|
| ![]() |
|
||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
A second glutamine synthetase gene with expression in the gills of the gulf toadfish (Opsanus beta)
1 NIEHS Marine and Freshwater Biomedical Sciences Center, Rosenstiel School
of Marine and Atmospheric Science, University of Miami, Miami, FL 33149,
USA
2 Joint Genome Institute, Genomic Diversity Laboratory, Walnut Creek, CA
94598, USA
3 Department of Biochemistry and Microbiology, University of Victoria,
Victoria, BC, Canada
* Author for correspondence (e-mail: pwalsh{at}rsmas.miami.edu)
Accepted 21 January 2003
| Summary |
|---|
|
|
|---|
kidney > intestine > gill > heart/spleen
> muscle. When tissue mass is used to calculate a glutamine synthetic
potential, the liver has the greatest, followed by muscle > stomach and
intestine, with minor contributions from the remaining tissues. Additionally,
during confinement stress, GSase activity increases significantly only in
liver (fivefold) and muscle (twofold), tissues that previously showed
significant expression of the other enzymes of urea synthesis. Western
analyses of samples on SDS gels demonstrated that GSase-specific protein
content reflected enzyme activity, and all tissues except muscle had a single,
similarly sized GSase subunit of 49.4 kDa; muscle showed staining of two bands
of 36.8 and 98.9 kDa, which may possibly result from another gene product or
post-translational modification. RT-PCR and RACE-PCR revealed the presence of a second GSase cDNA from gill tissue that shares only 73% nucleotide and amino acid sequence similarity with the GSase cDNA previously cloned from liver, and that lacks a mitochondrial leader-targeting sequence. RT-PCR and restriction digestion experiments demonstrated that mRNA from the original `liver' GSase is expressed in all tissues examined (liver, gill, stomach, intestine, kidney, brain and muscle), whereas the new `gill' form shows expression primarily in the gill. Gill GSase activity shows apparently exclusive expression in the soluble compartment, while other tissues expressing the `liver' form show both cytoplasmic and mitochondrial activities.
Phylogenetic analysis of a number of GSases demonstrates that the toadfish gill GSase has a greater affinity for a clade that includes the Xenopus GSase genes and one of two Fugu GSase genes, than it has for a clade containing the toadfish liver GSase and other described teleost GSase genes. The results are discussed in the context of a prior hypothesis on an ammonia-trapping mechanism in the gill of the toadfish.
Key words: glutamine synthetase, toadfish, ureotely, ornithineurea cycle, ammonia detoxification, Opsanus beta, ammonia excretion, gill, ORF, UTR
| Introduction |
|---|
|
|
|---|
GSase is also an interesting enzyme/gene from the standpoint of molecular
evolution, and sequence information is available from representatives of many
taxa (Kashiwaga et al., 2001
).
In recent studies of rainbow trout GSase sequences, at least four GSase
encoding genes have been discovered, and these additional GSase genes have
presumably resulted from either single-case or genome-wide gene duplications
(Murray et al., 2003
). Their
exact functions are as yet unknown, but increasing evidence points towards
differential expression during development (P. Essex-Fraser and P. A. Wright,
University of Guelph, personal communication). Prior enzymatic and molecular
studies of liver GSase in the gulf toadfish
(Walsh, 1996
;
Walsh et al., 1999
) suggested
the existence of more than a single GSase gene. The studies of Murray et al.
(2003
) provide substantial
recent impetus and information/approaches useful in the search for additional
GSase genes in the toadfish model. Furthermore, if one is to pursue the
5'-flanking region sequence from the inducible liver GSase gene in
toadfish to obtain regulatory information, there is an important need to
enumerate the GSase genes accurately in this species. Thus, the first goal of
this study was to probe the existence of multiple GSase genes in the
toadfish.
While liver GSase has received much attention in the toadfish, prior
studies have shown substantial expression of other O-UC enzymes in non-hepatic
tissues; in particular, CPSase III can show ample expression in fish muscle
(toadfish, Julsrud et al.,
1998
; trout, Korte et al.,
1997
; Lake Magadi tilapia,
Lindley et al., 1999
; other
fish species, Felskie et al.,
1998
). Therefore, to attain a more comprehensive view of nitrogen
metabolism in the toadfish model, it is desirable to know if GSase activity in
toadfish is expressed in other tissues, how GSase subcellular compartmentation
compares with liver, and whether activities in other tissues are subject to
change by stress. Thus, an additional goal of this study was to obtain
information on tissue-specific patterns of GSase activity and gene expression,
and to compare these data to the molecular information obtained.
| Materials and methods |
|---|
|
|
|---|
Enzyme activities and subcellular compartmentation
For measurement of total GSase activity only, tissues were disrupted either
by sonication (liver, brain and kidney) in a micro-ultrasonic cell disruptor
(Kontes, Vineland, NJ, USA) or homogenized (all other tissues) with a Polytron
(Brinkman, Westbury, NY, USA) in 5 vol. of 50 mmol l1 Hepes,
pH 7.4, then centrifuged at 13,000 g. The supernatant was used
directly in enzyme assays. For compartmentation studies, tissues were
homogenized in an isotonic sucrose buffer using a teflon pestle on glass
homogenizer, followed by differential centrifugation exactly following the
protocols of Anderson and Walsh
(1995
). Activities of the
marker enzymes for soluble (lactate dehydrogenase, LDH) and mitochondrial
(glutamate dehydrogenase, GDH) compartments were measured in all fractions.
The transferase assay for GSase (for details, see
Walsh, 1996
) was always used
since the synthetase assay that ultimately measures ADP production has too
many competing side reactions (e.g. from ATPases), especially in crude
homogenates.
Western blots
Tissues isolated from confined or unconfined toadfish were frozen in liquid
nitrogen, thawed and homogenized in 50 mmol l1 Hepes, pH
7.6. The homogenate was centrifuged briefly to remove debris and divided into
portions. Protein concentrations of each sample were determined
spectrophotometrically using the BCA protein assay kit (Pierce, Rockford, IL,
USA). SDS-PAGE 415% gradient Tris-HCl gels (Biorad, Hercules, CA, USA)
were loaded with 10 µg total protein in each well and electrophoresed.
Protein standards used were colored myosin (220 kDa), phosphorylase b (97.4
kDa), BSA (66 kDa), ovalbumin (46 kDa), carbonic anhydrase (30 kDa), trypsin
inhibitor (21.5 kDa) and lysozyme (14.3 kDa) (Rainbow markers, Amersham, UK).
After electrophoresis, gels were electroblotted onto 0.45 µm PVDF membranes
at a constant current of 60 mA for 1 h, using a semi-dry electroblotter
(Hoeffer, Piscataway, NJ, USA). Blots were blocked overnight in 1% casein
solution, then washed thoroughly in phosphate-buffered saline with 0.1% Tween
20 (PBST). Rabbit antibody to a GSase conserved oligopeptide conjugated to
keyhole limpet hemocyanin (KLH) (Acetylcysteinyl-CPRSVGQEKKGYFEDRRPS-Amide, as
produced in Anderson et al.,
2002
) with high homology to amino acids 326343 of the
toadfish liver GSase (see Fig.
3), was diluted from a stock sample in PBST. The blot was allowed
to bathe in the primary antibody solution for 1 h, then washed with PBST.
Horseradish peroxidase-labeled, anti-rabbit IgG (Amersham) was then diluted in
PBST and allowed to bathe the membrane for 1 h. After sufficient washing the
blot was detected using the ECL detection kit (Amersham) and light production
was captured on XAR-2 film.
|
Isolation of RNA, mRNA and cDNA synthesis/RT-PCR
Total RNA was isolated from 0.2 g of tissue by homogenization in 1.2 ml
phenol-guanidinium thiocyanate (Trizol Reagent, Gibco BRL, Carlsbad, CA, USA)
followed by standard chloroform extraction and isopropanol precipitation
(Sambrook et al., 1989
). mRNA
was enriched from total RNA using a mRNA Purification Kit (Qiagen, Valencia,
CA, USA) based on oligo(dT) latex binding. cDNA was synthesized using MMLV
Reverse Transcriptase and oligo-dT primers (Stratagene, La Jolla, CA, USA).
PCR was performed on these cDNAs using primers designed by Murray et al.
(2003
); specifically we used
either their exact primers to the toadfish liver GSase (GS 301 and 501) or
degenerate primers designed from sequences for mammalian, piscine, and other
GSases (GLUL*e3f1 and 6r1). Locations for these primers are shown in
Fig. 1 in the Results. PCR
conditions were 94°C for 5 min, followed by 55°C for 3 min, at which
point Taq polymerase (Promega, Madison, WI, USA) was added followed by the
mineral oil layer in a hot-start protocol, and then 3035 cycles of
94°C (1 min), 55°C (30 s), 72°C (30 s), followed by one cycle of
72°C (10 min) in a Perkin-Elmer 480 PCR Thermal Cycler using 0.5 ml
GeneAmp tubes (Perkin-Elmer, Boston, MA, USA). PCR products (typically in the
range 545570 bp) were separated by gel electrophoresis on 1% agarose
gel in TAE buffer (40 mmol l1 Tris-acetate, 1 mmol
l1 EDTA, pH 8.0). Bands were either gel-purified or in some
cases mixed PCR products used directly, prior to ligation into the plasmid
vector pCR 4 TOPO, with the resultant plasmid transfected into chemically
competent JM 109 cells (Invitrogen, Carlsbad, CA, USA). Standard blue/white
screening on LB kanamycin plates identified colonies with potential inserts,
which were then liquid-cultured and the plasmid DNA isolated by the alkaline
lysis method (Qiagen). Restriction digests were then performed to ensure the
presence of an appropriately sized insert. Insert DNA was sequenced using an
automated dideoxy chain-termination sequencing method
(Sanger et al., 1977
).
Generally, PCR reactions were performed in duplicate (from the same template)
to exclude PCR errors, and as noted below, multiple samples from each tissue
were sequenced to search for novel GSase sequences.
|
RACE-PCR
5' and 3' rapid amplification of cDNA ends (RACE)-PCR was
performed to amplify 5' and 3' ends from a novel GSase found in
gill using the Marathon cDNA Amplification Kit and adaptor-ligated gill cDNA
(Clontech, Palo Alto, CA, USA). Gene-specific primers were synthesized based
on the known sequences of a 545 bp PCR product (discovered in routine RT-PCR,
as described above) and primer sequences for the first round of PCR were:
GGSaseGSP1A, antisense gene specific primer for 5'-RACE,
5'-CAAATGCTGCTCCTTCACTGCCTC-3' and GGSaseGSP 2A, sense gene
specific primer for 3'-RACE,
5'-CTCATCCCAGTGTGCATGTTCAAAG-3'. The sense primers for
5'-RACE and the antisense primers for 3'-RACE were complementary
to an adaptor supplied with the kit that was ligated to the 5' and
3' cDNA ends. PCR conditions were: 94°C (1 min), followed by 5
cycles of 94°C (30 s), 72°C (4 min), followed by 5 cycles of 94°C
(30 s), 70°C (4 min), followed by 25 cycles of 94°C (30 s), 68°C
(4 min). Because RACE-PCR can generate multiple bands in the first round, a
second round of PCR with nested primers was performed on 1:250 dilutions of
the primary PCR reaction products. The gene-specific primers for the second
round were: GGSaseGSP1B, antisense primer for 5'RACE,
5'-CTGTTGCGATGGTTAGTTTCTGCAGGTA-3' and GGSaseGSP2B, sense primer
for 3'-RACE, 5'-TACCTGCAGAAACTAACCATCGCAACAG-3'. Adaptor
primers were also nested for this second round. Conditions were as in the
first round except the last set of cycles was 15 instead of 25. The
5'-RACE reactions produced a band of approx. 420 bp, and the
3'-RACE reactions produced a band of approx. 900 bp. Bands were
purified, subcloned and sequenced as above.
Phylogeny of GSases
A protein alignment of 359 amino acids for 25 protein sequences was
obtained by using Clustal X using the default settings. The alignment was then
refined by eye. Sequences of shorter length were excluded because they are
known to affect resolution in phylogenetic reconstruction. A total of 118
sites were constant. The Drosophila sequences were used as outgroups.
Minimum evolution (ME) reconstructions were conducted in MEGA 2.0
(Kumar et al., 2001
),
quartet-puzzling was performed in TREE_PUZZLE
(Strimmer and Haeseler, 1997
)
and Bayesian reconstructions in MrBayes
(Huelsenbeck and Ronquist,
2001
).
A gamma model of evolution was used for ME, and to estimate branch support
we performed 10000 bootstrap pseudoreplicates. The JTT model (Jones, Taylor,
Thornton model; Jones et al.,
1992
) was used for quartet-puzzling, with a gamma correction
(alpha parameter = 0.55) and eight categories. Amino acid frequencies were
estimated from the dataset. 1000 puzzling steps were performed. Exploratory
Markov Chain Monte Carlo (MCMC) runs were performed, starting with a JTT model
and a gamma correction. Subsequently, we ran the heated MCMC chain for 100000
generations, which was sampled every 100 updates. We discarded 7000 cycles as
burn-in before estimating joint posterior probabilities.
Restriction digests
Comparing the sequences of the PCR products for the `gill' and `liver'
forms of the gene generated with the GS 301 and 501 primers, we predicted that
the `gill' form should be cut once by the restriction enzyme PvuII
into 137 and 408 bp fragments, and the liver form cut by StuI should
produce 299 and 276 bp fragments. Furthermore, PvuII should not cut
the liver form, and StuI should not cut the gill form. Therefore,
digest experiments were performed with RT-PCR products from 7 tissues of
confined and unconfined individuals using PvuII and StuI
alone and in combination to identify tissue-specific mRNAs. Buffers and
dilutions were as per manufacturer's recommendations (New England Biolabs,
Beverly, MA, USA) and digests proceeded overnight at 37°C, after which
agarose gels were run on uncut and cut fragments to determine their molecular
size.
| Results |
|---|
|
|
|---|
kidney
> intestine > gill > heart/spleen > muscle. However, after
accounting for tissue mass and expressing as a percentage of `whole body'
GSase activity, the liver has the greatest glutamine synthetic potential,
followed by muscle > stomach and intestine, and minor contributions from
the remaining tissues (Table
1).
|
As in prior studies of enzyme compartmentation in liver of the toadfish
(e.g. Anderson and Walsh, 1995
;
Walsh and Milligan, 1995
), the
marker enzymes glutamate dehydrogenase (GDH; mitochondrial) and lactate
dehydrogenase (LDH; soluble) fractionated mostly as anticipated, with GDH
showing only minor contamination of the soluble compartment, and LDH as a
minor contaminant of the mitochondrial compartment
(Table 2). Exceptions in the
present study were the slightly higher proportion of LDH found in the brain
mitochondrial fraction, and the lower proportion of GDH present in the
mitochondrial fractions of stomach and muscle. We have no ready explanation
for the slightly unexpected marker enzyme compartmentation data in the brain.
However, in stomach and muscle, this phenomenon might be due to the relative
toughness of the tissues leading to a lower harvesting efficiency for intact
mitochondria, a suggestion reflected in the higher proportion of GDH in the
debris and soluble fractions (Table
2).
|
For tissues other than gill and liver, GSase activity shows partial
distribution in both the soluble and mitochondrial compartments, with a slight
bias towards the mitochondrial compartment in the unconfined state
(Table 2). Liver GSase
compartmentation shows the variable pattern previously demonstrated by Walsh
and Milligan (1995
), namely
that in the unconfined state, enzyme activity is distributed in both
mitochondrial and soluble compartments, but that most of the increase in GSase
activity upon confinement resides in the soluble compartment
(Table 2). Gill GSase
compartmentation is notably different from all other tissues in that it
appears to be nearly exclusively expressed in the soluble compartment, with
fractionation percentages skewed even more towards the soluble compartment
than the soluble LDH marker distribution
(Table 2).
Western blots (Fig. 1) of
SDS gels demonstrated that GSases in all tissues except muscle appear as a
single subunit band with a molecular mass of approximately 49.4 kDa. This
value differs slightly from the 42.342.4 kDa previously reported for
liver in Walsh (1996
),
probably due to the slightly different electrophoretic conditions and the use
of crude homogenates versus purified enzyme. Additionally, the
intensity of the staining reflects both the overall differences in activity
among tissues, as well as differences in confined versus unconfined
treatments for liver and muscle. Interestingly, muscle shows a rather
different pattern of expression, with two bands at 36.8 and 98.9 kDa, the
larger band appearing to increase in expression during confinement. From these
initial results, it cannot be concluded if these patterns are related to the
twofold increase in GSase activity in muscle and whether they are related to,
for example, expression of yet another GSase gene that is muscle-specific, or
a post-translational modification that effects the association of GSase
subunits in the muscle. Other factors could also be operating, such as
antibody cross-reactivity with a related protein in higher abundance than
GSase (which has the lowest mass-specific enzyme activity of all tissues
examined).
GSase cDNA sequences and phylogeny
RT-PCR was performed on mRNA of seven tissues (those listed in
Table 1, except for
heart/spleen) from each of three individual toadfish using both primer pairs
of GS 301/501 and GLUL*3ef1 and 6er1. In all cases except one, the sequences
of the 545 bp fragments obtained were identical to that of the appropriate
segment of the liver GSase sequence previously published
(Walsh et al., 1999
). PCR of
gill from one individual yielded several subclones of the same 545 bp size,
but whose overall sequence was rather different from the liver. This unique
sequence for the 545 bp PCR product, which formed the basis for RACE-PCR to
obtain a full sequence, can be found between nucleotides 249791 shown
in Fig. 2, except for a 3 bp
`error' that was corrected during sequencing of RACE-PCR products (see more
detailed explanation in the final paragraph of Results). Notably, the same
gill mRNA sample also yielded additional PCR products whose sequence matched
the original liver GSase sequence, suggesting coexpression of the two GSase
forms in the gill (see below).
|
RACE-PCR of the adaptor-ligated gill cDNA library using primers specific to this new GSase sequence and adaptor primers resulted in approx. 420 bp products at the 5' end, and predominant approx. 900 bp products at the 3' end. Sequences of several subclones of the 5'-RACE-PCR products consistently yielded the same invariant sequence shown in Fig. 2 (nucleotides 1385). Interestingly, different 3'-RACE-PCR subclones yielded two sequence variants that differed only by the presence or absence of a 67 bp sequence near the 3' end, just outside the open reading frame (ORF) (Fig. 2). Presumably, these two variants of the gill GSase are RNA splice variants from the same gene.
The full sequence of the gill GSase (GenBank AF532312) reflects an overall mRNA/cDNA size considerably smaller than the original liver GSase (1263 bp for the gill versus 1679 bp for the liver). However, the ORF for the gill yields a protein that is two amino acid residues larger than in the liver (373 versus 371 residues) with the substitution appearing near the N terminus (Fig. 3). Note that the gill GSase has no indication of any mitochondrial leader sequence that would target it to the mitochondrial compartment, even when nucleotides upstream of the ATG start site (Fig. 1) are read in all three open reading frames. This absence of a leader sequence is in marked contrast to the liver form of GSase, which has previously been shown to possess two presumed ATG translation start sites and a pronounced mitochondrial targeting leader sequence between the two start sites (not shown in Fig. 3).
Although amino acids involved in the catalytic site of GSase are exactly conserved in gill and liver forms (amino acids marked with an asterisk in Fig. 3), the proteins are in fact relatively different in overall amino acid sequence, with only a 73.3% similarity. Furthermore, whereas the liver gene clusters with the majority of fish GSases reported to date, and has a 91.4% and 89.5% similarity to the rainbow trout GS01 and GS02 genes, respectively, the gill form clusters more closely to the Xenopus laevis GSases (74.3% similarity) and one of the Fugu genes (Fig. 4). Note that the toadfish gill GSase neither has identity with mammalian GSases, nor does it show high similarity with invertebrate and primitive eukaryote GSases, suggesting that it does not originate from, for example, a parasitic or infectious organism colonizing the toadfish gill, or other sources of contamination.
|
Tissue distribution of the `gill' GSase
While data from the sequencing of PCR products suggested that gill was the
only tissue in which the new GSase was expressed in the toadfish, we wished to
test this assumption more carefully in many tissues in a number of individuals
from both unconfined and confined conditions. We therefore performed RT-PCR on
samples of seven tissues from four individuals from each of two treatments,
confined and unconfined (i.e. a subset of half of those individuals used for
GSase assays in Table 1), and
then subjected these products to PvuII and StuI digestion,
as described in Materials and methods. In all samples except those from gill
and stomach, only the digestion pattern diagnostic of liver cDNA was found
(see sample liver pattern in Fig.
5). In gill samples from all individuals, digestion patterns
diagnostic of both liver and gill cDNA were found (see sample gill pattern in
Fig. 5). Since the amounts of
mRNA/cDNA and numbers of PCR cycles were identical in all samples, these
reactions can be considered to be `semi-quantitative', indicating a
more-or-less equivalent expression of the two GSase mRNA forms in gill, and we
did not observe any obvious change in these proportions in samples from
confined versus unconfined fish. Amongst the eight stomach samples
examined, only one individual showed slight expression of the gill GSase form
(this exception is shown in Fig.
5), which appeared to be minor relative to the liver form, and
also minor relative to the expression level of the gill form in the gill
tissue. Stomach tissue from this individual was subjected to the entire RT-PCR
and digestion procedure two more times to rule out contamination artifacts,
and the results were qualitatively the same.
|
The gill sequence obtained by RACE-PCR differs from that obtained by RT-PCR by three nucleotides at positions 251 (A instead of G) and 263/266 (both T instead of C), and also in fact from the GS 501 primer (the nucleotides in question are underlined in the following primer sequence: GAGGGCTCCAACAGCGACAT). In other words, in order to actually amplify the gill form with GS 501, the primer has to misprime slightly. (Note that the GS 301 primer at the 3' end is an exact match for both genes, see Fig. 2.) Beca use of this slight mismatch, we were concerned that the result of the digest experiment, namely the nearly complete `absence' of expression of the gill form in other tissues, could be the result of not amplifying the `gill' form of the cDNAs simply due to the slight mismatch and a lower abundance (relative to the liver form) rather than the rare occurrence or `absence' of the gill template. To test this possibility, we performed PCR on all of the same cDNAs with the RACE-PCR primers GSP2A and GSP1A that are highly specific to the gill form only, and should generate a 152 bp product from the gill form. Confirming the expression pattern above, a significant band of the appropriate size was produced only in gill tissue, whereas only faint bands of an inappropriate size were obtained in other tissues (results not shown). Note that there was no amplification from stomach cDNA.
| Discussion |
|---|
|
|
|---|
A second interesting facet of ureotely in toadfish is that urea is excreted
in periodic `pulses' at the gill (Wood et al.,
1995
,
1997
,
1998
), presumably through a
specific urea transporter (Walsh et al.,
2000
). However, equally remarkable is the fact that ureotelic
toadfish virtually shut down ammonia excretion at the gill, despite continued
ventilation of the gill with water and perfusion with blood having typical
plasma ammonia values (in the range of several hundred µmol
l1), i.e. a substantial outwardly directed
PNH3 gradient when factoring in pH values of
water and plasma (Wang and Walsh,
2000
). Previously it was speculated that gill GSase might play a
role in trapping ammonia to minimize its leakage through the gill
(Wood et al., 1995
), and
calculations by Walsh (1997
)
suggest that there is sufficient gill GSase activity to support this proposed
mechanism.
Several findings of the current study may have a bearing on this
hypothesis. It seems prudent to conclude that mRNA of the `gill' form is in
low abundance or absent in non-branchial tissues in the toadfish and is
expressed nearly exclusively in the gill under the conditions imposed in this
study. The gill GSase shows different compartmentation from the form expressed
in other tissues in that it appears to have an exclusively soluble/cytosolic
distribution. This subcellular localization seems to make `sense' for an
ammonia-trapping function in that localization in the mitochondria might limit
the enzyme's ability to contact ammonia efficiently. Additionally, a
mitochondrial compartmentation might skew GSase expression towards the
mitochondrial-rich cells (MR)/chloride cells, cells that make up only a small
proportion of the total gill cell numbers
(Perry and Walsh, 1989
).
Therefore, one would predict expression of GSase in virtually all gill cells.
At a molecular level, this predominantly cytoplasmic expression pattern is
also consistent with the absence of a mitochondrial leader sequence in the
gill gene. However, since at least the mRNA for the liver gene is coexpressed
in the gill, the expression of a mitochondrial form of the enzyme is probably
minimized by some mechanism. Following the work of Campbell and colleagues on
dogfish shark GSase (see Campbell and
Anderson, 1991
), we have speculated that differential
transcription or translation of the liver form of the gene so as to not
include the mitochondrial leader sequence can take place
(Walsh et al., 1999
), and this
could limit the expression of the mitochondrial form of the enzyme in the
gill. Another interesting possibility is that the two genes are expressed in
different cell types (e.g. `gill' GSase in the pavement cells and `liver'
GSase in the MR cells), speculation that could be tested with gene-specific
nucleotide and antibody probes.
Interestingly, gill mass-specific GSase activity does not increase during
confinement stress, but it must be kept in mind that the transferase assay
does not necessarily measure how the enzyme functions in vivo, and
its relationship with the synthetase activity can be highly variable
(Shankar and Anderson, 1985
;
Walsh, 1996
). It is also
possible that even if total GSase activity remains unaltered, the proportion
of gill versus liver enzymes in the gill might change, and that these
enzymes might possess entirely different kinetics with respect to ammonia
trapping. Such kinetic differences could also be the result of different
susceptibilities of the two proteins to post-translational modifications. A
different kinetic variant makes sense for an ammonia-trapping role, since if
it were only the cytosolic location that were necessary, this condition could
be achieved just by dropping the mitochondrial leader sequence from the liver
form of the protein. There is precedent for variable kinetic properties of
GSase even among the two forms produced from the toadfish liver gene. Walsh
(1996
) demonstrated that the
cytoplasmic and mitochondrial forms of the enzyme, presumably generated from
the same gene with and without the leader sequence, show different substrate
Km values, specific activities, transferase to synthetase
activity ratios, pH profiles and susceptibilities to the inhibitor methionine
sulfoximine (MSOX).
Clearly the gill GSase gene nucleotide and amino acid sequences are rather
different from most other fish GSase genes examined to date (see
Murray et al., 2003
;
Fig. 4). It is not clear if
more than two forms of the GSase gene occur in toadfish. On the one hand,
since the primers used in this study identified four genes in the tetraploid
rainbow trout (Murray et al.,
2003
), and also amplified genes as divergent as the liver and gill
forms in the toadfish, one would expect them to amplify other related GSase
genes. On the other hand, the unusual pattern of muscle GSase in western
analysis for the toadfish suggests that further analysis is necessary.
Our study also confirms the results of Murray et al.
(2003
) that the initial gene
duplication of GSase in fish probably occurred relatively early in piscine
evolution, likely as part of a teleost-specific genome duplication. However,
it is clear that something in the selective pressures on toadfish, and perhaps
the pufferfish as well, led to a more divergent sequence of the second GSase
gene. It is tempting to speculate that it also has a divergent function, one
that is closer to that of terrestrial animals that possess CPSase I, namely
avid ammonia scavenging. It will be instructive to perform studies of the
biochemistry of purified gill GSase(s), and to examine whether only two `pure'
forms of the enzyme exist with unified subunit composition, or if toadfish
`mix and match' subunits from the two genes in this normally octameric enzyme
to express more than two functional proteins. It will also be useful to test
the role of gill GSase in ammonia trapping by examining the effects of MSOX on
ammonia excretion in vivo or in isolated head/gill preparations
(Pärt et al., 1999
).
In summary, the current studies report on the presence of a second GSase
gene in toadfish expressed mainly in the gill, and they have opened another
facet of nitrogen metabolism and excretion in this interesting species.
Furthermore, when our results are considered in the context of the recent
study of Murray et al. (2003
),
it is clear that further analyses of the GSase genes in additional species
should yield interesting evolutionary insights.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Anderson, P. M. (2002). Urea and glutamine synthesis: environmental influences on nitrogen excretion. In Fish Physiology Vol. 20, Nitrogen Excretion (ed. P. A. Wright and P. M. Anderson), pp. 239-277. New York: Academic Press.
Anderson, P. M. and Walsh, P. J. (1995). Subcellular localization and biochemical properties of the enzymes of carbamoyl phosphate and urea synthesis in the Batrachoidid fishes Opsanus beta, Opsanus tau and Porichthys notatus. J. Exp. Biol. 198,755 -766.
Anderson, P. M., Broderius, M. A., Fong, F. C., Tsui, K. N. T., Chew, S. F. and Ip, Y. K. (2002). Glutamine synthetase expression in liver, muscle, stomach and intestine of Bostrichthys sinensis in response to exposure to a high exogenous ammonia concentration. J. Exp. Biol. 205,2053 -2065.
Campbell, J. W. and Anderson, P. M. (1991). Evolution of mitochondrial enzyme systems in fish: the mitochondrial synthesis of glutamine and citrulline. In Biochemistry and Molecular Biology of Fishes, Vol. 1, Phylogenetic and Evolutionary Perspectives (ed. P. W. Hochachka and T. P. Mommsen), pp.43 -75. New York: Elsevier.
Cooper, A. J. L. (2001). Role of glutamine in cerebral nitrogen metabolism and ammonia neurotoxicity. Ment. Retard. Dev. Disabil. Res. Rev. 7,280 -286.[CrossRef][Medline]
Felskie, A. K., Anderson, P. M. and Wright, P. A. (1998). Expression and activity of carbamoyl phosphate synthetase III and ornithine urea cycle enzymes in various tissues of four fish species. Comp. Biochem. Physiol. 119B,355 -364.[CrossRef]
Gebhardt, R. and Mecke, D. (1983). Heterogeneous distribution of glutamine synthetase among rat liver parenchymal cells in situ and in primary culture. EMBO J. 2, 567-570.[Medline]
Hopkins, T. E., Wood, C. M. and Walsh, P. J. (1995). Interactions of cortisol and nitrogen metabolism in the ureogenic gulf toadfish Opsanus beta. J. Exp. Biol. 198,2229 -2235.
Huelsenbeck, J. P. and Ronquist, F. (2001).
MRBAYES: Bayesian inference of phylogenetic trees.
Bioinformatics 17,754
-755.
Ip, Y. K., Chew, S. F., Leong, I. W., Jin, Y. and Wu, R. S. S. R. (2001). The sleeper Bostrichthys sinensis (Teleost) stores glutamine and reduces ammonia production during aerial exposure. J. Comp. Physiol. 171B,357 -367.
Jones, D. T., Taylor, W. R. and Thornton, J. M.
(1992). The rapid generation of mutation data matrices from
protein sequences. Comput. Appl. Biosci.
8, 275-282.
Julsrud, E. A., Walsh, P. J. and Anderson, P. M. (1998). N-acetyl-L-glutamate and the urea cycle in gulf toadfish (Opsanus beta) and other fish. Arch. Biochem. Biophys. 350,55 -60.[CrossRef][Medline]
Jungermann, K. and Katz, N. (1989). Functional
specialization of different hepatocyte populations. Physiol.
Rev. 69,708
-764.
Kashiwaga, A., Noumachi, W., Katsuno, M., Alam, M. T., Urabe, I. and Yomo, T. (2001). Plasticity of fitness and diversification process during an experimental molecular evolution. J. Mol. Evol. 52,502 -509.[Medline]
Kong, H., Kahatapitiya, N., Kingsley, K., Salo, W. L., Anderson, P. M., Wang Y. and Walsh, P. J. (2000). Induction of carbamoyl-phosphate synthetase III and glutamine synthetase mRNA during confinement stress in the gulf toadfish (Opsanus beta). J. Exp. Biol. 203,311 -320.[Abstract]
Korte, J. J., Salo, W. L., Cabrera, V. M., Wright, P. A.,
Felskie, A. K. and Anderson, P. M. (1997). Expression
of carbamoyl-phosphate synthetase III mRNA during the early stages of
development and in muscle of adult rainbow trout (Oncorhynchus
mykiss). J. Biol. Chem.
272,6270
-6277.
Kumar, S., Tamura, K., Jakobsen, I. and Nei, M. (2001). MEGA: Molecular Evolutionary Genetics Analysis. Pennsylvania State University and Arizona State University, University Park, MD and Tempe, AZ.
Lindley, T. E., Scheiderer, C. L., Walsh, P. J., Wood, C. M.,
Bergman, H. G., Bergman, A. N., Laurent, P., Wilson, P. and Anderson,
P. M. (1999). Muscle as a primary site of urea cycle enzyme
activity in an alkaline lake-adapted tilapia, Oreochromis alcalicus
grahami. J. Biol. Chem. 274,29858
-29861.
Meijer, A. J. (1995). Urea synthesis in mammals. In Nitrogen Metabolism and Excretion (ed. P. J. Walsh and P. A. Wright), pp. 193-204. Boca Raton: CRC Press.
Murray, B. W., Busby, E. R., Mommsen, T. P. and Wright, P.
A. (2003). Evolution of glutamine synthetase in vertebrates:
multiple glutamine synthetase genes expressed in rainbow trout
(Oncorhynchus mykiss). J. Exp. Biol.
206,1511
-1521.
Pärt, P., Wood, C. M., Gilmour, K. M., Perry, S. F., Laurent, P., Zadunaisky J. and Walsh, P. J. (1999). Urea and water permeability in the ureotelic gulf toadfish (Opsanus beta). J. Exp. Zool. 283, 1-12.[CrossRef][Medline]
Perry, S. F. and Walsh, P. J. (1989).
Metabolism of isolated fish gill cells: contribution of epithelial chloride
cells. J. Exp. Biol.
144,507
-520.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press: New York.
Sanger, F., Nicklen, S. and Coulson, A. R.
(1977). DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74,5463
-5467.
Shankar, R. A. and Anderson, P. M. (1985). Purification and properties of glutamine synthetase from liver of Squalus acanthias. Arch. Biochem. Biophys. 239,248 -259.[CrossRef][Medline]
Strimmer, K. N. V. and von Haeseler, A. (1997). Puzzle. Maximum Likelihood Analysis for Nucleotide and Amino Acid Alignments. Munchen, Germany: Zoologisches Institut.
Walsh, P. J. (1996). Purification and properties of hepatic glutamine synthetases from the ureotelic gulf toadfish, Opsanus beta. Comp. Biochem. Physiol. 115B,523 -532.[CrossRef]
Walsh, P. J. (1997). Evolution and regulation of urea synthesis and ureotely in (batrachoidid) fishes. Annu. Rev. Physiol. 59,299 -323.[CrossRef][Medline]
Walsh, P. J. and Milligan, C. J. (1995). Effects of feeding on nitrogen metabolism and excretion in the gulf toadfish (Opsanus beta). J. Exp. Biol. 198,1559 -1566.
Walsh, P. J., Handel-Fernandez, M. E. and Vincek, V. (1999). Cloning and sequencing of glutamine synthetase cDNA from liver of the ureotelic gulf toadfish (Opsanus beta). Comp. Biochem. Physiol. 124B,251 -259.[CrossRef]
Walsh, P. J., Heitz, M., Campbell, C. E., Cooper, G. J., Medina, M., Wang, Y. S., Goss, G. G., Vincek, V., Wood, C. M. and Smith, C. P. (2000). Molecular identification of a urea transporter in gill of the ureotelic gulf toadfish (Opsanus beta). J. Exp. Biol. 203,2357 -2364.[Abstract]
Wang, Y. and Walsh, P. J. (2000). High ammonia tolerance in fishes of the family Batrachoididae (Toadfish and Midshipmen). Aquat Toxicol 50,205 -219.[CrossRef][Medline]
Wood, C. M., Hopkins, T. E., Hogstrand, C. and Walsh, P. J. (1995). Pulsatile urea excretion in the ureagenic toadfish Opsanus beta: an analysis of rates and routes. J. Exp. Biol. 198,1729 -1741.
Wood, C. M., Hopkins, T. E. and Walsh, P. J. (1997). Pulsatile urea excretion in the toadfish (Opsanus beta) is due to a pulsatile excretion mechanism, not a pulsatile production mechanism. J. Exp. Biol. 200,1039 -1046.[Abstract]
Wood, C. M., Gilmour, K. M., Perry, S. F., Pärt, P., Laurent, P. and Walsh, P. J. (1998). Pulsatile urea excretion in gulf toadfish (Opsanus beta): evidence for activation of a specific facilitated diffusion transport system. J. Exp. Biol. 201,805 -817.[Abstract]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
Related articles in JEB:
This article has been cited by other articles:
![]() |
A. J. Esbaugh and P. J. Walsh Identification of two glucocorticoid response elements in the promoter region of the ubiquitous isoform of glutamine synthetase in gulf toadfish, Opsanus beta Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2009; 297(4): R1075 - R1081. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Weihrauch, M. P. Wilkie, and P. J. Walsh Ammonia and urea transporters in gills of fish and aquatic crustaceans J. Exp. Biol., June 1, 2009; 212(11): 1716 - 1730. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Y. Tok, S. F. Chew, W. Y. X. Peh, A. M. Loong, W. P. Wong, and Y. K. Ip Glutamine accumulation and up-regulation of glutamine synthetase activity in the swamp eel, Monopterus albus (Zuiew), exposed to brackish water J. Exp. Biol., May 1, 2009; 212(9): 1248 - 1258. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. McDonald, B. Vulesevic, S. F. Perry, and P. J. Walsh Urea transporter and glutamine synthetase regulation and localization in gulf toadfish gill J. Exp. Biol., March 1, 2009; 212(5): 704 - 712. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Wright, S. L. Steele, A. Huitema, and N. J. Bernier Induction of four glutamine synthetase genes in brain of rainbow trout in response to elevated environmental ammonia J. Exp. Biol., August 15, 2007; 210(16): 2905 - 2911. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Buckley, A. Y. Gracey, and G. N. Somero The cellular response to heat stress in the goby Gillichthys mirabilis: a cDNA microarray and protein-level analysis J. Exp. Biol., July 15, 2006; 209(14): 2660 - 2677. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Essex-Fraser, S. L. Steele, N. J. Bernier, B. W. Murray, E. D. Stevens, and P. A. Wright Expression of Four Glutamine Synthetase Genes in the Early Stages of Development of Rainbow Trout (Oncorhynchus mykiss) in Relationship to Nitrogen Excretion J. Biol. Chem., May 27, 2005; 280(21): 20268 - 20273. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Barimo, S. L. Steele, P. A. Wright, and P. J. Walsh Dogmas and controversies in the handling of nitrogenous wastes: Ureotely and ammonia tolerance in early life stages of the gulf toadfish, Opsanus beta J. Exp. Biol., May 15, 2004; 207(12): 2011 - 2020. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. W. Murray, E. R. Busby, T. P. Mommsen, and P. A. Wright Evolution of glutamine synthetase in vertebrates: multiple glutamine synthetase genes expressed in rainbow trout (Oncorhynchus mykiss) J. Exp. Biol., May 1, 2003; 206(9): 1511 - 1521. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Phillips FISH FIND A FROG IN THE FAMILY J. Exp. Biol., May 1, 2003; 206(9): 1429 - 1430. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||