|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
MsGC-ß3 forms active homodimers and inactive heterodimers with NO-sensitive soluble guanylyl cyclase subunits
Department of Biological Structure and Function, Oregon Health and Science University, Portland, Oregon, USA
* Author for correspondence (e-mail: mortonda{at}ohsu.edu)
Accepted 20 December 2002
| Summary |
|---|
|
|
|---|
1 and
MsGC-ß1. These heterodimers, however, show no enzyme activity and, like
mammalian ß2 subunits, act in a dominant negative manner when combined
with the NO-sensitive subunits to disrupt their activation by NO. In addition,
we show that the unique C-terminal domain of MsGC-ß3 is not necessary for
enzyme activity and might act as an auto-inhibitory domain.
Key words: cGMP, guanylyl cyclase, nitric oxide, protein dimerization, tobacco hornworm, Manduca sexta
| Introduction |
|---|
|
|
|---|
1 subunit and that the degree of
NO-stimulation of the
1/ß1 heterodimer was reduced when ß2
subunits were coexpressed in the same cells
(Gupta et al., 1997
Modeling of the catalytic domain of both soluble and receptor guanylyl
cyclases, based on the crystal structure of adenylyl cyclases, suggests that
all of these enzymes need to form dimers to generate an active site to bind
the substrate, GTP (Liu et al.,
1997
; Zhang et al.,
1997
). Thus we predict that both MsGC-ß3 and mammalian
ß2 subunits should form active homodimers. In this study we demonstrate
that MsGC-ß3 does form active homodimers and also show that it is capable
of forming heterodimers with the NO-sensitive subunits, although these
heterodimers are inactive.
| Materials and methods |
|---|
|
|
|---|
Transient expression of MsGC-ß3 and guanylyl cyclase assay
The open reading frame of MsGC-ß3 in the expression vector pcDNA3.1
(Invitrogen, Carlsbad, CA, USA) was used to transiently express MsGC-ß3
in COS-7 cells as described previously
(Nighorn et al., 1999
). When
multiple guanylyl cyclases were cotransfected, the transfection efficiency was
monitored by the addition of 1 µg of a ß-galactosidase expression
plasmid (Invitrogen). ß-Galactosidase activity was determined by
incubating cell extracts with 1.3 mg ml-1
o-nitrophenyl-ß,D-galactopyranoside in a 100 mmol l-1
sodium phosphate buffer, pH 7.0, containing 1.5 mmol l-1
MgCl2 and 75 mmol l-1 ß-mercaptoethanol at room
temperature for 5-20 min. The reaction was stopped by the addition of 2 mol
l-1 Na2CO3 and the absorbance measured at 405
nm. Guanylyl cyclase activity was measured in a buffer containing 50 mmol
l-1 Mops-KOH, pH 7.5, 60 mmol l-1 KCl, 8 mmol
l-1 NaCl, 4 mmol l-1 MnCl2, 10 µmol
l-1 each of cGMP phosphodiesterase inhibitors dipyridamole and
zaprinast and 1 mmol l-1 GTP. The reaction was stopped with 0.2 mol
l-1 zinc acetate and excess GTP precipitated with 0.2 mol
l-1 Na2CO3. The amount of cGMP formed was
determined using a cGMP enzyme-linked immunoassay (EIA;
Kingan et al., 1997
). Under the
conditions used, the production of cGMP was linear with respect to time for up
to 30 min.
Production of C-terminal deletions of MsGC-ß3
Two deletions of MsGC-ß3 were generated that lacked the C-terminal 29
or 338 amino acids, MsGC-ß3
C29 and MsGC-ß3
C338,
respectively. The original cDNA for MsGC-ß3 was generated by the ligation
of two partial cDNAs, SGC4 and SGC25
(Nighorn et al., 1999
). SGC4
coded for all but the C-terminal 29 amino acids of the open reading frame and
was directly subcloned into pcDNA3.1 by excising SGC4 with XhoI and
SmaI and ligating it into pcDNA3.1 at the XhoI and
EcoRV sites to generate MsGC-ß3
C29.
MsGC-ß3
C338 was generated using polymerase chain reaction (PCR).
The 5' primer was designed to the 5' end of SGC4 and included an
XhoI site: 5'GCCTCGAGGAATGTGATATTTA, and the 3' primer
introduced a stop codon and a KpnI site immediately following residue
602 of the open reading frame of SGC4: 5'TTGGGTACCTAGGGTCTTGATT. PCR was
carried out using ElongaseTM enzyme mix (Invitrogen) for 30 cycles,
according to the manufacturer's instructions, with an annealing temperature of
50°C. The PCR product was digested with XhoI and KpnI
and ligated into pcDNA3.1.
Gel filtration
Transiently transfected COS-7 cells or Manduca abdominal nerve
cords (ANCs) were homogenized, incubated in 0.2% octyl
ß,D-thioglucopyranoside and centrifuged at 14 000 g for
30 min at 4°C. A portion (200 µl) was applied to a gel filtration
column (Bio-Sil 400-5, BioRad, Hercules, CA, USA) and eluted in 50 mmol
l-1 Tris-HCl, pH 7.5 in the presence of 0.2% octyl
ß,D-thioglucopyranoside at 0.5 ml min-1 and fractions were
collected every 0.2 min. The following standards were used to construct a
calibration curve: thyroglobulin (670 kDa), gamma globulin (158 kDa),
ovalbumin (44 kDa), myoglobulin (17 kDa) (all BioRad), apoferritin (443 kDa),
ß-amylase (200 kDa), alcohol dehydrogenase (150 kDa), bovine serum
albumin (66 kDa) and carbonic anhydrase (29 kDa) (all from Sigma, St Louis,
MO, USA).
Western blots
Western blots using antisera generated to MsGC-ß3 were carried out as
described previously (Nighorn et al.,
1999
).
Generation of tagged Manduca guanylyl cyclases
The coding regions of MsGC-
1, MsGC-ß1 and
MsGC-ß3
C338 were amplified using PCR and primers that incorporated
restriction sites at the 3' and 5' ends such that when ligated
into pcDNA3.1-His (Invitrogen), the coding sequence was in-frame with
N-terminal hexa-histidine and ExpressTM tags. The primers used were
5'ATGGTACCAATGACGTGTCCATTCC and 5'ATGGGCCCGTAAGAAGCTAAGTTG for
MsGC-
1, 5'ATGAATTCAAATGTACGGGTTTGTG and
5'ATGGGCCCTTAGAGATTTAATGGATC for MsGC-ß1 and
5'ATGAATTCCGATGTACGGCCTA and 5'ATGGGCCCTAGGGTCTTGATTCCCT for
MsGC-ß3
C338. PCR was carried out for 3 cycles at an annealing
temperature of 50°C followed by 25 cycles with an annealing temperature of
60°C, with extension times of 2 min in each case, and the products were
cloned into the TOPOII vector (Invitrogen). After being sequenced, the inserts
were excised with KpnI and ApaI for MsGC-
1 and
EcoRI and ApaI for MsGC-ß1 and MsGC-ß3
C338
and ligated into pcDNA3.1-His. COS-7 cells were transiently transfected with
each construct and western blots probed with an anti-express antibody
(Invitrogen) to confirm that each generated full-length proteins. For
heterodimerization studies two 10 cm plates were transiently contransfected
with full-length, untagged MsGC-ß3 in combination with either empty
vector, tagged MsGC-
1, tagged MsGC-ß1 or tagged
MsGC-ß3
C338. Transfected cells from the two plates were combined,
homogenized, centrifuged at 14 000 g for 30 min at 4°C and
the supernatants incubated with nickel-chelated agarose discs (Pierce,
Rockford, IL, USA) for 6h at 4°C. The agarose was washed with
phosphate-buffered saline (PBS) and bound proteins eluted with SDS-sample
buffer and analyzed by western blot. To measure the guanylyl cyclase activity
of bound proteins, the agarose was given an additional wash of 10 mmol
l-1 imidazole in PBS and the proteins eluted with 400 mmol
l-1 imidazole in PBS and assayed for activity as described
above.
Generation of point mutations in MsGC-ß3
Point mutations were introduced into the catalytic domain of MsGC-ß3
using the methods described previously
(Kunkel et al., 1987
). Briefly,
single-stranded uracil-containing MsGC-ß3 in pcDNA3.1 was generated using
CJ236 E. coli and the M13 bacteriophage. This was used as a template
for secondstrand synthesis using a phosphorylated primer that contained a
single mismatched base designed to convert E469 to lysine
(5'GTCACCTATTGTCTTCACCTTATACAC) or R537 to glutamine
(5'CGAATAGACAATACTGCGGCATCTTGA). After confirmation of the sequence, the
plasmid DNA was used to transfect COS-7 cells and assayed for guanylyl cyclase
activity as described above.
| Results |
|---|
|
|
|---|
C338 was transfected into COS-7 cells and assayed for
guanylyl cyclase activity, similar levels of activity were again detected,
compared to cells transfected with full-length MsGC-ß3, but although more
of the activity was present in the supernatant fraction, most of the activity
was still in the particulate fraction
(Table 1).
|
To determine whether the insolubility was the result of expression in a heterologous cell line, western blots were used to detect native MsGC-ß3 in pellet and supernatant fractions of nervous tissue homogenates. Surprisingly, native MsGC-ß3 was present exclusively in the soluble fraction of nervous tissue homogenates (Fig. 1), suggesting that MsGC-ß3 is not isoprenylated in vivo. In combination with the solubility data described above, these data suggest that the recombinant protein forms aggregates that are largely insoluble when expressed in COS-7 cells.
|
To determine the native molecular mass of the soluble fraction of
recombinant MsGC-ß3, COS-7 cells were transfected with either
MsGC-ß3 or MsGC-ß3
C338 and the proteins solubilized by
incubation with octyl ß,D-thioglucopyranoside. This detergent was chosen
because, in addition to being one of the more effective in solubilizing both
forms of MsGC-ß3, it also has a relatively high critical micelle
concentration of 9 mmol l-1. After centrifugation, soluble proteins
were separated by gel filtration and each fraction assayed for enzyme activity
(Fig. 2). Gel filtration of
full-length MsGC-ß3 confirmed that a large proportion of even the
solubilized protein existed as large aggregates (>1000 kDa) that eluted in
the void volume of the column. The calculated mass of monomeric MsGC-ß3
is 106 kDa (Nighorn et al.,
1999
) and the elution profile of full-length MsGC-ß3 from the
gel filtration column showed a second peak of guanylyl cyclase activity at 207
kDa, consistent with the formation of homodimers. When extracts of COS-7 cells
transfected with MsGC-ß3
C338 (calculated monomeric mass of 69 kDa)
were separated on the gel filtration column, a single peak of activity was
detected with an apparent molecular mass of 143 kDa, again consistent with the
formation of homodimers (Fig.
2).
|
To test whether native MsGC-ß3 also formed homodimers, we separated the soluble fraction of nerve cord homogenates by gel filtration using the same conditions as for recombinant MsGC-ß3 (Fig. 2). Each fraction was assayed by western blot for MsGC-ß3 immunoreactivity (IR). The profile of MsGC-ß3-IR showed two peaks, the first eluted with the void volume, presumably reflecting the formation of large aggregates, and the second eluted with an apparent mass of about 220 kDa, consistent with the formation of homodimers. Thus, in the presence of detergent, both native and recombinant MsGC-ß3 elute at a position consistent with the formation of homodimers, and in addition appear to form large aggregates.
Coexpression of MsGC-ß3 with MsGC-
1 and MsGC-ß1
reduces NO-stimulated activity
Previous studies demonstrated that MsGC-ß3 did not form NO-sensitive
heterodimers with either of the Manduca NO-sensitive guanylyl cyclase
subunits, MsGC-
1 or MsGC-ß1
(Nighorn et al., 1999
). These
data did not, however, indicate whether heterodimers were formed or had any
basal enzyme activity. The mammalian ß2 subunit acts in a dominant
negative manner, forming heterodimers with the mammalian
1 subunit that
are less sensitive to NO than the
1/ß1 combination
(Gupta et al., 1997
). To
determine whether MsGC-ß3 behaved in a similar manner, we cotransfected
COS-7 cells with all three subunits: MsGC-
1, MsGC-ß1 and
MsGC-ß3 (Table 2). Coexpression with MsGC-ß3 substantially reduced the NO activation of
MsGC-
1/MsGC-ß1. When the amount of MsGC-ß3 was doubled, the
activation by NO was further reduced. These data suggested that MsGC-ß3
was capable of forming heterodimers with either MsGC-
1 or MsGC-ß1
and that these heterodimers were NO-insensitive and were either catalytically
inactive or exhibited substantially reduced levels of activity.
|
MsGC-ß3 forms inactive dimers with tagged MsGC-
1 and
tagged MsGC-ß1
To determine directly whether MsGC-ß3 was capable of forming
heterodimers with either MsGC-
1 or MsGC-ß1 we generated
hexa-histidine tagged versions of all three guanylyl cyclases. We used
MsGC-ß3
C338 rather than a tagged full-length version of
MsGC-ß3, because the MsGC-ß3 antisera recognized an epitope in the
C-terminal domain (D. B. Morton, unpublished data) and hence could be used to
distinguish between the tagged and untagged versions. COS-7 cells were
cotransfected with each of the tagged guanylyl cyclases in combination with
full-length untagged MsGC-ß3, the extracts incubated with nickel-chelated
agarose and the proteins bound to the beads analyzed by western blot. Probing
the blot with MsGC-ß3 antisera (Fig.
3A) showed that each of the tagged guanylyl cyclases was capable
of binding to and pulling down MsGC-ß3 from solution. Somewhat lower
levels of MsGC-ß3 were detected with either tagged MsGC-
1 or
MsGC-ß1 compared to tagged MsGC-ß3, although the levels of
MsGC-ß3 in each extract were similar
(Fig. 3B). It is not known,
however, whether the lower levels of MsGC-ß3 pelleted with either
MsGC-
1 or MsGC-ß1 reflect a difference in affinity of MsGC-ß3
for forming homodimers compared to heterodimers.
|
These data show that both MsGC-
1 and MsGC-ß1 are capable of
forming heterodimers with MsGC-ß3. To determine if these heterodimers
exhibited any guanylyl cyclase activity, we eluted the bound proteins from the
beads with 400 mmol l-1 imidazole and assayed the eluate for
guanylyl cyclase activity. Very low levels of enzyme activity were measured
(less than 1% of the input levels) and subsequent experiments showed that 400
mmol l-1 imidazole inhibited the guanylyl cyclase activity by
70-80% (data not shown).
Site-directed mutagenesis confirms that the heterodimers are
inactive
An alternative approach to determine whether heterodimers form active
enzymes is to use site-directed mutagenesis to eliminate the activity
generated by MsGC-ß3 homodimers so that any activity present when
MsGC-ß3 is coexpressed with either MsGC-
1 or MsGC-ß1 will be
from heterodimers. Solving the crystal structure of the catalytic domain of
adenylyl cyclase followed by homology modeling of the catalytic domain of
guanylyl cyclases enabled the critical residues that bind GTP to be predicted
(Liu et al., 1997
;
Zhang et al., 1997
). This
modeling predicts that homodimeric receptor guanylyl cyclases have two
GTP-binding sites, whereas heterodimeric
1/ß1 guanylyl cyclases
have a single GTP-binding site, with the
subunit providing some of the
critical residues and the remainder provided by the ß subunit
(Liu et al., 1997
).
MsGC-ß3, like the receptor guanylyl cyclases, has all of the critical
residues necessary for binding GTP (Morton
and Hudson, 2002
; Fig.
4) and hence MsGC-ß3 homodimers should form two GTP-binding
sites. When MsGC-ß3 forms a heterodimer with MsGC-
1 it is possible
that a single active GTP-binding site is formed with MsGC-
1 acting as
the
chain and MsGC-ß3 acting as the ß chain. Conversely,
MsGC-ß3 could act as the
chain in heterodimers formed with
MsGC-ß1, again potentially forming a single active GTP-binding site. When
MsGC-ß3 is coexpressed with either MsGC-
1 or MsGC-ß1 it is
difficult to determine the contribution of the heterodimers to the total
guanylyl cyclase activity because they are dominated by MsGC-ß3
homodimers. This is especially true if MsGC-ß3 has a lower affinity for
MsGC-
1 and MsGC-ß1 as was suggested by the data shown in
Fig. 3A. A series of deletion
mutants have been made in mammalian
1 and ß1 subunits, which
demonstrate that particularly critical residues are R592 in the
1
subunit and E473 in the ß1 subunit
(Beuve, 1999
).
1R592Q/ß1 and
1/ß1E473K were both inactive
(Beuve, 1999
). If these
predictions extend to MsGC-ß3, then single mutations at each site will
yield inactive homodimers but active heterodimers when expressed with
wild-type MsGC-ß3. To test this, we generated two mutants:
MsGC-ß3E469K and MsGC-ß3R537Q, which have the equivalent mutations
to ß1E473K and
1R592Q respectively
(Fig. 4).
|
Fig. 5 shows that these predictions are correct. COS-7 cells transfected only with MsGC-ß3E469K had no guanylyl cyclase activity, whereas cells cotransfected with wild-type MsGC-ß3 and MsGC-ß3E469K had a similar or greater level of activity than cells transfected only with wild-type MsGC-ß3 (Fig. 5A). In these experiments the total amount of plasmid was kept constant and densitometry of western blots showed that there was no significant difference in the total amount of MsGC-ß3-IR when MsGC-ß3E469K was cotransfected with MsGC-ß3 (Fig. 5C). The other point mutation gave slightly different results (Fig. 5). Firstly, and similarly, COS-7 cells expressing only MsGC-ß3R537Q had no guanylyl cyclase activity, demonstrating that R537 is critical for enzyme activity. The level of activity when MsGC-ß3R537Q and wild-type MsGC-ß3 were cotransfected was always less than cells that only expressed wild-type MsGC-ß3. Averaging three separate experiments the level of activity from cells expressing both MsGC-ß3R537Q and wild-type MsGC-ß3 was 78±12% of the activity from cells expressing only wild-type MsGC-ß3. To demonstrate that the level of activity was proportional to the amount of plasmid transfected, we also transfected cells with 5 µg of MsGC-ß3 plasmid and 5 µg of empty pcDNA3.1 vector. In these experiments, the level of activity was approximately half (44.3±2.9%) that seen when 10 µg of MsGC-ß3 was used.
|
Because MsGC-ß3 can potentially act as both the
and ß
strands, we predicted that if MsGC-ß3 forms active heterodimers with
either MsGC-
1 or MsGC-ß1 then a single functional GTP-binding site
should be formed between MsGC-ß3E469K (eliminating the ß strand
function) and MsGC-ß1, but not with MsGC-
1. Similarly, a single
GTP-binding site will be formed in heterodimers between MsGC-ß3R537Q
(eliminating the
strand function) and MsGC-
1 but not with
MsGC-ß1. Because both mutants form inactive enzymes when expressed alone
it follows that when either is coexpressed with either MsGC-
1 or
MsGC-ß1 (which also are inactive when expressed alone), any activity that
is detected will come from the heterodimers. The results from these
experiments are also shown in Fig.
5A. No activity is seen with any of these combinations,
demonstrating that neither mutant forms active heterodimers with either
MsGC-
1 or MsGC-ß1.
Two additional controls were performed to confirm that each mutant was
capable of forming dimers. The first control tested that each mutant only
affected one of the GTP binding sites. This was accomplished by cotransfecting
each of the mutants together. Both mutants should each affect the same GTP
binding site, leaving the other unaffected, and hence generate an active
enzyme. The results of this experiment show that the
MsGC-ß3E469K/MsGC-ß3R537Q heterodimer was active
(Fig. 5B). Interestingly, when
the two mutants were expressed together, there was substantially more enzyme
activity than when an equivalent amount of wild-type MsGC-ß3 plasmid was
transfected alone. The second control was to test that each mutant was capable
of forming heterodimers with the NO-sensitive subunits. The lack of activity
when the mutants were coexpressed with either MsGC-
1 or MsGC-ß1
could have been because the mutated residues were critical for dimer
formation. If inactive heterodimers were formed we predicted that each mutant
would act like a dominant negative when coexpressed with both NO-sensitive
subunits together. This experiment is shown in
Fig. 5D and demonstrates that
each mutant reduced both the basal and the NO-stimulated guanylyl cyclase
activity, confirming that inactive heterodimers were formed.
Enzyme properties of MsGC-ß3
C338 compared to
MsGC-ß3
The results from the C-terminal domain deletion experiments demonstrated
that this region of MsGC-ß3 was not necessary for enzyme activity
(Table 1). Studies on the
mammalian ß2 subunit, however, have shown that residues within the
C-terminal domain affect the enzymatic properties of the ß2 subunit,
rendering it active in the presence of magnesium ions, whereas the wild-type
enzyme was only active in the presence of manganese ions
(Koglin et al., 2001
). To
determine whether the C-terminal domain of MsGC-ß3 also affected the
relative sensitivities of the enzyme to magnesium and manganese, we measured
the activity of MsGC-ß3 and MsGC-ß3
338 in the presence of
both of these cations and in the presence of different concentrations of GTP.
These results are shown in Fig.
6. In the first report describing the properties of MsGC-ß3
(Nighorn et al., 1999
), we
used a radio-enzyme assay for guanylyl cyclase activity and failed to detect
any activity for MsGC-ß3 in the presence of magnesium, whereas
Fig. 6A shows that using a more
sensitive EIA detection method we could clearly detect guanylyl cyclase
activity in the presence of 4 mmol l-1 MgCl2.
Interestingly, for a variety of GTP concentrations, we consistently measured
higher levels of activity for MsGC-ß3
C338 in the presence of
magnesium, whereas no difference was detected in the presence of manganese.
Using this data we calculated the values for Km and
Vmax, shown in Table
3. In the presence of manganese the activities of MsGC-ß3 and
MsGC-ß3
C338 were indistinguishable and yielded similar values for
Km and Vmax. By contrast, in the
presence of magnesium, MsGC-ß3
C338 yielded a significantly lower
Km although the calculated value for
Vmax was statistically indistinguishable. The linearity of
double-reciprocal plots (Fig.
6B,D) and calculations of the Hill coefficients
(Table 3) demonstrated that
neither enzyme showed cooperativity with respect to GTP. In a separate
experiment we also analyzed the influence of GTP concentration on the activity
of MsGC-ß3
C29 in the presence of magnesium. The resulting values
of Km and Vmax are also shown in
Table 3 and showed that
deletion of the C-terminal 29 residues was sufficient to reduce the
Km for GTP.
|
|
| Discussion |
|---|
|
|
|---|
MsGC-ß3 was the first soluble guanylyl cyclase identified that was
active in the absence of additional subunits. A recent report has shown that
the rat ß2 subunit is similarly active in the absence of additional
subunits (Koglin et al., 2001
).
Analysis of the residues predicted to form the active site show that, like
MsGC-ß3 and receptor guanylyl cyclases, mammalian ß2 subunits have
all the residues necessary to form the catalytic site without the need for
additional subunits (Fig. 4)
and are all predicted to have two GTP binding sites. Initial reports on the
activity of mammalian ß2 subunits suggested that they only formed active
heterodimers with mammalian
subunits
(Gupta et al., 1997
), although
subsequent studies failed to reproduce this data (e.g.
Denninger and Marletta, 1999
).
A more recent study (Koglin et al.,
2001
), in combination with data from MsGC-ß3, appear to place
both guanylyl cyclases in a new group of homodimeric soluble guanylyl cyclases
(Morton and Hudson, 2002
). A
major difference, however, between MsGC-ß3 and the mammalian ß2
subunits is that the insect guanylyl cyclase is NO-insensitive whereas rat
ß2 is weakly stimulated by NO (Koglin
et al., 2001
).
Another similarity between the Manduca and rat homodimeric
guanylyl cyclases is their low level of activity in the presence of magnesium
compared to manganese. Although our initial report describing MsGC-ß3
failed to detect any activity in the presence of magnesium, the present study,
using a more sensitive assay system, clearly showed that the enzyme is active
in the presence of magnesium. Furthermore, kinetic analysis showed that the
Km for GTP in the presence of magnesium is 20-fold higher
than in the presence of manganese. Wild-type rat ß2 subunits showed no
detectable enzyme activity in the presence of magnesium. Mutating a single
cysteine residue in the C-terminal isoprenylation sequence (CVVL), however,
yielded an enzyme that did show significant activity in the presence of
magnesium (Koglin et al.,
2001
). Interestingly, our data also revealed that alterations in
the C terminus affected the Km in the presence of
magnesium. Removal of either the C-terminal 338 or 29 residues significantly
reduced the calculated value of the Km. MsGC-ß3 also
terminates in a consensus isoprenylation sequence (CRLI), although our data
showed that the native protein was found in the soluble fraction of nerve cord
extracts, suggesting that it is not modified in vivo. It would be
interesting to determine whether mutating the equivalent cysteine residue also
affects the Km of MsGC-ß3. It is also interesting to
note the similarities in the values of Km for the insect
and rat enzymes. In the presence of 4 mmol l-1 manganese, rat
ß2 has a Km of 0.375 mmol l-1 when
unstimulated and 0.136 mmol l-1 when stimulated with NO
(Koglin et al., 2001
), which is
very similar to the value we obtain for MsGC-ß3 of 0.13 mmol
l-1.
The finding that removal of the C-terminal domain of MsGC-ß3 reduced
the Km for GTP in the presence of magnesium but not in the
presence of manganese suggests a role for this novel domain. Receptor guanylyl
cyclases and NO-sensitive guanylyl cyclases show basal levels of activity in
the presence of magnesium that are fully sensitive to their respective
activators (peptide ligands, GCAPs or NO)
(Lucas et al., 2000
). In the
presence of manganese, however, these guanylyl cyclases all exhibit maximal
levels of catalytic activity that are insensitive to further stimulation
(Lucas et al., 2000
).
Full-length MsGC-ß3 has a higher Km in the presence
of magnesium compared to manganese, whereas the value of
Km of MsGC-ß3
C338 is similar in the presence
of either cation. This suggests that the C-terminal domain acts as an
auto-inhibitory domain in the presence of magnesium, but in the presence of
manganese it has no effect. It is not known how MsGC-ß3 is activated
in vivo, but an intriguing possibility is that removal of the
C-terminal domain mimics this activation process, yielding a fully active
guanylyl cyclase that is also produced when MsGC-ß3 functions in the
presence of manganese.
Both MsGC-ß3 and rat ß2 also appear to interact with the
NO-sensitive heterodimeric subunits. Coexpression of all three rat subunits
(
1, ß1 and ß2) showed that with increasing amounts of the
ß2 subunit the NO stimulation of the resulting mixture was reduced
(Gupta et al., 1997
). This
suggested that heterodimers between the ß2 and either
1 or ß1
were formed and that these were less sensitive to NO than the
1/ß1
heterodimers. MsGC-ß3 behaved in the same manner: increasing the amount
of MsGC-ß3 coexpressed with MsGC-
1 and MsGC-ß1 reduced the NO
stimulation (Table 2). By using
tagged subunits we were also able to directly demonstrate that MsGC-ß3
formed heterodimers with both MsGC-
1 and MsGC-ß1.
In addition, coexpression of MsGC-
1 and MsGC-ß1 with each of
the two point mutations of MsGC-ß3 demonstrated that the heterodimers
formed between MsGC-ß3 and MsGC-
1 and MsGC-ß1 were inactive.
The design of this experiment assumed that MsGC-ß3 formed two GTP-binding
sites homologous to the two sites predicted for vertebrate homodimeric
receptor guanylyl cyclases (Liu et al.,
1997
). The generation of an active enzyme when the two mutants
were coexpressed appears to confirm that there are two GTP-binding sites.
Neither of the mutants formed an active enzyme when coexpressed with either
MsGC-
1 or MsGC-ß1. The conclusion that heterodimers between
MsGC-ß3 and MsGC-
1 or MsGC-ß1 are inactive depends on
demonstrating that each mutant is capable of forming an active heterodimer
with wild-type MsGC-ß3. The MsGC-ß3E469K mutant was clearly active
as a heterodimer with wild-type MsGC-ß3, as the level of activity when
both plasmids were cotransfected was similar or greater than the level of
activity when wild-type MsGC-ß3 was transfected alone, even though only
half the amount of wild-type MsGC-ß3 plasmid was used. By contrast,
coexpression of MsGC-ß3R537Q with wild-type MsGC-ß3 always yielded
lower levels of activity (78%) compared to the activity measured when
wild-type MsGC-ß3 was expressed alone. A 1:1 ratio of wild-type:mutant
should yield a mixture of wild-type homodimers, heterodimers and mutant
homodimers in a ratio of 1:2:1. If the heterodimers have half the specific
activity of wild-type homodimers (because they have a single active site
compared to two), the total level of guanylyl cyclase activity would be half
that measured when wild-type MsGC-ß3 was expressed alone, if the total
amount of plasmid was equal. By contrast, if the heterodimers were inactive,
then the activity of the mixture should be 25% of the activity when only
wild-type MsGC-ß3 is expressed. Thus, the MsGC-ß3R537Q mutant also
appears to form active heterodimers with wild-type MsGC-ß3.
An alternative model is that although there are two potential GTP-binding
sites only one can be filled at a time possibly because they are too
close to each other to allow the simultaneous binding of two GTP molecules. If
this were the case, then mutating one of the binding sites would have no
effect on the specific activity of the heterodimer (or only a minimal effect),
as it would still bind a single GTP molecule. A 1:1 mixture of
mutant:wild-type MsGC-ß3 would then be about 75% as active as wild-type
MsGC-ß3 alone. This is closer to the situation seen with the two point
mutations. Our kinetic analysis of MsGC-ß3 reveals a Hill coefficient of
1.0, i.e. that there is no cooperativity with respect to GTP, which is
consistent with a single GTP molecule binding per dimer. The rat ß2
subunit also shows linear MichaelisMenten kinetics in the presence of
manganese (Koglin et al.,
2001
). These findings contrast the situation with the homodimeric
receptor GC, GC-A, which shows positive cooperativity with respect to GTP in
the presence of manganese (Wong et al.,
1995
). Thus, although the data strongly support our hypothesis
that both mutant/wild-type MsGC-ß3 heterodimers are active, our results
suggest a possible different model for the catalytic site of this homodimeric
guanylyl cyclase. Interestingly, when the two mutant MsGC-ß3 subunits
were expressed together, substantially higher levels of guanylyl cyclase
activity were measured compared to an equivalent amount of wild-type
MsGC-ß3. This suggests that eliminating one of the GTP binding sites
removes a constraint of GTP binding, yielding a more active enzyme. Although
these equivalent mutations have been made in the homodimeric receptor guanylyl
cyclase, RetGC-1 (Tucker et al.,
1998
), each mutant was only expressed individually (each was
inactive). It would be interesting to determine the total level of guanylyl
cyclase activity if these mutations were coexpressed together or with
wild-type RetGC-1, and compare the results with those we have obtained for
MsGC-ß3.
Overall, our data demonstrate that although MsGC-ß3 can form
heterodimers with both MsGC-
1 and MsGC-ß1, these heterodimers are
catalytically inactive. These results are somewhat surprising, as both
heterodimers should have all the residues necessary to form at least one
GTP-binding site. This suggests that although heterodimers are formed, they do
not fold together correctly to form an active catalytic site. A complementary
series of studies showed that human
1 and ß1 subunits were each
capable of forming homodimers and that they were inactive
(Zabel et al., 1999
). When the
1 and ß1 subunits were coexpressed, homodimers were still formed,
but not as readily as heterodimers (Zabel
et al., 1999
). We do not know the relative affinities of
MsGC-ß3 for the formation of homodimers compared to heterodimers with
MsGC-
1 or MsGC-ß1. Thus these studies seem to suggest a general
property of all soluble guanylyl cyclase subunits; they can dimerize with any
other subunit but are only active as dimers with their appropriate subunit.
Specificity could be generated either by different relative affinities or by
cell-specific expression patterns. It is not known whether MsGC-ß3 is
ever coexpressed with either of the NO-sensitive subunits, but it has been
suggested that in the kidney, mammalian
1, ß1 and ß2 are
coexpressed and their relative levels can contribute to alterations in renal
NO sensitivity (Gupta et al.,
1997
).
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Beuve, A. (1999). Conversion of a guanylyl cyclase to an adenylyl cyclase. Methods 19,545 -550.[CrossRef][Medline]
Denninger, J. W. and Marletta, M. A. (1999). Guanylate cyclase and the NO/cGMP signaling pathway. Biochim. Biophys. Acta 1411,334 -350.[Medline]
Gupta, G., Azam, M., Yang, L. and Danziger, R. S.
(1997). The ß2 subunit inhibits stimulation of the
1/ß1 form of soluble guanylyl cyclase by nitric oxide. Potential
relevance to regulation of blood pressure. J. Clin.
Invest. 100,1488
-1492.[Medline]
Kingan, T. G., Gray, W., Zitnan, D. and Adams, M. E. (1997). Regulation of ecdysis-triggering hormone release by eclosion hormone. J. Exp. Biol. 200,3245 -3256.[Abstract]
Koglin, M., Vehse, K., Budaeus, L., Scholz, H. and Behrends,
S. (2001). Nitric oxide activates the ß2 subunit of
soluble guanylyl cyclase in the absence of a second subunit. J.
Biol. Chem. 276,30737
-30743.
Kunkel, T. A., Roberts, J. D. and Zakour, R. A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 154,367 -382.[Medline]
Liu, Y., Ruoho, A. E., Rao, V. D. and Hurley, J. H.
(1997). Catalytic mechanism of the adenylyl and guanylyl
cyclases: modeling and mutational analysis. Proc. Natl. Acad. Sci.
USA 94,13414
-13419.
Lucas, K. A., Pitari, G. M., Kazerounian, S., Ruiz-Stewart, I.,
Park, J., Schulz, S., Chepenik, K. P. and Waldman, S. A.
(2000). Guanylyl cyclases and signaling by cyclic GMP.
Pharmacol. Rev. 52,375
-413.
Morton, D. B. and Giunta, M. A. (1992). Eclosion hormone stimulates cGMP levels in Manduca sexta nervous tissue via arachidonic acid metabolism with little or no contribution from the production of nitric oxide. J. Neurochem. 59,1522 -1530.[Medline]
Morton, D. B. and Hudson, M. L. (2002). Cyclic GMP regulation and function in insects. Adv. Insect Physiol. 29,1 -54.
Nighorn, A., Byrnes, K. A. and Morton, D. B.
(1999). Identification and characterization of a novel beta
subunit of soluble guanylyl cyclase that is active in the absence of
additional subunits and relatively insensitive to nitric oxide. J.
Biol. Chem. 274,2525
-2531.
Tucker, C. L., Hurley, J. H., Miller, T. R. and Hurley, J.
B. (1998). Two amino acid substitutions convert a guanylyl
cyclase, RetGC-1, into an adenylyl cyclase. Proc. Natl. Acad. Sci.
USA 95,5993
-5997.
Wong, S. K.-F., Ma, C.-P., Foster, D. C., Chen, A.-Y. and
Garbers, D. L. (1995). The guanylyl cyclase-A receptor
transduces an atrial natriuretic peptide/ATP activation signal in the absence
of other proteins. J. Biol. Chem.
270,30818
-30822.
Zabel, U., Häusler, C., Weeger, M. and Schmidt, H. H. H.
W. (1999). Homodimerization of soluble guanylyl cyclase
subunits: dimerization analysis using glutathione S-transferase affinity tag.
J. Biol. Chem. 274,18149
-18152.
Zhang, G., Liu, Y., Ruoho, A. E. and Hurley, J. H. (1997). Structure of the adenylyl cyclase catalytic core. Nature 386,247 -253.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
X. Ma, N. Sayed, P. Baskaran, A. Beuve, and F. van den Akker PAS-mediated Dimerization of Soluble Guanylyl Cyclase Revealed by Signal Transduction Histidine Kinase Domain Crystal Structure J. Biol. Chem., January 11, 2008; 283(2): 1167 - 1178. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Langlais, J. A. Stewart, and D. B. Morton Preliminary characterization of two atypical soluble guanylyl cyclases in the central and peripheral nervous system of Drosophila melanogaster J. Exp. Biol., June 1, 2004; 207(13): 2323 - 2338. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Choi NO SIGNAL FOR MOTH'S LIFESTYLE CHANGE J. Exp. Biol., March 15, 2003; 206(6): 933 - 934. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||