosquito, Anopheles gambiae, Anopheles stephensi, aequorin, calcium, leucokinin


    Introduction
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The Malpighian (renal) tubules of insects are mission-critical organs (Beyenbach, 2003bGo; Dow and Davies, 2001Go) and as such are an excellent target tissue for the development of novel insecticides against agriculturally and biomedically relevant pest species. Not only do they regulate water and ion homeostasis, but they have a major role in detoxification. Thus, modulation of fluid transport by Malpighian tubules is an effective method for novel pest control strategies.

Insect leucokinins elicit potent diuretic effects on the Malpighian tubules of various insect species (Gade, 2004Go) and have also been implicated in a number of other physiological functions, such as the contraction of the hindgut (Holman et al., 1999Go; Howarth et al., 2002Go; Veenstra et al., 1997Go) – hence the term `myokinin'. In addition, recent studies have suggested the involvement of leucokinins in dietary regulation and energy mobilisation (Nachman et al., 2002Go; Seinsche et al., 2000Go). As such, the insect leucokinins have attracted a great deal of interest as lead molecules for novel pesticides, including the development of peptidase-resistant analogues of this family of peptides (Teal et al., 1999Go). Given the diverse roles of insect leucokinins, elucidation of the mode of action of these peptides via their cognate G protein-coupled receptors (GPCRs) is of importance. Furthermore, as leucokinins have only been found in invertebrates, it is likely that careful design of leucokinin antagonist or agonist analogues will avoid interactions with mammalian species.

While identification of leucokinins and their cognate receptors has been successfully undertaken in some insects (Holman et al., 1984Go; Holman et al., 1999Go; Veenstra et al., 1997Go), including the genetically tractable Dipteran, Drosophila melanogaster (Radford et al., 2002Go; Terhzaz et al., 1999Go), less progress has been made in studies of leucokinin signalling in biomedically relevant insects.

The malaria mosquito, Anopheles gambiae, is one such insect. Initial attempts to curb the spread of malaria involved the use of larvicides and insecticides, against the mosquito vectors, and also the use of chloroquine, which halts the progression of the disease in patients. Despite these efforts, resistance has evolved in both the mosquitoes and in the malaria parasites. Thus malaria, as other vector-borne diseases, is now classed as a re-emerging disease (Gubler, 1998Go). However, the sequencing of the A. gambiae genome (Holt et al., 2002Go) provides a fresh direction for anti-malarial research. The action of leucokinins on the Malpighian tubules of the yellow fever mosquito, Aedes aegypti, has already been studied in great detail (Beyenbach, 2003bGo; Veenstra et al., 1997Go). Thus in Anopheles, it is likely that leucokinins will also play an important role in the regulation of water and ion homeostasis. An initial survey of the completed Anopheles genome identified a single leucokinin-like gene (Riehle et al., 2002Go). Approximately 37 neurohormone receptor-like-encoding sequences were also identified in a survey of the GPCR repertoire of the Anopheles genome (Hill et al., 2002Go). It is likely that one of these will represent a receptor for Anopheles leucokinins.

In this study we identified three leucokinin peptides (Anopheles leucokinins I-III) from the A. gambiae genome and demonstrated effects on calcium signalling via a putative cognate GPCR-coupled receptor cloned from its close relative, A. stephensi. All Anopheles leucokinins increase intracellular calcium in a dose-dependent manner. Furthermore, the Anopheles leucokinin receptor is responsive to D. melanogaster Drosophila leucokinin, while the D. melanogaster leukokinin-like receptor (LKR) is only sensitive to Anopheles leucokinins I and II.


    Materials and methods
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Bioinformatics
Identification of Anopheles gambiae Miles leucokinins: TBLASTN analysis was carried out on the completed A. gambiae genome using the predicted protein product of the Aedes aegypti L. preproleucokinin transcript (Veenstra et al., 1997Go) (GenBank accession no. AAC47656. The BLOSUM62 matrix (default settings) was used for all BLAST analysis. A 333 bp sequence was identified, which potentially encoded a protein with homology to the Aedes preproleucokinin (E-value 2x10–29). This region plus the surrounding 20 kb of genomic sequence either side was then analysed with the Softberry FgenesH gene prediction program (www.softberry.com).

Identification of A. gambiae leucokinin receptor: TBLASTN analysis was carried out on the completed Anopheles gambiae genome using the predicted protein product of the Drosophila leucokinin receptor, CG10626 (Radford et al., 2002Go). The protein sequences of the Lymnaea stagnalis L. (Cox et al., 1997Go) and Boophilus microplus Canestrini (Holmes et al., 2003Go) leucokinin-like receptors were also used to confirm the sequence match. The BLOSUM62 matrix (default settings) was used for all BLAST analysis as above. This identified a sequence within the Anopheles genome that encoded a putative protein of 377 amino acids (GenBank accession no. agCP10499, E-value 2x10–59). No other good sequence matches were identified in the completed genome sequence. However, this sequence only represented a portion of a presumed GCPR, encompassing only the strictly conserved TM domains. Efforts were made to identify a full-length transcript by the use of the FgenesH gene prediction program, although subsequent attempts to amplify the putative open reading frame (ORF) region by polymerase chain reaction (PCR) from Anopheles cDNA failed. Therefore, a RACE approach was undertaken in order to identify the correct cDNA sequence.

Insects
A. stephensi Liston and its close relative A. gambiae are malaria-carrying anopheline mosquitoes. For reasons of availability, A. stephensi was used as a source of cDNA in this study. Non-infective, sugar-water-fed adults were a kind gift from Dr L. Ranford-Cartwright, University of Glasgow, UK. Female animals were used upon receipt. If mosquitoes were not used immediately, they were maintained over a 12 h:12 h L:D photoperiod at 55% humidity at 22°C, on 5% sucrose (v/v) solution ad libitum for a maximum of 3 days before use in experiments.

RT-PCR of putative leucokinin receptor
For cDNA preparations, total RNA was extracted (Sigma Tri-reagent, Gillingham, Dorset, UK) from whole A. stephensi and reverse transcribed with Superscript II (Invitrogen). 1 µl of the reverse transcription reaction was used as a template for PCR containing the gene-specific primer pairs given below. Additionally, to control against genomic contamination in cDNA preps, primers were used that had been designed around intron/exon boundaries of the predicted A. gambiae leucokinin receptor gene. Use of such primers verified the quality of the cDNA used in PCR reactions. Further controls were performed, which included non-reverse transcribed template (i.e. no cDNA). The primers used were: GGAATCTGCCCGAGTTTATGTG and GTTCTTCAGCATCGTAATGTCGC. PCR cycle conditions for reactions were as follows: 93°C 3 min; 36 cycles of (93°C 30 s, 59°C 30 s, 72°C 1 min); 72°C (1 min). PCR products obtained from such RT-PCR experiments were cloned into pCRII-TOPOTM using the Invitrogen Topoisomerase (TOPO TA Cloning) system. Cloned plasmids were purified using Qiagen kits and sequenced to confirm their identity.

5'-RACE and 3'-RACE of putative leucokinin receptor
Poly(A)+ RNA was purified from whole fly total RNA using the magnetic Dynabeads® mRNA purification kit (Dynal® Bromborough, UK) according to the manufacturers' instructions. The RACE procedure was carried out using the SMARTTM RACE cDNA Amplification kit (Clontech, Oxford, UK). This kit provides a method for performing both 5'- and 3'-RACE. 5'- and 3'-RACE-ready cDNAs are generated as separate cDNA samples, using 1 µg poly(A)+ mRNA as starting material for each of the 5'- and 3'-RACE-ready cDNAs.

SMARTTM RACE PCR reactions were carried out according to the manufacturers' instructions using Advantage 2 Polymerase Mix (Clontech). Both 5'- and 3'-RACE reactions were set up according to the protocol, using 200 nmol l–1 gene-specific primer and 2.5 µl RACE-ready cDNA in the appropriate reaction mix. Gene-specific primers were carefully designed in such a way that they had the following characteristics: 23–28 nucleotides, 50–70% GC, Tm≥70°C. To perform 5'-RACE PCR, an antisense primer was designed, and for 3'-RACE PCR a sense primer was designed. Primers were situated as close as possible to the end of known cDNA sequence in order to keep the size of RACE products to a minimum.

Designing primers with a Tm≥70°C allowed the use of touchdown PCR to improve the specificity of the amplification. This method uses an annealing temperature during the initial PCR cycles that is higher than the Tm of the universal primer, allowing only gene-specific synthesis during these cycles. Cycling was performed in thin-walled dome-topped 0.2 ml PCR tubes in a Hybaid PCR Express-Gradient thermocycler. This was performed as follows: 94°C, 3 min; 5 cycles of 94°C 5 s, 72°C 3 min; 5 cycles of 94°C 5 s, 70°C 10 s, 72°C, 3 min; 20–25 cycles of 94°C 5 s, 68°C 10 s, 72°C 3 min. Note that the extension time is dependent on the length of the fragment being amplified; 3 min is suitable for cDNA fragments of 2–4 kb.

RACE products were then separated by agarose gel electrophoresis under standard conditions and individual products gel-purified. RACE products were then directly cloned into pCRII-TOPOTM vector and individual clones analysed by restriction enzyme digestion and automated sequencing.

Expression of Anopheles leucokinin receptor in S2 cells
The ORF of the A. stephensi leucokinin-like receptor was amplified using the primers GCCCAGAAGAAATCATGCAAGCAACAG and GCAAAACAGCTCACAGTTAATACACATTGCTCG, and A. stephensi whole fly cDNA as template (see Fig. 3). This was cloned into the pMT/V5-His TOPO® vector, and the correct orientation determined by restriction enzyme digestion. Constructs were then sequenced to confirm error free cloning of the ORF. The amplification product included the native stop codon to prevent inclusion of the C-terminal V5-His peptide in the expressed protein. S2 cells, cultured under standard conditions (Radford et al., 2002Go) were transiently transfected with the apoaequorin ORF (Radford et al., 2002Go) and the A. stephensi leucokinin-like receptor ORF constructs, and expression induced using Cu2+ (Radford et al., 2002Go).



View larger version (69K):
[in this window]
[in a new window]
 
Fig. 3. The cDNA and putative protein sequence of the Anopheles stephensi leucokinin receptor gene. Nucleotide and amino acid residue numbers are indicated at the end of each line, amino acids are centred on their codons. The polyadenylation signal, and start and stop codons are marked in bold type. Upstream in frame stop codons are double underlined, and the positions of predicted introns in the cDNA sequence are indicated by ><. Predicted TM regions are indicated by a shaded box. The peptide epitope used to raise the anti-CG10626 antibody (Radford et al., 2002Go) is not present within the A. stephensi receptor sequence. {ddagger}Potential N-glycosylation sites in the protein sequence. The conserved GPCR Asp-Arg-Tyr/His (DRY/H) motif just after TM III and conserved Cys (C) residues in extracellular loops 1 and 2 are also marked in bold type. The position of binding sites for primers used in the analysis and construction of the cDNA sequence are indicated. Nucleotides that are different between the cDNA and primer sequences are indicated in red type.

 

Peptide synthesis
The three putative Anopheles leucokinins identified in this work were synthesised as C-terminally amidated peptides (Research Genetics/Invitrogen Inc.). Peptides were dissolved in H2O to a concentration of 1 mmol l–1 and then diluted to the required working concentration in Schneider's medium supplemented with 10% foetal calf serum (FCS; Invitrogen Inc.).

Measurements of intracellular Ca2+ using aequorin
Transfected S2 cells were harvested and incubated with 2.5 µmol l–1 coelenterazine in the dark at room temperature (RT) for 1–2 h (Radford et al., 2002Go). 25,000 cells were then placed in 135 µl Schneider's medium supplemented with 10% FCS in a well of a white polystyrene 96-well plate (Berthold Technologies, Redbourn, UK). Bioluminescence recordings were carried out using a Mithras LB940 automated 96-well plate reader (Berthold Technologies) and MikroWin software. 15 µl of each of the Anopheles leucokinin peptides was applied at the required concentration. At the end of each recording samples were disrupted by the addition of 100 µl lysis solution, and the Ca2+ concentrations calculated as previously described (Rosay et al., 1997Go).

Generation of antibodies against Anopheles leucokinin receptor and immunolocalisation of the receptor
Rabbit anti-peptide antibodies were raised against the epitope PHPDSGGESGGDGE (residues 531–543; Genosphere Technologies, Paris, France). An N-terminal cysteine residue was incorporated to permit conjugation to bovine serum albumin (BSA). The antiserum to Anopheles leucokinin receptor showed some background immunoreactivity and, therefore, was purified on a HiTrap Protein A HP column (Amersham Pharmacia Biotech, Little Chalfont, UK) according to the manufacturer's instructions. The protocol used for immunohistology was as described previously (Radford et al., 2002Go). Briefly, the IgG to Anopheles leucokinin receptor was diluted 1:1000 or the pre-immune serum diluted 1:500. Primary antibody incubations were performed overnight. A Texas Red-conjugated affinity-purified goat anti-rabbit antibody (Jackson Immunologicals, Westgrove, PA, USA) was used at a dilution of 1:1000 for visualization of the primary antiserum. Prior to mounting on slides, tubules were stained with 1 µg ml–1 of 4',6'-diamidino-2-phenylindole hydrochloride (DAPI; Sigma-Aldrich, Gillingham, UK). Slides were viewed using a Zeiss 510 META confocal microscope and images were processed with a Zeiss LSM 5 Image Browser.

Western blot analysis
Protein samples were prepared from tubule or head tissues by homogenization in ice-cold Tris lysis buffer (20 mmol l–1 Tris, pH 7.5, 250 mmol l–1 sucrose, 2 mmol l–1 EDTA, 100 mmol l–1 NaCl, 50 mmol l–1 ß-mercaptoethanol, 2% (w/v) SDS) with protease inhibitor cocktail (P-8340, Sigma). Samples were centrifuged for 10 min at 13 000 g at 4°C to remove debris. Supernatants were removed to a clean tube and assayed for protein concentration (Lowry protein assay). 15 µg of each sample were run on SDS-PAGE and blotted according to standard methods. The filter was blocked for 3 h in PBS with 0.1% Tween 20 and 10% non-fat dry milk and washed in PBS/Tween 20 once for 5 min. The filter was incubated for 3 h at RT with IgG to Anopheles leucokinin receptor, diluted 1:1000 (or the pre-immune serum diluted 1:500) in PBS/Tween 20/milk, washed in PBS/Tween 20 three times for 10 min, and incubated for 1 h with secondary antibody (1:5000 horseradish peroxidase-labelled anti-rabbit IgG antibody; Amersham Biosciences) diluted in PBS/Tween 20/milk. The filter was then washed in PBS for 1 h and protein bands visualized using enhanced chemiluminescence (ECL, Amersham Biosciences).

Statistics
Where appropriate, statistical significance was assessed using Student's t-test for unpaired samples, taking P<0.05 as the critical value.


    Results
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Identification of the A. gambiae leucokinins
The Softberry FgenesH gene prediction program predicted a gene contained within a 2179 bp genomic region, including a single intron of 629 bp. Further inspection revealed a transcript of 1545 bp in length, containing an ORF of 891 bp, a 265 bp 5'-UTR and a 3'-UTR of approximately 385 bp(Fig. 1). This would appear to be a full mature transcript, as it contains a perfect consensus sequence for the initiation of transcription (–2 to +4, TCAGTT), and a polyadenylation signal consensus sequence in the 3'-UTR (1508–1513, AATAAA). There is also a TATA box motif upstream of the initiation of transcription site (–30 to –34, TATAA). There is a single presumed ATG start codon at positions 266–268, preceded by four in-frame stop codons.



View larger version (77K):
[in this window]
[in a new window]
 
Fig. 1. The cDNA and protein sequences of the putative Anopheles gambiae preproleucokinin gene. Nucleotide and amino acid residue numbers are indicated at the end of each line, amino acids are centred on their codons. The start codon, following stop codon and putative polyadenylation signal are indicated in bold type. Upstream in-frame stop codons are double underlined. A putative TATA-box sequence is underlined, the initiation of transcription consensus sequence is indicated by a shaded box, and the position of the single intron is indicated by ><. Within the putative preproleucokinin the location of the three A. gambiae leucokinin peptides are indicated by shaded boxes and a possible signal peptide is underlined. Proteolytic processing sites thought to be used are underlined. The Gly (G) residues that are presumed to be processed to C-terminal amides in the mature A. gambiae leucokinins are indicated in bold and double underlined. Four Cys (C) residues within the preproleucokinin are also indicated by shaded boxes.

 

The ORF of the A. gambiae leucokinin gene encodes a predicted protein of 296 amino acids (Fig. 1). Analysis using the PROSITE program (Bairoch et al., 1997Go) identified a putative 24-amino-acid signal peptide. Within the remaining protein sequence there are three leucokinin peptides predicted, which have been named according to their similarity to the three known Aedes aegypti leucokinins. The Anopheles leucokinins I and III (Anopheles leucokinins) are flanked by dibasic proteolytic cleavage sites, and in all three peptides a C-terminal Gly is present, which is predicted to be processed into a C-terminal amide group in the mature peptides. A different proteolytic cleavage site is present at the N terminus of Anopheles leucokinin II, consisting of a single Arg with a Lys at residue –8. Four Cys residues are also present in the protein region before to the leucokinin peptide sequences. The position of the four Cys residues is identical in Aedes, suggesting that these residues may play an important role in the function of the precursor protein, perhaps in the formation of disulphide bridges (Veenstra et al., 1997Go). It has been proposed that these residues are responsible for paraldehyde-fuchsin staining observed in the leucokinin-immunoreactive neuroendocrine cells of the abdominal ganglion in hemimetabolous insects (Veenstra et al., 1997Go). Owing to the conservation of this staining between insect species, it was suggested that this region of the precursor protein would be conserved between species. However, alignment of the Anopheles and Aedes leucokinin precursors revealed very little other sequence conservation within this region.

Using the same technique, a leucokinin-like precursor gene was also identified in the available sequence of the Drosophila pseudoobscura genome. The D. pseudoobscura sequence encodes a putative protein of 176 amino acids, containing only a single leucokinin peptide sequence, identical to Drosophila leucokinin from D. melanogaster. A full-length mature transcript could not be reliably identified for D. pseudoobscura, although alignment of the protein with that from D. melanogaster (data not shown) suggested that the entire ORF had been identified.

Comparison of the sequence of the Anopheles leucokinin peptides
Anopheles leucokinin I is 15 residues in length, equal to Drosophila leucokinin, the longest leucokinin known to date (Fig. 2). It is also similar in sequence, being identical to Drosophila leucokinin in the bioactive C-terminal pentapeptide –Phe–His–Ser–Trp–Gly–amide. Unsurprisingly, Anopheles leucokinin is most similar across its entire length to Aedes leucokinin I, being identical at 10 residues. Significant similarity can also be seen to another mosquito leucokinin, culekinin III. Similar to Aedes aegypti and Culex salinarius, there are three leucokinins present in Anopheles. The shortest of the three, Anopheles leucokinin II (7 residues), is identical to culekinin I, with only one residue different from Aedes leucokinin II (Fig. 2). In addition, the C-terminal pentapeptide is identical to Drosophila leucokinin and Anopheles leucokinin I. The third peptide, Anopheles leucokinin III, is 10 residues in length, 1 longer than Aedes leucokinin III, but equal to culekinin II (Fig. 2). The C-terminal core is more divergent in Anopheles leucokinin III, although it retains the essential –Phe–X1X2–Trp–Gly–amide motif, the His being replaced by a Tyr and the Ser being replaced by a Pro. This is identical to the C-terminal cores of Aedes leucokinin III and culekinin II, although less similarity is seen in the more N-terminal residues.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 2. Comparison of the fruit fly and mosquito leucokinin peptides. The sequences of the Drosophila melanogaster (Drosophila leucokinin), Aedes aegypti (Aedes leucokinin), Culex salinarius (Culex leucokinin) and Anopheles gambiae (Anopheles leucokinin) leucokinin peptides are compared. Residues conserved with Drosophila leucokinin are indicated in bold. Analysis of the D. pseudoobscura genome sequence suggests that a single leucokinin identical to that of D. melanogaster is encoded.

 

Insect leucokinin gene families
This characterisation of a leucokinin peptide-encoding gene within the A. gambiae genome shows that, as in the yellow fever mosquito, Aedes aegypti (Veenstra et al., 1997Go), three leucokinin peptides are encoded by a single transcript. Three leucokinins have also been identified in Culex salinarius (Meola et al., 1998Go), suggesting that this may be a conserved feature among mosquitoes. By contrast, only one leucokinin is found in Drosophila melanogaster (Terhzaz et al., 1999Go), Drosophila pseudoobscura (this work) and Musca domestica (Coast et al., 2002Go). This division reflects Dipteran taxonomy: Anopheles, Aedes and Culex are all members of the family Culicidae, whereas Drosophila and Musca are both Schizophora. The two groups thus diverge at the suborder level (Nematocera and Brachycera, respectively); so it is possible that both at the gene organisation level and their proposed modes of action (Beyenbach, 1998Go; Dow and Davies, 2003Go), the leucokinins may plausibly differ between mosquitoes and Drosophila.

In non-Dipteran insects, the numbers of known leucokinins vary widely: three leucokinins have been isolated from the moth Helicoverpa zea; eight from Leucophaea maderae and five from Acheta domesticus and Periplaneta Americana (Torfs et al., 1999Go). It would be interesting to determine whether the leucokinin peptides from non-mosquito species are also contained within one precursor protein.

The putative Anopheles leucokinin receptor is a GPCR
Having identified a putative leucokinin receptor from the A. gambiae genome, RT-PCR primers were designed within regions of high sequence similarity to CG10626 and PCR carried out on A. stephensi cDNA. Successful PCR showed bands of expected product sizes for A. gambiae cDNA and genomic DNA (470 bp and 632 bp, respectively; data not shown). Cloning and sequencing of these bands confirmed that the identified Anopheles sequence is expressed. Primers were then designed within the identified gene sequence to carry out 5'-RACE and 3'-RACE analysis to determine the full transcript sequence of the putative leucokinin receptor gene. Three primers were designed for each direction and RACE-ready cDNAs were prepared from A. stephensi whole fly poly(A)+ mRNA. Discrete products were amplified using the AnLKR 5' RACE 1 (~1.2 kb), 2 (~1.4 kb) and 3 (~1.9 kb), and 3' RACE 2 (~1.1 kb) and 3 (~1.8 kb) primers (data not shown). Amplified products were gel extracted, cloned into the pCRII-TOPO® vector and sequenced in full. From this information the full transcript of the putative A. stephensi leucokinin receptor gene was assembled.

Analysis of the sequence identified from 5'-RACE and 3'-RACE experiments suggests that the sequence of the full mature transcript for this gene has been identified. It is a 2684 bp transcript containing the coding sequence of 1722 bp, a 962 bp 5'-UTR and a 181 bp 3'-UTR. The sequence (bases 1–4) contains a portion of a consensus sequence for the initiation of transcription. The lack of known genomic sequence for A. stephensi precluded the analysis of upstream sequence in order to identify further regulatory sequences. However, no downstream promoter element (DPE)-dependent promoter sequences could be identified in the transcript sequence, as has been found in the Drosophila genomic sequence for LKR (Radford et al., 2002Go). A single ATG start codon was identified, beginning at base 963 and terminating at a stop codon at position 2682. Upstream of this presumed start codon there are 17 in-frame stop codons. A polyadenylation signal is also present within the 3'-UTR of the sequence (AATAAA, 18 bp from the polyadenylation site). By alignment of the A. stephensi transcript with the A. gambiae genome it is likely that at least six introns are contained within this gene. There is less conservation of the nucleotide sequence within the 5'-UTR, and so the presence of additional introns within this region cannot be ruled out. Again, by inference from the A. gambiae genome, the transcript is thought to be contained within approximately a 7.5 kb genomic region.

The ORF of the A. stephensi leucokinin-like receptor transcript encodes a 574 amino acid protein, which has an estimated molecular mass of 65 kDa. Analysis using the TMHMM program (Krogh et al., 2001Go) suggests that this predicted protein exhibits the conserved 7 TM domain structure, consistent with it being a functional GPCR (Fig. 3). Other conserved GPCR motifs are also present, such as a triplet motif Asp-Tyr-His at residues 136–138, just downstream of the putative third TM domain. Also two conserved Cys residues, Cys112 and Cys201, located in the first and second extracellular loops respectively, are predicted to form a disulphide bond. There are also four potential N-glycosylation sites within the protein sequence, Asn14 and Asn18 in the N-terminal region, and Asn190 and Asn195 in the putative second extracellular loop. Interestingly, a difference exists between the C-terminal domain of the A. stephensi leucokinin receptor and that of the D. melanogaster LKR: it does not contain the epitope used to raise the anti-CG10626 (D. melanogaster LKR) antibody (Radford et al., 2002Go).

Alignment and comparison of the known leucokinin receptors
The protein sequences of the known leucokinin-like receptors, the Drosophila LKR (CG10626; Radford et al., 2002Go), the lymnokinin receptor (GenBank accession AAD11810 Cox et al., 1997Go), the B. microplus receptor (AAF72891 Holmes et al., 2003Go) and the putative A. stephensi receptor (Fig. 3) were aligned using the CLUSTAL X program (Thompson et al., 1994Go). The sequence alignment was annotated using BioEdit (Hall, 1999Go) (Fig. 4). The alignment demonstrates that there is considerable similarity between the four protein sequences, particularly within the TM domain-containing regions, with the N- and C-terminal regions being more divergent (Fig. 4). However, the sequence similarity is not as high within TM domains IV and V. The size and spacing of the TM domains is also consistent between the proteins, with only the second extracellular loop being variable in size. Interestingly, the first extracellular loop also appears highly conserved within these proteins, suggesting possible involvement in ligand binding. Several key residues are also conserved. A typical GPCR triplet motif is present immediately after the third TM domain as either an Asp–Arg–Tyr or Asp–Arg–His sequence. Cys residues, thought to form a disulphide bridge in GPCRs, are also present in the first and second extracellular loops of all but the lymnokinin receptor. Similarly putative N-glycosylation sites in the second extracellular loop are present in all proteins except the lymnokinin receptor. Although there is a great deal of sequence diversity within the C-terminal domains, several Ser and Thr residues appear conserved, representing possible sites of phosphorylation.



View larger version (92K):
[in this window]
[in a new window]
 
Fig. 4. Alignment of the known leucokinin receptor protein sequences. Amino acid residue numbers are indicated at the end of each line. The predicted TM domains are underlined. TM domains were predicted using the TMHMM 2.0 prediction program. Identical residues with a threshold limit of 75% are indicated by a shaded box. Sequence alignments were performed using CLUSTAL X, and annotated using BioEdit. Key conserved residues, such as the Asp-Arg-Tyr/His (DRY/H) triplet motif after TM III, Cys (C) residues in the second and third extracellular loops and potential N-glycosylation sites are in bold type and underlined.

 

TBLASTN analysis using the putative A. stephensi receptor was also used to identify a similar sequence in the A. gambiae genome sequence. In addition, Drosophila LKR was used to identify a similar sequence within the partially sequenced D. pseudoobscura genome. Without experimental confirmation the C-terminal domains could not be reliably predicted for the A. gambiae and D. pseudoobscura proteins. Therefore, the putative seven TM domain-containing regions of all the protein sequences were determined using the TMHMM program, and then aligned as before. From the resulting output dnd file a dendrogram was created using the TREEVIEW program (Page, 1996Go) (Fig. 5). The percentage identity and similarity of each were also calculated using BioEdit and were scored on the BLOSUM62 matrix (Table 1). This was carried out for the TM domain-containing regions and for the four known full-length proteins.



View larger version (9K):
[in this window]
[in a new window]
 
Fig. 5. Dendrogram of the known leucokinin receptors. A CLUSTAL X protein alignment was performed using the putative TM spanning regions of the known leucokinin receptors. From this a phylogram was produced using the TREEVIEW program. TM domains were predicted using the TMHMM 2.0 program. The scale bar gives an approximation of the number of substitutions per site. The Lymnaea stagnalis (pond snail) receptor is used as an outgroup.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Percentage identity and similarity of the protein sequences of the leucokinin receptors

 

The dendrogram of the TM domain regions of the leucokinin-like receptors reflects the phylogeny of the species concerned (Fig. 5). The D. melanogaster and D. pseudoobscura sequences are closely related, as are the A. stephensi and A. gambiae sequences. These four sequences are more closely related to each other than to the Boophilus sequence, with the molluscan Lymnaea sequence being the least similar. This ancestral relationship is verified by the identity and similarity values for each sequence comparison (Table 1).

The Anopheles leucokinins act on the Anopheles leucokinin receptor to raise intracellular calcium
Having identified both leucokinins and a leucokinin-like receptor within Anopheles, it was important to establish that they are a functional receptor–ligand pairing. S2 cells were transiently transfected with the apoaequorin ORF and the A. stephensi leucokinin-like receptor ORF constructs, and their expression induced, as previously described (Radford et al., 2002Go). The S2 cells were then subsequently assayed for agonist-dependent activation by monitoring [Ca2+]i levels. An agonist-dependent response in [Ca2+]i level was observed for each of the three Anopheles leucokinin peptides, with an order of potency of I>II>III for this particular concentration (Fig. 6). [Ca2+]i levels increased from basal levels of 50 nmol l–1 to a peak concentration of 365 nmol l–1, 325 nmol l–1 and 300 nmol l–1, respectively, upon addition of Anopheles leucokinin I, II or III, representing a 6- to 7.3-fold increase. The [Ca2+]i responses were biphasic in nature, with a primary Ca2+ spike followed by a secondary wave that peaked at approximately 175 nmol l–1, for all three peptides, 20–30 spost-stimulation.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 6. Real-time measurement of the [Ca2+]i response by A. stephensi leucokinin receptor. S2 cells were co-transfected with the A. stephensi leucokinin receptor ORF and apoaequorin ORF constructs, and expression induced. Peptide was injected at 15 s. Samples were stimulated with either Anopheles leucokinin I (A), II (B) or III (C) peptide at a concentration of 10–7 mol l–1. (D) Comparison of the responses to the three Anopheles leucokinin peptides applied at a concentration of 10–7 mol l–1. Data are expressed as [Ca2+]i (nmol l–1) against time (s); measurements were taken at 0.1 s intervals. The traces shown are average responses ± S.E.M. (N=8). Error bars are negligible for all panels.

 

Dose–response curves were then generated for the action of each Anopheles leucokinin on the A. stephensi leucokinin receptor. The receptor responds to all three Anopheles leucokinins in a dose-dependent manner (Fig. 7). Anopheles leucokinin I appears to be slightly more potent at stimulating the receptor, with an EC50 value of 2.0 nmol l–1, compared to values of 7.4 nmol l–1 and 8.4 nmol l–1 for the action of Anopheles leucokinin II and III, respectively. The EC50 values for the actions of these peptides on the A. stephensi receptor are considerably higher than the value for the action of Drosophila leucokinin on the Drosophila LKR, 56.5 pmol l–1 (Radford et al., 2002Go). Similar EC50 values were determined for the effect of the eight known leucokinins on Leucophaea maderae hindgut contraction (Cook et al., 1989Go; Cook et al., 1990Go). The existence of a higher affinity leucokinin receptor within Anopheles cannot be ruled out, although it is likely that this sequence would also have been identified from the genomic sequence. Nonetheless, it should be remembered that the action of Aedes leucokinins on Aedes tubules were consistent with the existence of more than one receptor (Veenstra et al., 1997Go); and that the broad concentration range of Drosophila leucokinin on Drosophila tubule was also taken as suggestive of multiple receptor classes (Terhzaz et al., 1999Go).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 7. Dose–response curves for the action of the Anopheles leucokinins on the A. stephensi leucokinin receptor. S2 cells were co-transfected with the A. stephensi leucokinin receptor ORF and apoaequorin ORF constructs, and expression induced. Peptide-stimulated [Ca2+]i increases were measured in S2 cell aequorin-based assays, at different concentrations of peptide as indicated. Values were expressed as maximal [Ca2+]–background [Ca2+] (nmol l–1; mean ± S.E.M., N=5–8). Where error bars are not visible they are too small to reproduce.

 

Cross-specific leucokinin signalling
The effects of the Anopheles leucokinins on S2 cells expressing the Drosophila LKR, CG10626 (Radford et al., 2002Go) were also established. As this was assessing cross-specific activity, relatively high concentrations of peptide were used (10–6 mol l–1 and 10–7 mol l–1). The application of both Anopheles leucokinin I (15 amino acids) and Anopheles leucokinin II (7 amino acids) produced a concentration-dependent increase in [Ca2+]i in the S2 cells (Fig. 8). Anopheles leucokinin III (10 amino acids) did not produce any observable [Ca2+]i response at either concentration tested. This is probably because Anopheles leucokinin III possesses a C-terminal pentapeptide, which diverges from the –Phe–His–Ser–Trp–Gly–amide present in Drosophila leucokinin. Both Anopheles leucokinin I and II contain a C-terminal pentapeptide identical to that of Drosophila leucokinin. The fact that only the Anopheles receptor responds to the divergent Anopheles leucokinin III peptide suggests that the Anopheles receptor has a broader specificity than the Drosophila receptor. The only extracellular regions of these proteins that are considerably different in sequence are the short N-terminal domain and the second extracellular loop. It is tempting to speculate that differences in these regions may define the specificity of the receptor-ligand interaction. Although responses to Anopheles leucokinin I and II were seen at both 10–6 mol l–1 and 10–7 mol l–1, the response to 10–6 mol l–1 was significantly larger. At this concentration, [Ca2+]i levels were seen to increase from basal levels of 50–60 nmol l–1 to a peak concentration of 250 nmol l–1 (Anopheles leucokinin I) and 208 nmol l–1 (Anopheles leucokinin II), approximately a four- and fivefold increase, respectively. It was not possible to determine whether these were maximal responses because the high concentrations required meant that dose–response curves could not be generated. For both peptides the [Ca2+]i response was biphasic in nature, with a primary Ca2+ spike and evidence of a sustained secondary wave that peaked at approximately 130 nmol l–1 20–30 s post-stimulation. Although the primary [Ca2+]i responses to 10–7 mol l–1 Anopheles leucokinin I and II were different, the secondary responses were similar.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 8. Real-time measurement of the [Ca2+]i response in S2 cells expressing D. melanogaster LKR, CG10626. S2 cells were co-transfected with the D. melanogaster LKR, CG10626 ORF (Radford et al., 2002Go) and apoaequorin ORF constructs, and expression induced. Data are expressed as [Ca2+]i (nmol l–1) against time (s); measurements were taken at 0.1 s intervals. The traces shown are average responses (N=5). Peptide was injected at 15 s. (A–C) Samples were stimulated with either Anopheles leucokinin I (A), II (B) or III (C) peptide at a concentration of 10–6 mol l–1 (blue) or 10–7 mol l–1 (red). (D) Comparison of the responses to the three Anopheles leucokinin peptides applied at a concentration of 10–6 mol l–1. Error bars are negligible for all panels.

 

The effects of Drosophila leucokinin (Terhzaz et al., 1999Go) on S2 cells expressing the A. stephensi leucokinin receptor were also ascertained. Drosophila leucokinin was found to stimulate the A. stephensi receptor in a similar manner to the Anopheles leucokinins, displaying an EC50 value of 1.1 nmol l–1, very similar to that of Anopheles leucokinin I (Fig. 9).



View larger version (9K):
[in this window]
[in a new window]
 
Fig. 9. Cross-specific activation of the A. stephensi leucokinin receptor with Drosophila leucokinin (drosokinin). (A) Real-time measurements of [Ca2+]i in S2 cells expressing the A. stephensi leucokinin receptor and apoaequorin in response to Drosophila leucokinin. Data are expressed as [Ca2+]i (nmol l–1) against time (s); measurements were taken at 0.1 s intervals. The trace shown is an average response (N=5). Peptide was injected at 15 s. (B) Dose–response curve. Values were expressed as maximal [Ca2+]–background [Ca2+] (nmol l–1; mean ± S.E.M., N=5). Where error bars are not visible they are too small to reproduce.

 

The Anopheles leucokinin receptor is expressed in stellate cells of the Malpighian tubule
Antisera against the Anopheles leucokinin receptor identified a band of the predicted size of 65 kDa on western blots, together with a heavier band of approximately 72 kDa (Fig. 10). A similar doublet was observed in Drosophila, and was shown to be due to N-glycosylation of the receptor (Radford et al., 2002Go). Consistent with this, four potential N-glycosylation sites are present within the receptor sequence.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 10. Western blot analysis of the Anopheles leucokinin receptor. Western blot of adult Malpighian tubule and head proteins using Anopheles leucokinin receptor purified IgG. The antibody recognises both a protein of the expected size (65 kDa) and a heavier band, of approximately 72 kDa. The control lane is blotted with pre-immune serum.

 

Immunocytochemistry of adult Anopheles tubule revealed staining specific to the stellate cells (Fig. 11), as has previously been reported for the Drosophila leucokinin receptor.



View larger version (104K):
[in this window]
[in a new window]
 
Fig. 11. Anopheles leucokinin receptor is expressed in stellate cells of the Malpighian tubule. Tubules were stained with anti-Anopheles leucokinin peptide purified IgG, raised as described in the text. Texas Red secondary antibodies were used to visualize the primary antiserum and DAPI was used to stain nuclei (blue). (A,B), Fluorescence microscopy of immunostained whole-mount tubules revealed staining in the secondary stellate cell type (arrows), concentrated in the basolateral membrane. (C) Tubules were processed as for A and B, but with pre-immune serum, confirming the specificity of the antibody. Only low-level non-specific staining of apical microvilli was observed. All images were captured on a Zeiss 510 Meta confocal microscope using a 63 x objective and the approximate scale can be determined from the tubule diameter, which can be taken to be 35 µm.

 


    Discussion
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
This paper identifies and characterises a cognate pairing of the Anopheles leucokinins and their receptor in a genus containing major human and animal disease vectors. By comparison with the abundant knowledge of the leucokinin family in insects, it is now possible to distinguish significant differences in the numbers of leucokinins and their potencies across the Order Diptera. This may help to explain a radical difference between the diuretic actions of leucokinins in Diptera. In the Drosophila tubule, the Drosophila leucokinin receptor is found only in the type II (stellate) cells, and (using a transgenic aequorin calcium reporter) the peptide is known to raise calcium only in these cells (Radford et al., 2002Go). By contrast, in the Aedes tubule, the leucokinins are thought to act on principal cells to regulate paracellular permeability (Beyenbach, 2003aGo; Yu and Beyenbach, 2004Go). Given the relatively divergent taxonomy of these two insects, and the differences in prepropeptide structure and in receptor C-terminal sequence, the functional differences might not be so surprising. However, in Anopheles, which is phylogenetically much closer to Aedes, all aspects of leucokinin signalling, including the receptor localisation to stellate cells in the tubule, appear much closer to Drosophila than to Aedes. It will thus be of great interest to locate the homologous receptor within the Aedes tubule.


    Acknowledgments
 
This work was supported by the Biotechnology and Biological Sciences Research Council, UK and by a Wellcome Trust PhD scholarship to J.C.R.


    References
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

Bairoch, A., Bucher, P. and Hofmann, K. (1997). The PROSITE database, its status in 1997. Nucleic Acids Res. 25,217 -221.[Abstract/Free Full Text]

Beyenbach, K. W. (1998). Reversible paracellular permeability changes in insect Malpighian tubules induced by the neuropeptide leucokinin. FASEB J. 12, 5869.

Beyenbach, K. W. (2003a). Regulation of tight junction permeability with switch-like speed. Curr. Opin. Nephrol. Hypertens. 12,543 -550.[Medline]

Beyenbach, K. W. (2003b). Transport mechanisms of diuresis in Malpighian tubules of insects. J. Exp. Biol. 206,3845 -3856.[Abstract/Free Full Text]

Coast, G. M., Zabrocki, J. and Nachman, R. J. (2002). Diuretic and myotropic activities of N-terminal truncated analogs of Musca domestica kinin neuropeptide. Peptides 23,701 -708.[CrossRef][Medline]

Cook, B. J., Holman, G. M., Wagner, R. M. and Nachman, R. J. (1989). Pharmacological actions of a new class of neuropeptides, the leucokinins I-IV, on the visceral muscles of Leucophaea maderae.Comp. Biochem. Physiol. 93C,257 -262.[CrossRef]

Cook, B. J., Holman, G. M., Wagner, R. M. and Nachman, R. J. (1990). Comparative pharmacological actions of leucokinins V-VIII on the visceral muscles of Leucophaea maderae. Comp. Biochem. Physiol. 95C,19 -24.[CrossRef]

Cox, K. J., Tensen, C. P., Van der Schors, R. C., Li, K. W., van Heerikhuizen, H., Vreugdenhil, E., Geraerts, W. P. and Burke, J. F. (1997). Cloning, characterization, and expression of a G-protein-coupled receptor from Lymnaea stagnalis and identification of a leucokinin-like peptide, PSFHSWSamide, as its endogenous ligand. J. Neurosci. 17,1197 -1205.[Abstract/Free Full Text]

Dow, J. A. T. and Davies, S. A. (2001). The Drosophila melanogaster Malpighian tubule. Adv. Insect Physiol. 28,1 -83.

Dow, J. A. T. and Davies, S. A. (2003). Integrative physiology and functional genomics of epithelial function in a genetic model organism. Physiol. Rev. 83,687 -729.[Abstract/Free Full Text]

Gade, G. (2004). Regulation of intermediary metabolism and water balance of insects by neuropeptides. Annu. Rev. Entomol. 49,93 -113.[CrossRef][Medline]

Gubler, D. J. (1998). Resurgent vector-borne diseases as a global health problem. Emerg. Infect Dis. 4,442 -450.[Medline]

Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41, 95-98.

Hill, C. A., Fox, A. N., Pitts, R. J., Kent, L. B., Tan, P. L., Chrystal, M. A., Cravchik, A., Collins, F. H., Robertson, H. M. and Zwiebel, L. J. (2002). G protein-coupled receptors in Anopheles gambiae. Science 298,176 -178.[Abstract/Free Full Text]

Holman, G. M., Cook, B. J. and Wagner, R. M. (1984). Isolation and partial characterization of five myotropic peptides present in head extracts of the cockroach, Leucophaea maderae.Comp. Biochem. Physiol. 77C,1 -5.

Holman, G. M., Nachman, R. J. and Coast, G. M. (1999). Isolation, characterization and biological activity of a diuretic myokinin neuropeptide from the housefly, Musca domestica.Peptides 20,1 -10.[CrossRef][Medline]

Holmes, S. P., Barhoumi, R., Nachman, R. J. and Pietrantonio, P. V. (2003). Functional analysis of a G protein-coupled receptor from the southern cattle tick Boophilus microplus (Acari: Ixodidae) identifies it as the first arthropod myokinin receptor. Insect Mol. Biol. 12,27 -38.[CrossRef][Medline]

Holt, R. A., Subramanian, G. M., Halpern, A., Sutton, G. G., Charlab, R., Nusskern, D. R., Wincker, P., Clark, A. G., Ribeiro, J. M., Wides, R. et al. (2002). The genome sequence of the malaria mosquito Anopheles gambiae. Science 298,129 -149.[Abstract/Free Full Text]

Howarth, C. J., Prince, R. I., Dyker, H., Losel, P. M., Seinsche, A. and Osborne, R. H. (2002). Structure-activity relationship of contractile effects induced by helicokinins in the isolated gut of the lepidopteran caterpillar Spodoptera frugiperda. J. Insect Physiol. 48,75 -82.[CrossRef][Medline]

Krogh, A., Larsson, B., von Heijne, G. and Sonnhammer, E. L. (2001). Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J. Mol. Biol. 305,567 -580.[CrossRef][Medline]

Meola, S. M., Clottens, F. L., Holman, G. M., Nachman, R. J., Nichols, R., Schoofs, L., Wright, M. S., Olson, J. K., Hayes, T. K. and Pendleton, M. W. (1998). Isolation and immunocytochemical characterization of three tachykinin-related peptides from the mosquito, Culex salinarius. Neurochem. Res. 23,189 -202.[CrossRef][Medline]

Nachman, R. J., Strey, A., Isaac, E., Pryor, N., Lopez, J. D., Deng, J. G. and Coast, G. M. (2002). Enhanced in vivo activity of peptidase-resistant analogs of the insect kinin neuropeptide family. Peptides 23,735 -745.[CrossRef][Medline]

Page, R. D. M. (1996). TREEVIEW: An application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12,357 -358.[Free Full Text]

Radford, J. C., Davies, S. A. and Dow, J. A. T. (2002). Systematic GPCR analysis in Drosophila melanogaster identifies a leucokinin receptor with novel roles. J. Biol. Chem. 277,38810 -38817.[Abstract/Free Full Text]

Riehle, M. A., Garcynski, S. F., Crim, J. W., Hill, C. A. and Brown, M. R. (2002). Neropeptides and peptide hormones in Anopheles gambiae. Science 298,172 -175.[Abstract/Free Full Text]

Rosay, P., Davies, S. A., Yu, Y., Sozen, A., Kaiser, K. and Dow, J. A. T. (1997). Cell-type specific calcium signalling in a Drosophila epithelium. J. Cell Sci. 110,1683 -1692.[Abstract]

Seinsche, A., Dyker, H., Losel, P., Backhaus, D. and Scherkenbeck, J. (2000). Effect of helicokinins and ACE inhibitors on water balance and development of Heliothis virescens larvae. J. Insect Physiol. 46,1423 -1431.[CrossRef][Medline]

Teal, P. E., Meredith, J. A. and Nachman, R. J. (1999). Development of amphiphylic mimics of insect neuropeptides for pest control. Ann. NY Acad. Sci. 897,348 -360.[CrossRef][Medline]

Terhzaz, S., O'Connell, F. C., Pollock, V. P., Kean, L., Davies, S. A., Veenstra, J. A. and Dow, J. A. T. (1999). Isolation and characterization of a leucokinin-like peptide of Drosophila melanogaster. J. Exp. Biol. 202,3667 -3676.[Abstract]

Thompson, J. D., Higgins, D. G. and Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22,4673 -4680.[Abstract/Free Full Text]

Torfs, P., Nieto, J., Veelaert, D., Boon, D., van de Water, G., Waelkens, E., Derua, R., Calderon, J., de Loof, A. and Schoofs, L. (1999). The kinin peptide family in invertebrates. Ann. NY Acad. Sci. 897,361 -373.[CrossRef][Medline]

Veenstra, J. A., Pattillo, J. M. and Petzel, D. H. (1997). A single cDNA encodes all three Aedes leucokinins, which stimulate both fluid secretion by the Malpighian tubules and hindgut contractions. J. Biol. Chem. 272,10402 -10407.[Abstract/Free Full Text]

Yu, M. J. and Beyenbach, K. W. (2004). Effects of leucokinin-VIII on Aedes Malpighian tubule segments lacking stellate cells. J. Exp. Biol. 207,519 -526.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J. Exp. Biol.Home page
G. M. Coast
Neuroendocrine control of ionic homeostasis in blood-sucking insects
J. Exp. Biol., February 1, 2009; 212(3): 378 - 386.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
S. A. Davies and S. Terhzaz
Organellar calcium signalling mechanisms in Drosophila epithelial function
J. Exp. Biol., February 1, 2009; 212(3): 387 - 400.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
J. A. T. Dow
Integrative physiology, functional genomics and the phenotype gap: a guide for comparative physiologists
J. Exp. Biol., May 1, 2007; 210(9): 1632 - 1640.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
M. L. Patrick, K. Aimanova, H. R. Sanders, and S. S. Gill
P-type Na+/K+-ATPase and V-type H+-ATPase expression patterns in the osmoregulatory organs of larval and adult mosquito Aedes aegypti
J. Exp. Biol., December 1, 2006; 209(23): 4638 - 4651.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
N. Kaufmann, J. C. Mathai, W. G. Hill, J. A. T. Dow, M. L. Zeidel, and J. L. Brodsky
Developmental expression and biophysical characterization of a Drosophila melanogaster aquaporin
Am J Physiol Cell Physiol, August 1, 2005; 289(2): C397 - C407.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Radford, J. C.
Right arrow Articles by Dow, J. A. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Radford, J. C.
Right arrow Articles by Dow, J. A. T.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CALCIUM COMPOUNDS
*CALCIUM, ELEMENTAL
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?