|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online December 10, 2003
Journal of Experimental Biology 207, 347-356 (2004)
Published by The Company of Biologists 2004
doi: 10.1242/jeb.00773
A facilitative urea transporter is localized in the renal collecting tubule of the dogfish Triakis scyllia
1 Laboratory of Physiology, Ocean Research Institute, University of Tokyo,
1-15-1 Minamidai, Nakano, Tokyo 164-8639, Japan
2 Center for International Cooperation, Ocean Research Institute, University
of Tokyo, 1-15-1 Minamidai, Nakano, Tokyo 164-8639, Japan
* Author for correspondence (e-mail: hyodo{at}ori.u-tokyo.ac.jp)
Accepted 20 October 2003
| Summary |
|---|
|
|
|---|
Key words: urea transporter, urea reabsorption, kidney, bundle zone, collecting tubule, Na+/K+-ATPase, facilitative diffusion, elasmobranch, dogfish, Triakis scyllia
| Introduction |
|---|
|
|
|---|
A net influx of water across the body surface caused by the internal
hypertonicity of marine elasmobranchs leads to high urine flow rates from the
kidney compared with those of marine teleosts. Although urea is freely
filtered by the glomerulus, more than 90% of filtered urea is reabsorbed from
primary urine by the renal tubules and returned to the blood system, thereby
reducing urinary loss of urea (Smith,
1936
; Kempton,
1953
; Boylan,
1967
). Renal excretion thus accounts for only 4-20% of total urea
loss (Evans and Kormanik, 1985
;
Goldstein and Forster, 1971
;
Payan et al., 1973
;
Wood et al., 1995
). Following
transfer from full-strength seawater (SW) to diluted SW, the plasma urea level
is reduced; this reduction is largely attributed to an increase in urea loss
at the kidney (see Hazon et al.,
1997
). These observations imply the existence of a specific
mechanism enabling `uphill' transport of urea by the kidney. Indeed,
morphological studies have revealed that the renal tubules of marine
elasmobranchs are highly elaborate and show unique features compared with
those of other vertebrates (Lacy and Reale,
1985
,
1999
;
Hentschel, 1991
;
Hentschel et al., 1998
). The
kidney consists of multiple lobules that are separated into two zones; the
bundle zone and the sinus zone (Lacy and
Real, 1985
), or the lateral bundle zone and the mesial zone
(Hentschel et al., 1998
). Each
nephron makes four turns and traverses repeatedly between the two zones. In
the bundle zone, the resulting five tubular segments are arranged to form
countercurrent loops. An impermeable peritubular sheath wraps the five tubular
segments together and separates tubular bundles from each other.
The bundle of five tubular segments has been considered to play an
important role in efficient renal reabsorption of urea in marine elasmobranchs
(see Lacy and Reale, 1999
).
This hypothesis is supported by the fact that stenohaline freshwater
elasmobranchs do not use urea as an osmolyte and lack such countercurrent
segments. Nevertheless, a precise mechanism for urea reabsorption has not been
clarified yet. This is largely due to difficulty in applying classical
physiological methods to the elasmobranch kidney because of its complex
architecture. Meanwhile, molecular anatomy can determine the localization of
transport proteins for urea, ions and water in situ, and thus is a
powerful tool to overcome the difficulty in studying the elasmobranch kidney.
Spatial patterns in the distribution of various pumps
(Hentschel et al., 1993
;
Swenson et al., 1994
),
channels and transporters (Biemesderfer et
al., 1996
) in the nephron segments can provide valuable
information on the movement of the above molecules across the kidney tubules,
and thus on the reabsorption mechanism of urea.
In the mammalian kidney, facilitative urea transporters (UTs) play a
crucial role in the urinary concentration mechanism (see
Sands, 2003
). Type-A UT
proteins (UT-A) are responsible for the high urea permeability of the inner
medullary collecting duct and of the thin descending limb of Henle's loop,
which participate, respectively, in urea reabsorption and recycling in the
kidney. With respect to marine elasmobranchs, Smith and Wright
(1999
) cloned and
characterised a cDNA encoding a UT, which may belong to the mammalian UT-A2
family, from the spiny dogfish (Squalus acanthias) kidney. These
advances have enabled a more direct approach to the study of the urea
reabsorption mechanism by identifying the localization of a UT in the
elasmobranch kidney tubules. In the present study, we cloned a cDNA encoding a
UT, which is homologous to the Squalus UT, from the kidney of the
marine dogfish Triakis scyllia and determined the localization of the
UT in the kidney by immunohistochemistry using specific antibodies raised
against the cloned UT. Our study demonstrated that the UT shows a limited
localization in the collecting tubule designated by Hentschel et al.
(1998
), or in the distal
segment designated by Lacy and Real
(1985
). These data suggest
that the collecting tubule is responsible for the urea reabsorption in marine
elasmobranch kidney.
| Materials and methods |
|---|
|
|
|---|
12°C)
under natural photoperiod for 3-7 days before use. For tissue sampling, fish
were anaesthetized in 0.02% (w/v) 3-aminobenzoic acid ethyl ester (Sigma, St
Louis, MO, USA).
cDNA cloning of Triakis UT
Tissues were dissected out and frozen quickly in liquid nitrogen. Total RNA
was extracted from the kidney with Isogen (Nippon Gene, Toyama, Japan).
Poly-A+ RNA was purified with Oligotex-dT30 (Japan Synthetic
Rubber, Tokyo, Japan). Adaptor-ligated double-stranded kidney cDNA was
synthesized using the SMART cDNA Library Construction Kit (Clontech, Palo
Alto, CA, USA). A cDNA encoding a portion of UT was amplified from the kidney
cDNA with high-fidelity Ex-Taq DNA polymerase (TaKaRa, Kyoto, Japan). The
sense and antisense primers were designed based on the amino acid sequences of
Squalus UT (Smith and Wright,
1999
) and mammalian UT-A2 as follows: sense, GTNCARAAYCCNTGGTGGRC;
antisense, CCANGGRTTRTCRCANCCRTA. The amplified products were electrophoresed,
excised and ligated into pT7Blue T-Vector (Novagen, Madison, WI, USA). The
nucleotide sequence was determined by an automated DNA sequencer (PRISM 310;
Applied Biosystems, Foster City, CA, USA). Total length of the
Triakis UT cDNA was obtained by 5'- and 3'-RACE methods
with the adaptor primers (Clontech) and the UT gene-specific primers according
to the supplier's instructions. Finally, full-length UT cDNA was amplified
with newly designed specific primers in the 5'- and
3'-untranslated regions to confirm the sequence.
Detection of UT mRNA expression
The distribution of UT mRNA in Triakis tissue was examined by
RT-PCR and northern blotting. Poly-A+ RNA was isolated from brain,
gill, intestine, rectal gland, muscle and liver of three fishes as described
above. For RT-PCR, 1 µg of poly-A+ RNA was used as template for
synthesis of first strand cDNA using Superscript First-Strand Synthesis System
for RT-PCR (Invitrogen, Carlsbad, CA, USA). The specific PCR primer pair
comprised a sense primer (682-703), CATGGTCTGATCTCAGTGTTCC, and an antisense
primer (1349-1330), CATCTATGGAAAGAGCAGGG. One fiftieth of RT product was
processed for the PCR reaction. After an initial denaturation at 94°C for
1 min, 30 cycles of PCR were performed, each consisting of 50 s denaturation
at 94°C, 30 s annealing at 60°C, and 1 min extension at 72°C.
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA was used as an internal
standard. A partial cDNA sequence for Triakis GAPDH (deposited to DNA
Data Bank of Japan, accession no. AB094994) was obtained by RT-PCR using
degenerate primers designed based on other fish GAPDH sequences. RT-PCR for
detection of GAPDH mRNA was carried out by the same protocol as for UT, with a
sense primer, TCACATTTACAGGGTGGTGC, and an antisense primer,
AAGTCAGTTGACACCACCTG. PCR products were electrophoresed in 1.2% agarose gels,
stained with ethidium bromide and detected by an FLA-2000 imaging analyzer
(Fuji Film, Tokyo, Japan).
For northern blotting, poly-A+ RNAs (10 µg or 20 µg) from the kidney, brain, gill and liver were separated in a 1% agarose gel in the presence of 2.2 mol l-1 formaldehyde and transferred to a nylon filter (Nytran-plus; Schleicher and Schuell, Dassel, Germany). The filter was hybridized using a 32P-labelled UT cDNA probe at 55°C. After washing in 0.1xSSC/0.1% SDS at 55°C, signal was detected by the FLA-2000 imaging analyzer.
Tissue preparation for histochemistry
The kidney was dissected out, trimmed transversely at up to 1 cm thickness
and immersed in a fixative solution. The osmolality of fixative containing 4%
paraformaldehyde in 0.05 mol l-1 phosphate buffer (pH 7.4) was
adjusted to plasma osmolality (1000 mOsm) with NaCl. The tissue was fixed at
4°C for 2 days, washed twice in 70% ethanol at 4°C for 24 h and then
embedded in paraplast. Serial transverse sections were cut at 5 µm, mounted
onto gelatin-coated slides and processed for immunohistochemistry.
Polyclonal antibody production
The polypeptides ESEATQNPFMEKKKT and TYPEKNIRIYQEMKRIEQNK, corresponding to
the NH2 (UTN)- and COOH (UTC)-terminal cytoplasmic domains,
respectively, of Triakis UT were synthesized and coupled via
cysteine to keyhole limpet haemocyanin. These conjugated peptides were
emulsified with complete Freund's adjuvant and injected into New Zealand white
rabbits for immunization (Sawady Technology, Tokyo, Japan). The antisera were
subjected to affinity purification with the respective synthetic peptides and
were used for immunohistochemistry.
Immunohistochemistry
The kidney sections were immunohistochemically stained with the
avidin-biotin-peroxidase complex kit (Vector, Burlingame, CA, USA). After
rehydration, tissue sections were incubated sequentially with: (1) 2% normal
goat serum in phosphate-buffered saline (pH 7.4; PBS-NGS) for 2 h at room
temperature, (2) the affinity-purified anti-UTC or anti-UTN diluted 1:10 000
with PBS-NGS for 48 h at 4°C, (3) biotinylated, goat anti-rabbit IgG for
30 min at room temperature, (4) avidin-biotin-peroxidase complex for 45 min at
room temperature and (5) 0.05% diaminobenzidine tetrahydrochloride and 0.01%
hydrogen peroxide in 50 mmol l-1 Tris buffer (pH 7.2) for 10 min at
20°C. Adjacent sections were stained with an
anti-Na+/K+-ATPase
-subunit antiserum. The
anti-Na+/K+-ATPase antiserum (a gift from Prof. K.
Yamauchi, Hokkaido University, Japan) was raised against a synthetic peptide,
VTGVEEGRLIFDNLKKC, which represents a completely conserved sequence among all
vertebrate groups examined (Ura et al.,
1996
). To confirm the identity of the epitope, a partial cDNA
sequence for Triakis Na+/K+-ATPase
-subunit was obtained by RT-PCR (deposited to DDBJ AB094995).
Specificity of immunoreactive signals for UT was confirmed by (1) comparison of the stained tissues between anti-UTC and anti-UTN antibodies and (2) preabsorption of antibodies with the synthetic antigens (5 µg ml-1) for 24 h at 4°C prior to incubation.
Light micrographs were obtained from a series of stained sections using a
digital camera (DXM1200; Nikon, Tokyo, Japan). The nomenclature of the nephron
segments was largely based on Hentschel et al.
(1998
). To determine tubular
segments in which the UT is expressed, serial sections (500 µm in
thickness) stained with anti-UTC antibody were investigated. As shown in the
Results, immunoreactive signals appeared in the transitional area between the
sinus zone and the bundle zone, where immunoreactive tubules were directly
connected to the collecting duct. Starting from the origin of immunoreactive
signals (either the transitional region or the collecting duct), the
convoluted courses of stained tubules were traced on the serial sections. Ten
separate nephrons were tested.
Thin sections (2 µm) were cut and used for immunohistochemistry to determine the topical location of the UT on the plasma membrane (apical or basolateral). In this experiment, goat anti-rabbit IgG labelled with Alexa Fluor 488 (Molecular Probes, Eugene, OR, USA) was used as a secondary antibody. Sections were observed with a confocal laser scanning microscope (LSM 310; Zeiss, Jena, Germany).
Western blotting
The kidney was homogenized on ice in a buffer consisting of 25 mmol
l-1 Tris HCl (pH 7.4), 250 mmol l-1 sucrose and a pellet
(for 50 ml) of Complete Protein Inhibitor (Boehringer Mannheim, Ingelheim,
Germany). The homogenate was initially centrifuged at 4500 g
for 15 min, and the supernatant was subjected to a second centrifugation step
at 200 000 g for 1 h. The pellet was resuspended in the same
buffer. All the above procedures were performed at 4°C. The protein
content of the sample was quantified with a BCA Protein Assay Kit (Pierce,
Rockford, IL, USA). The samples (100 µg) were solubilized in a
sample-loading buffer [250 mmol l-1 Tris-HCl (pH 6.8), 2% sodium
dodecyl sulphate (SDS), 10% ß-mercaptoethanol, 30% glycerol and 0.01%
Bromophenol Blue] and heated at 70°C for 15 min. They were separated by
SDS-polyacrylamide gel electrophoresis (SDS-PAGE) using 7.5% polyacrylamide
gels. After electrophoresis, the protein was transferred from the gel to a
polyvinylidene difluoride membrane (Atto, Tokyo, Japan).
The membranes were pre-incubated in 50 mmol l-1 Tris-buffered saline (TBS; pH 7.6) containing 0.05% Triton X-100 and 2% skimmed milk at 4°C overnight and incubated with the antibodies diluted at 1:500 with PBS-NGS for 1 h at room temperature. After rinsing in washing buffer (TBS, 0.05% Triton X-100), the membranes were incubated with gold-conjugated anti-rabbit IgG (British Biocell Inc., Cardiff, UK) for 1 h at room temperature and stained with silver enhancing kit (British Biocell Inc.).
| Results |
|---|
|
|
|---|
|
The RT-PCR analysis revealed that the Triakis UT is abundantly
expressed in the kidney (Fig.
2A). In one fish, low level of signal was observed in the liver.
In all fishes, no signal was observed in the brain, gill, intestine or rectal
gland. Signal was not detected from the kidney without reverse transcription,
demonstrating the absence of genomic DNA contamination. Northern blot analysis
of kidney poly-A+ RNA also showed an intense band at
2.3 kb
that corresponds well with the cloned cDNA
(Fig. 2B). An additional band
was observed at
4 kb, but signal intensity was very low compared with the
major band. In accord with the RT-PCR experiment, northern blotting using 20
µg of poly-A+ RNA revealed a low level of expression in the
liver. A faint band was detectable also in the brain. However, when 10 µg
of poly-A+ RNA was used for northern analysis, only kidney
poly-A+ RNA gave a positive signal (data not shown).
|
Localization of UT in the Triakis kidney
As described in other marine elasmobranchs, the Triakis kidney
consists of multiple, irregular lobules (see
Hentschel et al., 1998
;
Lacy and Reale, 1985
). Each
lobule is further separated into two zones, a sinus (or mesial) zone and a
bundle zone (Figs 3A,
4A). Large renal corpuscles are
situated between the two zones (Fig.
4A). The single nephron makes four loops within the lobule.
Beginning at a renal corpuscle, the first hairpin and third convoluted loops
are situated in the bundle zone, while the nephron forms the second and fourth
convoluted loops in the sinus zone (see
Fig. 5D). The final tubular
segment is connected to the collecting duct. In the bundle zone, the resulting
five tubular segments are enclosed in a sac-like peritubular sheath, in which
the nephron segments are arranged in parallel to form a countercurrent
system.
|
|
|
Immunohistochemistry with the affinity-purified antibody raised against the C-terminal peptide of UT (anti-UTC) revealed positive staining in tubules in the bundle zone but not in tubules in the sinus zone or in renal corpuscles (Fig. 3A,B). In the bundle zone, immunoreactive signal was not detected in every tubule, but only a small proportion of tubules were stained. Observations on the five tubular segments in the straight portion of bundle zone showed that only one segment was stained with the anti-UTC antibody (Fig. 3C).
The same staining pattern was obtained when an affinity-purified antibody
against the N-terminal peptide of UT (anti-UTN) was used as primary antibody
(Fig. 6A,B). Treatment with
pre-immune sera from the same rabbit revealed no specific signals in the
kidney. Preabsorption of the anti-UTC antibody with the synthetic UTC peptide
resulted in disappearance of the immunoreactive signals
(Fig. 6D), while treatment with
the synthetic UTN peptide did not affect immunoreactivity
(Fig. 6C). Furthermore, the
anti-UTC antibody recognized a single band of molecular mass
55 kDa by
western blot analysis (Fig. 7).
This band disappeared when the membrane was incubated with the UTC antibody
preabsorbed with the UTC peptide but was not affected by preincubation of the
UTC antibody with the UTN peptide (Fig.
7). These results confirmed the specificity of the anti-UTC and
anti-UTN antibodies to the Triakis UT. Since signal intensity with
anti-UTC antibody was much stronger than that with anti-UTN antibody,
subsequent analyses were done using only the anti-UTC antibody.
|
|
To determine which tubular segments in the bundle zone express the UT, serial sections were stained with anti-UTC antibody. Immunoreactive signal appeared in the transitional area between the sinus zone and the bundle zone (Fig. 5A). Immunoreactive tubules were in close association with renal corpuscles and then extended into the bundle zone. The tubules ran straight along with the other tubules to the periphery of the bundle zone (arrowhead in Fig. 5A) and then convoluted (arrows in Fig. 5A). These tubules were finally connected to the collecting duct that ran towards the adjacent bundle (Fig. 5B,C). We traced the convoluted course of the immunoreactive tubules for 10 separate nephrons, as described in the Materials and methods, and confirmed that all immunoreactive tubules in the bundle zone correspond to the collecting tubule, the final nephron segment (Fig. 5D). Other tubular segments, namely the first and third loops in the bundle zone, were negative in UT-staining without exception. Although the signal intensity was not analysed quantitatively, the strongest signal was observed in the straight portion of the collecting tubules. The collecting ducts were also stained; however, the signal intensity was very weak compared with that in the collecting tubules (Fig. 5B,C).
The confocal laser scanning microscopy further revealed that both the apical and basolateral membranes of epithelial cells were positively stained in the collecting tubule (Fig. 3D,E).
Localization of Na+/K+-ATPase
In contrast to the UT staining pattern, the
Na+/K+-ATPase antibody stained numerous tubules in both
bundle and sinus zones, indicating that the
Na+/K+-ATPase is widely distributed along the nephron
(Fig. 4). In the sinus zone, at
least three nephron segments were easily identified. A large tubule,
consisting of extremely tall, columnar-shaped cells (arrowheads in
Fig. 4A,D), probably
corresponds to the proximal II segment of the 2nd convoluted loop
(Hentschel et al., 1998
). A
thin layer of squamous cells formed the epithelium of the intermediate segment
(arrows in Fig. 4A,D), while
the third segment of intermediate size is composed of cuboidal cells. The
third-type tubule may correspond to the fourth convoluted loop of the nephron,
i.e. the late distal segment (see Fig.
5D). The basolateral membrane of most tubular cells in the sinus
zone showed Na+/K+-ATPase-immunoreactivity to varying
degrees. The strongest signal was observed in the basolateral membrane of the
second-type, intermediate segment (arrows in
Fig. 4A,D).
In the bundle zone, intense immunoreactive signal to
Na+/K+-ATPase was detected in the largest segment, which
consisted of large cuboidal epithelial cells
(Fig. 4A-C).
Na+/K+-ATPase was stained along the basolateral
membrane. The distal end of the bundle zone was occupied by this intensely
stained segment, suggesting that the
Na+/K+-ATPase-expressing tubule is the early distal
segment of the third loop (Fig.
4C; arrowheads in Fig.
4B; convoluted intermediate segment IV of
Lacy and Reale, 1985
). This
early distal segment extends into the straight portion of the bundle as the
ascending limb of the third loop. Indeed, among the five tubular segments of
the straight portion of the bundle, only one segment consisting of large
cuboidal cells was intensely stained with Na+/K+-ATPase
(arrow in Fig. 4B), supporting
the notion that convoluted and ascending segments of the third loop abundantly
express Na+/K+-ATPase. The ascending segment stained
with Na+/K+-ATPase was frequently in contact with the
UT-expressing collecting tubule (Figs
3C,
4B). In the straight portion of
the bundle, two other segments, namely the ascending limb of the first loop
and the descending limb of the third loop, also express
Na+/K+-ATPase, although the intensity was weaker
compared with that of the early distal segment
(Fig. 4B). The collecting
tubule expressing the UT (Fig.
3C) was, without exception, not stained with
Na+/K+-ATPase antibody (CT in
Fig. 4B).
| Discussion |
|---|
|
|
|---|
Boylan and colleagues proposed a model for passive urea reabsorption in the
elasmobranch kidney based on anatomical relationships among nephron segments
in S. acanthias and the little skate Raja erinacea
(Deetjen et al., 1970
;
Boylan, 1972
). They traced the
course of single nephrons following injection of a coloured dye into the
glomerulus. The collecting tubule is invested by the first loop in S.
acanthias and by the first and third loops in the kidney of R.
erinacea. They proposed that the first and third loops create a low urea
interstitial environment by reabsorption of sodium and water. Urea may diffuse
from the collecting tubule into the low urea interstitial fluid around it,
lowering the urea concentration of the final urine.
Hentschel et al. (1998
)
examined the vascular system in the bundle zone and its spatial relationship
to the surrounding tubular segments in R. erinacea and the dogfish
Scyliorhinus caniculus. They found a single lymph capillary-like
central vessel. This capillary system is quite different from the mammalian
vasa recta, which functions as a countercurrent exchanging system of blood
capillaries in the renal medulla. The central vessel originates as a few
blind-ending branches at the distal end of the bundle and runs in close
contact with the collecting tubule, the third loop and, to a lesser degree,
the first loop along the entire bundle. In the direction of the sinus zone,
the central vessel merges with the large venous sinusoid capillaries of the
renal portal system. Based on these observations, they proposed a hypothesis
that urea-free fluid is generated in the central vessel by absorbing water and
NaCl from the tubules, particularly from a diluting segment. Unidirectional
flow of the fluid most likely occurs in the central vessel from the tip of the
bundle to the renal portal system because of high resistance at the
peritubular sheath and low resistance in the direction of the sinus zone.
Countercurrent exchange of urea may then occur from the collecting tubule to
the central vessel. Our finding that the Triakis UT is specifically
localized in the collecting tubule coincides well with these hypothetical
models for passive urea reabsorption. Urea may be transported from the
filtered urine in the collecting tubule into low-urea interstitial fluid
(Boylan, 1972
) and/or directly
into low-urea fluid in the vascular system
(Hentschel et al., 1998
) by
way of the UT.
Renal micropuncture and microdissection techniques have also been applied
to evaluate single nephron functions
(Deetjen et al., 1972
;
Schmidt-Nielsen et al., 1966
,
1972
;
Stolte et al., 1977
). In
S. acanthias, osmotic pressure and urea concentration of fluids
obtained from a variety of puncture sites along the proximal tubule were not
significantly different from those in plasma, while samples obtained from the
ureter had lower osmolality and urea concentration than the blood
(Schmidt-Nielsen et al.,
1972
). Deetjen et al.
(1972
) did not find any
reabsorption of urea in the collecting duct system of R. erinacea,
indicating that the tubular fluid flowing into the collecting duct has already
reached its final low concentration with respect to urea. These physiological
data are consistent with our hypothesis that the collecting tubule is
responsible for urea reabsorption in the Triakis kidney. In our
study, immunoreactive UT was also found in the collecting duct, although the
signal intensity was quite low compared with the collecting tubule. Thus, the
collecting duct may contribute to urea reabsorption to a lesser extent in
T. scyllia.
In contrast to the preferential localization of UT in the collecting
tubule, the transport enzyme Na+/K+-ATPase is widely
distributed in tubular epithelial cells in both bundle and sinus zones of the
Triakis kidney. Among the immunoreactive segments, intense signal was
detected in the convoluted and ascending straight portions of the third loop
in the bundle zone, corresponding to the early distal segment of Hentschel et
al. (1998
). This segment seems
to be responsible for active NaCl reabsorption.
Na+/K+-ATPase immunoreactivity was found in the
basolateral membrane of epithelial cells in our study, while immunoreactive
Na+/K+/2Cl- cotransporter has been detected
along the apical membrane of the early distal segment of S. acanthias
(Biemesderfer et al., 1996
). A
microperfusion study has also shown that the early distal segment contains an
NaCl reabsorptive activity that is sensitive to furosemide, an inhibitor of
Na+/K+/2Cl- cotransporter activity
(Friedman and Hebert, 1990
).
The epithelial cells of the early distal segment have elaborate basolateral
infoldings and numerous large mitochondria that are characteristic of
ion-transporting epithelia (Hentschel,
1991
). These immunohistochemical and physiological results,
together with our present results, suggest that the early distal segment of
the elasmobranch kidney is homologous to the thick ascending limb of Henle's
loop in the mammalian kidney
(Martinez-Maldonado and Cordova,
1990
). The early distal segment thus may function as a diluting
segment, which contributes to low-urea fluid generation in the interstitium
and/or inside the central vessel, since the blind-ending branches of central
vessels were closely associated with the early distal segment
(Hentschel et al., 1998
).
Urea transport in the mammalian nephron is largely due to passive
permeation (facilitated diffusion; Hays et
al., 1977
; Sands,
2003
), although recent evidence suggests that an ion-coupled
active component may also contribute to this process
(Walsh and Smith, 2001
;
Sands, 2003
). To date, at
least three components (a sodium/urea cotransporter and antiporters) have been
reported in the inner medullary collecting duct of rat kidney
(Walsh and Smith, 2001
). Thus,
the involvement of an unidentified ion-coupled component(s) in the urea
reabsorption process cannot be ruled out in elasmobranchs. In fact, in marine
elasmobranchs, the presence of a sodium-coupled urea transporter has been
suggested in the gill (Fines et al.,
2001
). Because of its huge surface area exposed to external
environments, the gill is another site of urea loss to the environment
(Boylan, 1967
;
Rasmussen, 1971
;
Haywood, 1977
;
Evans and Kormanik, 1985
;
Goldstein and Forster, 1971
;
Payan et al., 1973
).
Nevertheless, the urea efflux across the dogfish gill is considerably lower
than that across the teleost gill (Part et
al., 1998
) and across the toad bladder
(Payan et al., 1973
). This low
urea efflux certainly facilitates urea retention in the body. Low permeability
to urea in the epithelial cell membrane of dogfish gill is explained by the
highest reported cholesterol-to-phospholipid molar ratio
(Fines et al., 2001
). In
addition, analysis of urea uptake revealed the presence of a
phloretin-sensitive, sodium-coupled urea antiporter on the basolateral
membrane, which returns urea to the blood
(Part et al., 1998
;
Fines et al., 2001
). Ouabain,
an inhibitor of the Na+/K+-ATPase, suppressed the
ATP-dependent urea uptake.
In the kidney, tubular urea reabsorption is tightly coupled with sodium
reabsorption at a fixed ratio of 1.6:1 over a wide range of urine flow rates
and urea reabsorption values, suggesting the presence of a sodium-coupled urea
cotransporter (Schmidt-Nielsen et al.,
1972
). Walsh and Smith
(2001
) have pointed out two
hypothetical components for active urea transport in the elasmobranch kidney;
an apical sodium/urea cotransporter and a basolateral sodium/urea antiporter.
In both models, an inwardly directed sodium gradient in the epithelial cell,
established by the basolateral Na+/K+-ATPase, provides a
driving force for urea movement through the transporters. In the
Triakis kidney, Na+/K+-ATPase was not detected
in the collecting tubule, suggesting that transport (reabsorption) of urea in
the collecting tubule occurs transcellularly by facilitated diffusion. The
localization of UT on both apical and basolateral membranes supports this
hypothesis. Meanwhile, other nephron segments expressing
Na+/K+-ATPase may function as an active component of
urea transport.
In conclusion, our molecular anatomical study provides, for the first time, direct evidence showing that the final nephron segment, the collecting tubule, expresses a facilitated UT. Our results suggest that the collecting tubule exerts an important function for urea reabsorption in the Triakis kidney. To confirm our hypothesis, physiological evidence for urea permeability through the collecting tubule is necessary. A survey of additional facilitative or sodium-coupled UTs is also required in future studies to delineate the overall mechanism of urea reabsorption in the elasmobranch kidney.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Biemesderfer, D., Payne, J. A., Lytle, C. Y. and Forbush, B., III (1996). Immunocytochemical studies of the Na-K-Cl cotransporter of shark kidney. Am. J. Physiol. 270,F927 -F936.
Boylan, J. W. (1967). Gill permeability in Squalus acanthias. In Sharks, Skates and Rays (ed. P. W. Gilbert, R. F. Mathewson and D. P. Rall), pp.197 -206. Baltimore: Johns Hopkins Press.
Boylan, J. W. (1972). A model for passive urea reabsorption in the elasmobranch kidney. Comp. Biochem. Physiol. A 42,27 -30.[Medline]
Deetjen, P., Antkowiak, D. and Boylan, J. W. (1970). The nephron of the skate, Raja erinacea. Bull. Mt. Desert Isl. Biol. Lab. 10, 5-7.
Deetjen, P., Antkowiak, D. and Boylan, J. W. (1972). Urea reabsorption by the skate nephron: micropuncture of collecting ducts in Raja erinacea. Bull. Mt. Desert Isl. Biol. Lab. 12,28 -29.
Evans, D. H. and Kormanik, G. A. (1985). Urea
efflux from the Squalus acanthias pup: the effect of stress.
J. Exp. Biol. 119,375
-379.
Fines, G. A., Ballantyne, J. S. and Wright, P. A. (2001). Active urea transport and an unusual basolateral membrane composition in the gills of a marine elasmobranch. Am. J. Physiol. 280,R16 -R24.
Friedman, P. A. and Hebert, S. C. (1990). Diluting segment in kidney of dogfish shark. I. Localization and characterization of chloride absorption. Am. J. Physiol. 258,R398 -R408.
Goldstein, L. and Forster, R. P. (1971). Osmoregulation and urea metabolism in the little skate Raja erinacea. Am. J. Physiol. 224,367 -372.
Hays, R. M., Levine, S. D., Myers, J. D., Heinemann, H. O., Kaplan, M. A., Franki, N. and Berliner, H. (1977). Urea transport in the dogfish kidney. J. Exp. Zool. 199,309 -316.[CrossRef][Medline]
Haywood, G. P. (1977). A preliminary investigation into the roles played by the rectal gland and kidneys in the osmoregulation of the striped dogfish Poroderma africanum. J. Exp. Zool. 193,167 -176.[CrossRef]
Hazon, N., Tierney, M. L., Anderson, G., Mackenzie, S., Cutler, C. and Cramb, G. (1997). Ion and water balance in elasmobranch fish. In Ionic Regulation in Animals (ed. N. Hazon, F. B. Eddy and G. Flik), pp. 70-86. Berlin: Springer.
Hentschel, H. (1991). Developing nephrons in adolescent dogfish, Scyliorhinus caniculus (L.), with reference to ultrastructure of early stages, histogenesis of the renal countercurrent system, and nephron segmentation in marine elasmobranchs. Am. J. Anat. 190,309 -333.[CrossRef][Medline]
Hentschel, H., Mahler, S., Herter, P. and Elger, M. (1993). Renal tubule of dogfish, Scyliorhinus caniculus: a comprehensive study of structure with emphasis on intramembrane particles and immunoreactivity for H+-K+-adenosine triphosphatase. Anat. Rec. 235,511 -532.[CrossRef][Medline]
Hentschel, H., Storb, U., Teckhaus, L. and Elger, M. (1998). The central vessel of the renal countercurrent bundles of two marine elasmobranchs - dogfish (Scyliorhinus caniculus) and skate (Raja erinacea) - as revealed by light and electron microscopy with computer-assisted reconstruction. Anat. Embryol. 198, 73-89.[CrossRef][Medline]
Kempton, R. (1953). Studies on the elasmobranch
kidney-II. Reabsorption of urea by smooth dogfish, Mustelus canis.
Biol. Bull. 104,45
-56.
Lacy, E. R. and Reale, E. (1985). The elasmobranch kidney II. Sequence and structure of the nephrons. Anat. Embryol. 173,163 -186.[CrossRef][Medline]
Lacy, E. R. and Reale, E. (1999). Urinary system. In Sharks, skates, and rays (ed. W. C. Hamlett), pp. 353-397. Baltimore: Johns Hopkins Press.
Martinez-Maldonado, M. and Cordova, H. R. (1990). Cellular and molecular aspects of the renal effects of diuretic agents. Kidney Int. 38,632 -641.[Medline]
Part, P., Wright, P. A. and Wood, C. M. (1998). Urea and water permeability in dogfish (Squalus acanthias) gills. Comp. Biochem. Physiol. A 119,117 -123.[CrossRef]
Payan, P., Goldstein, L. and Forster, R. P.
(1973). Gills and kidneys in ureosmotic regulation in euryhaline
skates. Am. J. Physiol.
224,367
-372.
Rasmussen, L. E. (1971). Organ distribution of exogenous 14C-urea in elasmobranchs, with special regard to the nervous system. Comp. Biochem. Physiol. A 40,145 -154.[Medline]
Sands, J. M. (2003). Mammalian urea transporters. Annu. Rev. Physiol. 65,543 -566.[CrossRef][Medline]
Schmidt-Nielsen, B., Truniger, B. and Rabinowitz, L. (1972). Sodium-linked urea transport by the renal tubule of the spiny dogfish Squalus acanthias. Comp. Biochem. Physiol. A 42,13 -25.[Medline]
Schmidt-Nielsen, B., Ullrich, K. J., Rumrich, G. and Long, W. S. (1966). Micropuncture study of urea movements across the renal tubules of Squalus acanthias. Bull. Mt. Desert Isl. Biol. Lab. 6,35 -37.
Smith, C. P. and Wright, P. A. (1999). Molecular characterization of an elasmobranch urea transporter. Am. J. Physiol. 276,R622 -R626.
Smith, H. W. (1936). The retention and physiological role of urea in the elasmobranchii. Biol. Rev. 11,49 -82.
Stolte, H., Galaske, R. G., Eisenbach, G. M., Lechene, C., Schmidt-Nielsen, B. and Boylan, J. W. (1977). Renal tubule ion transport and collecting duct function in the elasmobranch little skate, Raja erinacea. J. Exp. Zool. 199,403 -410.[CrossRef][Medline]
Swenson, E. R., Fine, A. D., Maren, T. H., Reale, E., Lacy, E. R. and Smolka, A. J. (1994). Physiological and immunocytochemical evidence for a putative H-K-ATPase in elasmobranch renal acid secretion. Am. J. Physiol. 267,F639 -F645.
Ura, K., Soyano, K., Omoto, N., Adachi, S. and Yamauchi, K. (1996). Localization of Na+,K+-ATPase in tissues of rabbit and teleosts using an antiserum directed against a partial sequence of the alpha-subunit. Zool. Sci. 13,219 -227.[Medline]
Walsh, P. J. and Smith, C. P. (2001). Urea transport. In Nitrogen Excretion (ed. P. A. Wright and P. M. Anderson), pp. 279-307. San Diego: Academic Press.
Wood, C. M., Part, P. and Wright, P. A. (1995). Ammonia and urea metabolism in relation to gill function and acid-base balance in a marine elasmobranch, the spiny dogfish (Squalus acanthias). J. Exp. Biol. 198,1545 -1558.[Abstract]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
Related articles in JEB:
This article has been cited by other articles:
![]() |
C. Y. C. Hung, F. Galvez, Y. K. Ip, and C. M. Wood Increased gene expression of a facilitated diffusion urea transporter in the skin of the African lungfish (Protopterus annectens) during massively elevated post-terrestrialization urea excretion J. Exp. Biol., April 15, 2009; 212(8): 1202 - 1211. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Uchiyama, R. Kikuchi, N. Konno, T. Wakasugi, and K. Matsuda Localization and regulation of a facilitative urea transporter in the kidney of the red-eared slider turtle (Trachemys scripta elegans) J. Exp. Biol., January 15, 2009; 212(2): 249 - 256. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Rodela, J. S. Ballantyne, and P. A. Wright Carrier-mediated urea transport across the mitochondrial membrane of an elasmobranch (Raja erinacea) and a teleost (Oncorhynchus mykiss) fish Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2008; 294(6): R1947 - R1957. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hyodo, J. D. Bell, J. M. Healy, T. Kaneko, S. Hasegawa, Y. Takei, J. A. Donald, and T. Toop Osmoregulation in elephant fish Callorhinchus milii (Holocephali), with special reference to the rectal gland J. Exp. Biol., April 15, 2007; 210(8): 1303 - 1310. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Janech, W. R. Fitzgibbon, D. W. Ploth, E. R. Lacy, and D. H. Miller Effect of low environmental salinity on plasma composition and renal function of the Atlantic stingray, a euryhaline elasmobranch Am J Physiol Renal Physiol, October 1, 2006; 291(4): F770 - F780. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Janech, W. R. Fitzgibbon, M. W. Nowak, D. H. Miller, R. V. Paul, and D. W. Ploth Cloning and functional characterization of a second urea transporter from the kidney of the Atlantic stingray, Dasyatis sabina Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2006; 291(3): R844 - R853. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Konno, S. Hyodo, K. Matsuda, and M. Uchiyama Effect of osmotic stress on expression of a putative facilitative urea transporter in the kidney and urinary bladder of the marine toad, Bufo marinus J. Exp. Biol., April 1, 2006; 209(7): 1207 - 1216. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Mistry, G. Chen, A. Kato, K. Nag, J. M. Sands, and S. Hirose A novel type of urea transporter, UT-C, is highly expressed in proximal tubule of seawater eel kidney Am J Physiol Renal Physiol, March 1, 2005; 288(3): F455 - F465. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Phillips FACILITATING WASTE RECYCLING J. Exp. Biol., January 15, 2004; 207(2): 191 - 191. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||