|
| ![]() |
|
||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
norpA and itpr mutants reveal roles for phospholipase C and inositol (1,4,5)- trisphosphate receptor in Drosophila melanogaster renal function
1 Institute of Biomedical and Life Sciences, Division of Molecular Genetics,
University of Glasgow, Glasgow G11 6NU, UK
2 Department of Physiology and Pharmacology, Strathclyde Institute for
Biomedical Sciences, University of Strathclyde, Glasgow G4 ONR, UK
3 National Centre for Biological Sciences, UAS-GKVK Campus, Bangalore
560065, India
* Author for correspondence (e-mail: s.a.davies{at}bio.gla.ac.uk)
Accepted 2 December 2002
| Summary |
|---|
|
|
|---|
In itpr hypomorphs, basal IP3 levels are lower, although CAP2b-stimulated IP3 levels are not significantly reduced compared with wild type. However, CAP2b-stimulated fluid transport is significantly reduced in itpr alleles. Rescue of the itpr90B.0 allele with wild-type itpr restores CAP2b-stimulated fluid transport levels to wild type. Drosokinin-stimulated fluid transport is also reduced in homozygous and heteroallelic itpr mutants.
Measurements of cytosolic calcium levels in intact tubules of wild-type and itpr mutants using targeted expression of the calcium reporter, aequorin, show that mutations in itpr attenuated both CAP2b- and Drosokinin-stimulated calcium responses. The reductions in calcium signals are associated with corresponding reductions in fluid transport rates.
Thus, we describe a role for norpA and itpr in renal epithelia and show that both CAP2b and Drosokinin are PLCß-dependent, IP3-mobilising neuropeptides in Drosophila. IP3R contributes to the calcium signalling cascades initiated by these peptides in both principal and stellate cells.
Key words: CAP2b, leucokinin, photoreception, TRP, TRPL, Drosokinin, Drosophila, inositol (1,4,5)-trisphosphate receptor (IP3R), itpr, norpA
| Introduction |
|---|
|
|
|---|
The processes of calcium signalling in vivo have been intensely
investigated in Drosophila phototransduction, where novel calcium
channels and associated signalling proteins have been discovered in forward
genetic screens (Hardie and Raghu,
2001
). Importantly, studies in Drosophila have
subsequently revealed vertebrate and human homologues of such signalling
complexes (Harteneck et al.,
2000
). Light-driven phototransduction has been shown to be
PLC-dependent; as such, most studies of PLC function in vivo in
Drosophila have utilised the photoreceptor model. Two genes encode
PLCß in Drosophila: norpA and Plc21C. Mutants
in norpA severely reduce phototransduction
(Pak et al., 1970
). Molecular
cloning of the gene, together with biochemical analyses of PLC activity in the
eye of norpA mutants showed that norpA encodes a
retinal-specific PLC similar to bovine brain PLC
(Bloomquist et al., 1988
). By
contrast, Plc21C is more generally expressed, with a 7 kb transcript
in the eye and central nervous system (CNS) and a 5.6 kb transcript in heads
and bodies (Shortridge et al.,
1991
).
Mutagenic analysis of the IP3R has also been informative in
insects. In Drosophila, a single gene, itpr-83, encodes
IP3R (Hasan and Rosbash,
1992
; Yoshikawa et al.,
1992
). Drosophila IP3R has most similarity to
type I IP3R in vertebrates. Embryonic expression of itpr
has been documented, and a delayed-development phenotype has been identified
in mutants (Venkatesh and Hasan,
1997
). In the adult, expression has been shown in photoreceptors,
brain and antennae, with expression also documented in the eye, which suggests
a role for IP3R in chemosensation and in visual processes. However,
in spite of the documented role of PLC in the eye, recent work has shown that
IP3 signalling is unnecessary for phototransduction to occur
(Hardie and Raghu, 1998
;
Venkatesh and Hasan,
1997
).
While norpA and itpr have been assigned neural roles
indeed, norpA is generally considered to be visual system
specific it is likely that much more general roles for these genes
exist but have yet to be documented due to lack of an informative
physiological phenotype. The Drosophila Malpighian tubule is an ideal
genetic model for transporting epithelia and provides a robust phenotype for
the integrative physiology of cell signalling and transport genes
(Dow and Davies, 2001
).
Previous work has established that ion transport and cell signalling process
are compartmentalised into different tubule cell subtypes: the principal and
stellate cells (Dow and Davies,
2001
). Furthermore, direct measurements of cell-specific
intracellular calcium signalling mechanisms using targeted aequorin show a
direct modulation of fluid transport by agents that mobilise intracellular
calcium (O'Donnell et al.,
1998
; Rosay et al.,
1997
; Terhzaz et al.,
1999
; MacPherson et al.,
2001
). The Drosophila neurohormones capa-1 (a member of
the CAP2b family; Kean et al.,
2002
) and Drosophila leucokinin (Drosokinin;
Terhzaz et al., 1999
) have
been shown to stimulate fluid transport rates, which are associated with
increases in cytoplasmic calcium concentration in principal and stellate
cells, respectively, in tubule main segment. The CAP2b response is
dependent on extracellular calcium (Rosay
et al., 1997
); furthermore, it has been recently demonstrated that
TRP/TRPL (transient receptor potential/TRP-like) and L-type calcium channels
play a role in this response (MacPherson et al.,
2000
,
2001
). However, the relative
contribution of intracellular calcium stores to these neurohormone-induced
responses is still unclear. Use of the ER Ca2+-ATPase inhibitor
thapsigargin in the presence of extracellular calcium results in elevation of
intracellular calcium levels in both principal and stellate cells and
increased fluid transport rates (Rosay et
al., 1997
). However, in the absence of extracellular calcium the
response is abolished in principal cells but remains in stellate cells. Thus,
it appears that the contribution of ER calcium stores, and thus of calcium
signalling via IP3R to capacitative calcium entry in
tubule cells, is cell-type specific. Alternatively, the putative
thapsigargin-sensitive pool in principal cells is very small and is emptied
too rapidly to monitor. It is thus of interest to try to dissect the different
contributions of calcium signalling genes in the context of principal and
stellate cell function.
In this study, we show that mutations in norpA reduce stimulation of fluid transport by both CAP2b and Drosokinin. Furthermore, CAP2b and Drosokinin both elevate IP3 levels. Thus, PLCß and IP3 are involved in stimulated fluid transport; we have thus utilised itpr mutants to define the contribution of IP3R to neurohormone-mediated increases in epithelial fluid transport. Genetic blockade of IP3R function results in inhibition of neuropeptide-fluid transport rates associated with either CAP2b or Drosokinin. In itpr mutants, downregulation of fluid transport is associated with reductions in neuropeptide-stimulated intracellular calcium levels. Thus, PLCß-mediated IP3 signalling plays a functional role in calcium signalling and epithelial fluid transport in Drosophila, confirming that the important norpA and itpr genes are not neural specific.
| Materials and methods |
|---|
|
|
|---|
Drosophila stocks
Drosophila melanogaster (Meigen) were maintained on a 12h: 12h L:D
cycle on standard cornmealyeastagar medium at 25°C. Oregon R
(OrR) wild-type flies used were those described previously
(Dow et al., 1994
). Mutant
lines of norpA (Bloomquist et al.,
1988
; Pearn et al.,
1996
) and itpr
(Venkatesh and Hasan, 1997
)
have been described previously. itpr lines were used as out-crossed
lines to OrR to rule out the effects of balancer chromosomes on the tubule
phenotype. Multiple alleles were utilised in this study in order to control
for any effects of genetic background in individual lines. Choice of alleles
was based on the health of the lines. Lines used were as follows:
norpAH52/norpAH52 (temperature-sensitive
allele); norpAP24/norpAP24 (kind gifts of R. C.
Hardie, University of Cambridge); itprXR12/+ (X-ray
inversion); itpr90B.0/+, itpr1664/+,
itpr1664/itprXR12,
itpr1664/itpr90B.0 and
itpr1664/itpr1664 (P-element insertions);
itprWC361/itprUG3 (EMS alleles). itpr
lines were slow-growing due to eclosion defects
(Venkatesh and Hasan, 1997
).
Additionally, the following lines were also utilised:
hsGAL4;itpr90B.0 and UAS-itpr
(Venkatesh et al., 2001
).
Temperature-sensitive (ts) and hsGAL4 lines were heat-shocked at
37°C for 30 min and left to recover at 23°C before
experimentation.
To produce flies in which tubule calcium measurements could be made using
the calcium reporter aequorin (Rosay et
al., 1997
; Terhzaz et al.,
1999
), it was necessary to generate itpr lines in an
aequorin background under control of an hsGAL4 promoter. These were based on
an X-chromosome insertion of UAS-aeq, and an hsGAL4 construct on chromosome 2,
leaving chromosome 3 free for itpr alleles. The following lines were
generated and utilised for this study:
aeq;hsGAL4;itprXR12/+,
aeq;hsGAL4;itpr90B.0/+,
aeq;hsGAL4;itpr1664/+,
aeq;hsGAL4;itpr1664/itpr1664 and
aeq;hsGAL4;itprWC361/itprUG3. Extremely poor
viability of the itpr1664/itprXR12 and
itpr1664/itpr90B.0 heteroallelics in the
aequorin background did not allow use of these lines for calcium measurements.
Verification of aequorin expression was achieved at several stages of the
crossing procedure by measuring total light output by dissected, intact
tubules after lysis in Triton/CaCl2 as described below. The
presence of the appropriate itpr allele was verified in progeny of
aeq;itpr flies by RT-PCR. Maintenance of the itpr phenotype
was assessed by fluid transport assays in the presence of either
CAP2b or Drosokinin.
Transport (fluid secretion) assays
Flies were cooled on ice and then decapitated prior to isolation of whole
tubules. Malpighian tubules were isolated into 10 µl drops of a 1:1 mixture
of Schneider's medium and Drosophila saline (NaCl, 117.5
mmoll-1; KCl, 20 mmoll-1; CaCl2, 2
mmoll-1; MgCl2, 8.5 mmoll-1;
NaHCO3, 10.2 mmoll-1; NaH2PO4, 4.3
mmoll-1; Hepes, 15 mmoll-1; glucose 20
mmoll-1) under liquid paraffin, and fluid secretion rates were
measured as described previously (Dow et
al., 1994
) under the different conditions described in the text.
CAP2b and Drosokinin were added as solutions in assay medium at 30
min.
Heterologous expression of the Drosokinin receptor
The recently characterised Drosokinin receptor
(Radford et al., 2002
) was
used to assay Drosokinin-stimulated IP3 production. In order to
transfect S2 cells with Drosokinin receptor, the protocol described below was
adopted.
Expression constructs
Primers were designed for the Drosokinin receptor (CG1062;
Radford et al., 2002
) to allow
amplification from the start to the stop codon of the coding sequence. Forward
primers were designed to include a 5' Kozak translational initiation
sequence (G/ANNATGG). Amplification was carried out
with EXPAND High Fidelity Polymerase (Roche Diagnostics Ltd, Lewes, UK)
according to manufacturers instructions. Forward (GACATGGACTTAATCGAGCAGGAG)
and reverse (TTAAAGTGGTTGCCACAAGGAC) primers were used to generate a fragment
of 1626bp. OrR cDNA was used as template. The PCR product was purified by gel
extraction and directly cloned into the pMT-V5/His TOPO TA inducible
expression vector (Invitrogen). The construct was verified by restriction
enzyme digestion and sequencing to ensure that no mutations had been induced
during cloning.
S2 cell culture
S2 cells were maintained in DES (Drosophila expression system)
medium (Invitrogen) supplemented with 10% heat-inactivated foetal calf serum
(FCS; Invitrogen). Cells were grown in suspension at an initial density of
2-4x106 cells ml-1 at 23°C. S2 cells were
transiently transfected at a density of 1x106 cells
ml-1 using calcium phosphate (Invitrogen), according to
manufacturer's instructions. Cells were transfected with 20µg of the
Drosokinin receptor expression construct and were used 24h post-induction of
the metallothionein promoter with Cu2+ ions.
Mass measurement of inositol (1,4,5)-trisphosphate (IP3)
levels
IP3 levels in tubules were measured by a quantitative
radioligand-binding assay as described elsewhere
(Palmer et al., 1989
) using an
IP3-binding protein preparation derived from bovine adrenal
gland.
Tubule preparations
Tubules (20 per sample) were dissected from wild-type and itpr
mutants into 9µl of Schneider's medium. Samples were stimulated with
CAP2b (10-7 moll-1) for 0 s (control), 2 s or
5 s in a final sample volume of 10µl and performed in triplicate. Initial
experiments showed that IP3 levels peaked at 5 s post-stimulation
(data not shown); this time was used for all subsequent experiments.
S2 cell preparations
To stimulate S2 cells, Drosokinin
(Terhzaz et al., 1999
) was
diluted to working concentration in DES medium/FCS, then added to
5x104 cells (approximating to 5000 transfected cells) in DES
medium/FCS to a final concentration of 10-7 moll-1 for
the appropriate time. Initial experiments showed that peak IP3
generation occurred at 10 s after peptide stimulation (data not shown). Cells
were co-transfected with an eGFP (enhanced green fluorescent protein) control
plasmid in order to measure transfection efficiency using a haemocytometer.
The same transfection batch was used for all samples in any one data set;
stimulations were performed in duplicate.
For both tubule and S2 cell preparations, reactions were terminated with 10% (v/v) ice-cold perchloric acid and samples were homogenised using a Polytron homogeniser on ice. Cellular debris was removed by centrifugation and the supernatants neutralised with 1.5 moll-1 KOH/60 mmoll-1 Hepes in the presence of 2µl Universal Indicator. Precipitated salts were spun down and the supernatants transferred to fresh tubes. Additions of 2500 d.p.m. [3H]Ins(1,4,5)P3 ([3H]IP3; specific activity 370-1850 GBq mmoll-1; Amersham Biosciences UK Ltd, Little Chalfont, UK), incubation buffer and binding protein were made [final concentrations: 25 mmoll-1 Tris-HCl (pH 9); 5 mmoll-1 NaHCO3; 1 mmoll-1 EDTA; 1 mmoll-1 EGTA; 0.25 mmoll-1 dithiothreitol (DTT); 1 mg ml-1 bovine serum albumin (Fraction V); 0.4 mg ml-1 binding protein] to a final volume of 400µl, and the samples were incubated on ice for 45 min prior to centrifugation at 12 000g (4°C) for 1 min. Supernatants were removed by aspiration, the pellets dissolved in 1 ml of scintillation fluid and the radioactivity therein determined by scintillation counting. A standard curve, using 0-40 pmol IP3 per sample, was generated in parallel. Non-specific binding was determined using 100 pmol IP3. Standard curves were plotted as %B/Bo versus pmol of unlabelled IP3, where B is the specific binding of [3H]IP3 (at a given concentration of unlabelled IP3), and Bo is the maximal specific binding of [3H]IP3 (at 0 pmol of unlabelled IP3). A similar calculation was made using values of specific binding of [3H]IP3 of tissue samples and the IP3 content therein determined using the standard curve.
Protein concentrations in tubule samples were assessed by Lowry assays. Three replicate samples were pooled for assay of IP3 content in order to obtain measurable levels of IP3. Duplicate samples were assayed for each experimental sample.
Measurements of [Ca2+]i using an aequorin
transgene under heat-shock control
hsGAL4;aeq (Rosay et al.,
1997
) were used as control animals, and protocols used were
essentially those previously described. For each assay, 20-40 tubules from 4-
14-day-old adults were dissected in Schneider's medium 2 h after heat-shock
(37°C for 30 min). Tubules were pooled in 160µl of the same buffer and
aequorin reconstituted with the cofactor coelenterazine (final concentration,
2.5 µmoll-1). Bioluminescence recordings were made with a
luminometer (LB9507; Berthold, Pforzheim, Germany); recordings were made every
0.1 s for each tube. Each tube of 20 tubules was used for a single data point:
after recording [Ca2+]i levels, tissues were disrupted
in 350µl lysis solution [1% (v/v) Triton X-100/100 mmoll-1
CaCl2], causing discharge of the remaining aequorin and allowing
estimation of the total amount of aequorin in the sample. Calibration of the
aequorin system and calculation of [Ca2+]i were
performed as previously described (Rosay
et al., 1997
). Mock injections with Schneider's medium were
applied to all samples prior to treatment with neuropeptides.
| Results |
|---|
|
|
|---|
Both norpA mutants manifest an epithelial phenotype (Fig. 1). No significant change in basal secretion rate was observed repeatedly in norpA mutants; however, both alleles, norpAH52 and norpAP24, severely attenuated CAP2b-induced secretion to similar extents (Fig. 1A). By contrast, for Drosokinin-stimulated fluid transport, the norpA alleles were distinguishable (Fig. 1B); in the eye, norpAP24 displays a much more severe phenotype compared with norpAH52. Kinetics of the fluid secretion response in all lines were similar.
|
Thus, the data show that fluid transport induced by both CAP2b and Drosokinin requires a PLCß-dependent signalling pathway; as such, norpA function is not confined to phototransduction.
CAP2b and Drosokinin stimulate IP3
production
CAP2b and Drosokinin have both been shown to act through
intracellular calcium; so, if their action relies on PLC
(Fig. 1), they should also each
act to raise IP3 in tubules.
Table 1 shows that
CAP2b, which acts only on principal cells, increases IP3
levels in intact wild-type tubules. This, together with the data in
Fig. 1, shows that
CAP2b acts via a phosphoinositide (PI)-PLC-dependent
mechanism.
|
Aedes leucokinins have been shown to stimulate IP3
production in mosquito tubules (Cady and
Hagedorn, 1999
). However, as Drosokinin exerts its effects solely
via stellate cells in Drosophila tubules
(Terhzaz et al., 1999
), and as
Drosophila tubules each contain only 22 stellate cells
(Sozen et al., 1997
),
Drosokinin-stimulated IP3 levels could not be reliably quantified
in intact tubules (data not shown). Accordingly, an in vitro approach
was used. Drosophila S2 cells transfected with the Drosokinin
receptor have been shown to display increased cytosolic intracellular calcium
when stimulated with Drosokinin (Radford
et al., 2002
). Data in Table
1 show that Drosokinin increases IP3 content in these
cells by approximately eightfold. As the Drosokinin receptor has been
localised to only stellate cells in vivo
(Radford et al., 2002
), it is
probable that Drosokinin stimulates IP3 production in stellate
cells in intact tubules. As with CAP2b, Drosokinin action requires
activation of PI-PLC.
Resting and CAP2b-stimulated levels of IP3
are significantly reduced in itpr mutants
Intracellular signalling is frequently regulated by feedback. If
IP3 signalling contributes to the biological effects of
neuropeptides in tubules, lesions in the IP3R might feed back to
downregulate the IP3 signalling molecule in vivo.
Measurement of basal IP3 levels in wild-type and itpr tubules shows that disruption of IP3R results in a reduction in resting IP3 levels. Significant reductions in basal IP3 levels are observed in heterozygous alleles, homozygous itpr1664/itpr1664 and heteroallelic lines (Fig. 2A).
|
IP3 levels were also measured in neurohormone-stimulated intact tubules. As Drosokinin-stimulated IP3 production was not measurable in intact tubules, experiments were conducted only on CAP2b-stimulated wild-type and itpr tubules (Fig. 2B). IP3 content is increased in all CAP2b-stimulated itpr tubules, although to a lesser extent in homozygous itpr1664/itpr1664 and heteroallelic itprWC361/itprUG3 lines compared with wild type. However, these differences are not statistically significant. Thus, tubules from itpr mutants are able to generate IP3 in response to CAP2b, suggesting that PI-PLC-dependent signalling is not compromised in these lines.
Diuresis is inhibited by disruption of itpr
As mutations in norpA result in an epithelial phenotype, we
investigated the possibility of uncovering such phenotypes in itpr
mutants. We show that CAP2b stimulation of fluid transport is
inhibited in heterozygous, homozygous and heteroallelic itpr alleles
(Fig. 3A). Significant
inhibition is observed in itpr90B.0/+,
itpr1664/itprXR12 and
itpr1664/itpr90B.0. However,
CAP2b-stimulated fluid transport is almost completely abolished in
the homozygous itpr1664/itpr1664 and
heteroallelic itprWC361/itprUG3 lines. It is
possible that the non-correlation between the severity of the alleles
(itpr1664/itpr90B.0 versus
itpr1664/itpr1664) and CAP2b-stimulated
transport in these alleles is due to either differences in genetic background
or by impact of the mutations on other interacting signalling pathways that
are activated by CAP2b.
|
By contrast, Drosokinin-stimulated fluid transport is not affected by either heterozygous itprXR12/+, itpr90B.0/+ or itpr1664/+ alleles (Fig. 3B). Significant inhibition is only observed in the heteroallelics itpr1664/itprXR12, itpr1664/itpr90B.0 and itprWC361/itprUG3 and in the homozygous itpr1664/itpr1664. Furthermore, there are marked differences in the severity of inhibition between Drosokinin- and CAP2b-stimulated fluid transport, especially in itpr1664/itpr1664 and itprWC361/itprUG3 alleles.
Thus, itpr acts in both principal and stellate cells to transduce CAP2b and Drosokinin diuretic signals.
Rescue of itpr90B.0 restores
CAP2b-stimulated fluid transport levels
Sometimes, phenotypes ascribed to mutant loci in Drosophila are
subsequently found to be caused by second-site mutations or other genetic
accidents incidental to the original study. It is thus desirable to confirm
that mutant effects are genuinely due to the locus of interest. Crosses were
established between heterozygous hsGAL4;itpr90B.0 and
UAS-itpr homozygotes to allow rescue of
itpr90B.0. Tubules from flies with the
w/UAS-itpr;+/hsGAL4;+/itpr90B.0 genotype were
used in transport assays. Control lines used were OrR and UAS-itpr.
Non-heat-shocked w/UAS-itpr;+/hsGAL4;+/itpr90B.0
were not used as controls, as the heat-shock promoter is `leaky' and is
transcribed at 25°C (G. Hasan, unpublished).
Fig. 4 shows that expression of itpr restores CAP2b-stimulated fluid transport to levels indistinguishable from wild-type. Although disruption of itpr may compromise associated signalling pathways resulting in downregulation of CAP2b-stimulated transport, successful rescue of itpr90B.0/+ with USA-itpr provides strong evidence that the epithelial phenotype observed in this line is associated with mutated itpr.
|
CAP2b-induced calcium signalling is impaired in
itpr mutants
Previous work has shown that capa peptides
(Kean et al., 2002
) increase
intracellular calcium in tubule main segment principal cells
(Rosay et al., 1997
)
via plasma membrane calcium channels (MacPherson et al.,
2000
,
2001
). However, release from
intracellular stores is not measurable in this cell type
(Rosay et al., 1997
), thus
calling into question the role of IP3R-sensitive stores in
principal cells. If release of calcium from IP3-sensitive internal
stores does occur upon CAP2b stimulation, changes in this response
may be observed in itpr mutants.
Using targeted aequorin, cytosolic calcium measurements in wild-type and
itpr tubules stimulated with CAP2b were performed; typical
traces are shown in Fig. 5A.
Fig. 5Ai shows the biphasic
rise, consisting of a rapid primary peak followed by a slow secondary rise in
cytosolic calcium in CAP2b-stimulated wild-type aeq;hsGAL4 tubules.
This calcium signature is also observed in capa/CAP2b-stimulated
wild-type tubules (Kean et al.,
2002
). The response is reduced in heterozygous itpr
alleles, aeq;hsGAL4;itprXR12/+ and
aeq;hsGAL4;itpr90B.0/+
(Fig. 5B), which may result in
the transport phenotype observed. Interestingly, in heterozygous
itpr1664/+, the primary response is unaffected, with only
the secondary response being reduced; in this line, stimulated fluid transport
is not significantly different from control
(Fig. 3A). By contrast, the
alleles that display the most severe transport phenotype
(itpr1664/itpr1664 and
itprWC361/itprUG3) also display an attenuated
calcium response to CAP2b (Fig.
5Av,vi,B). Both reduction in the primary peak and loss of the
secondary rise are observed in these lines. However, none of the itpr
alleles completely abolish CAP2b-stimulated calcium signalling.
This is consistent with itpr being an essential gene and with viable
alleles all being hypomorphs rather than nulls.
|
These results thus suggest that IP3R-mediated calcium release from intracellular stores contributes significantly to calcium signalling, and consequent diuresis, in principal cells.
itpr mutants reduce Drosokinin-induced calcium signals
We have shown previously that leucokinin
(Rosay et al., 1997
;
O'Donnell et al., 1998
) and
endogenous Drosophila leucokinin
(Terhzaz et al., 1999
) elevate
intracellular calcium levels in stellate cells. Furthermore, experiments in
calcium-free medium show that stellate cells display emptying of intracellular
calcium stores in the presence of the ER-calcium ATPase inhibitor,
thapsigargin (Rosay et al.,
1997
). Thus, Drosokinin-stimulated calcium increases should be
reduced in itpr mutants.
Data in Fig. 6A show typical
traces of Drosokinin-stimulated increases in cytosolic calcium in wild-type
and itpr tubules. A rapid response is observed in wild-type tubules
(Fig. 6Ai;
Terhzaz et al., 1999
;
Radford et al., 2002
). This
response is severely reduced in
itpr1664/itpr1664 and
itprWC361/itprUG3 flies
(Fig. 6Av,vi,B). Drosokinin-stimulated fluid transport is also reduced in these lines
(Fig. 3B); thus, functional
IP3R contributes to Drosokinin-stimulated calcium signalling and
fluid transport.
|
| Discussion |
|---|
|
|
|---|
IP3 and IP3R have been shown to be critical for
calcium signalling in non-excitable cells via a mechanism of
IP3-induced release of calcium from internal stores. Previous work
has shown that IP3R is expressed in Malpighian tubules
(Pollock et al., 2000
;
Blumenthal, 2001
). We now
ascribe functional significance to this finding and show that CAP2b
stimulates IP3 production in intact Drosophila tubules.
Furthermore, we show that Drosokinin mobilises IP3 in Drosokinin
receptor-transfected S2 cells.
A role for IP3R in neurohormone-stimulated epithelial transport
has been demonstrated using an allelic series of itpr mutants. These
itpr lines have been extensively investigated previously in order to
determine the role of IP3R in vivo. itprXR12/+
(inversion), itpr90B.0/+ (null) and
itpr1664/+ (hypomorph) display delayed moulting and
reduced expression of the ecdysone-inducible gene E74. In terms of
severity, itpr90B.0 and itprXR12 are
the most severe alleles (Venkatesh and
Hasan, 1997
). These lines, as well as
itprWC361/itprUG3, have also been used in
studies of olfaction, where it has been shown that, in the most severe
alleles, olfactory adaptation is not maintained
(Deshpande et al., 2000
).
CAP2b-stimulated epithelial transport is reduced in the null mutant
(itpr90B.0) compared with wild-type tubules, while the
most severe phenotypes are observed in itpr1664
homozygotes and the heteroallelics. Rescue of the
itpr90B.0 transport phenotype is demonstrated with
UAS-itpr, which strongly suggests that the tubule phenotype is
associated with disruption in IP3R. Interestingly, while the null
mutant displays a phenotype upon CAP2b stimulation, only the most
severe itpr1664 homozygotes and the heteroallelics affect
Drosokinin-stimulated secretion. Therefore, reduced
CAP2b-stimulated fluid transport in itpr90B.0
may be due to principal cell-specific signalling processes associated with the
null mutation.
Intriguingly, resting levels of IP3 in tubules are significantly reduced in all itpr mutants apart from itpr1664/itprXR12, suggesting a possible feedback mechanism between receptor (IP3R) and second messenger (IP3). However, this is not associated with an epithelial phenotype, as no difference in basal rate is observed in tubules from itpr lines as compared to wild-type flies.
We have previously shown that the neuropeptide CAP2b induces a
rise in cytosolic calcium in only principal cells that is dependent on
extracellular calcium; these calcium signalling events, which may mediate
NO/cGMP signalling, correlate with CAP2b-stimulated fluid
transport. The CAP2b-induced response is abolished by L-type
calcium channel inhibitors and also in mutants for the plasma membrane calcium
channels, TRP and TRPL (MacPherson et al.,
2000
,
2001
). Thus,
CAP2b-induced calcium signalling occurs via multichannel
mechanisms. We demonstrate here that IP3R plays a role in
CAP2b-induced calcium signalling
(Fig. 5). Extensive work using
norpA mutants has shown that norpA-encoded PLC plays a
critical role in rhabdomeres. Thus, PLCß, which is required for the
cleavage of phosphatidylinositol (4,5)-bisphosphate (PIP2) to
IP3 and diacylglycerol (DAG), is necessary for phototransduction.
Interestingly, however, using the itpr null and
itpr1664 mutants, IP3 signalling has been shown
to be unnecessary to activate light-activated conductance
(Raghu et al., 2000a
). This
response is, however, dependent on calcium entry via TRP/TRPL
channels. DAG has been shown to activate native TRP and TRPL channels in
photoreceptors and recombinant TRPL channels
(Chyb et al., 1999
).
Furthermore, recent studies have supported the role of DAG in TRP/TRPL action:
DAG kinase mutants display constitutive activation of TRP and TRPL channels
(Raghu et al., 2000b
), and, in
vertebrate cells, TRPC3 (transient receptor potential-like channel 3) has been
shown to be activated by DAG independently of IP3R
(Venkatachalam et al., 2001
).
Thus, PLC is involved in regulation of TRP/TRPL plasma membrane calcium
channels without a requirement for IP3. It is possible, then, that
PLC-activated DAG generation may regulate TRP/TRPL channels in tubules, which
may contribute significantly to the `multichannel' mode of action of
CAP2b. Furthermore, if DAG/TRP/TRPL signalling were compromised in
some itpr lines, this may explain the significant impact of
itpr alleles (for example, itpr null) on
CAP2b-stimulated, but not Drosokinin-stimulated, fluid transport
and calcium signalling (Figs 3,
5).
Previous work has shown that leucokinin and Drosokinin increase cytosolic
calcium concentration in only stellate cells in tubules, which express the
Drosokinin receptor (Rosay et al.,
1997
; Terhzaz et al.,
1999
; Radford et al.,
2002
). This suggests that IP3-mediated calcium
signalling may occur in stellate cells. Activation of calcium signalling may
be linked to chloride shunt conductance, which is also confined to stellate
cells (O'Donnell et al.,
1998
). It is thus possible that Drosokinin stimulates
PLCß-dependent, IP3-mediated calcium signalling in stellate
cells in vivo, which increases chloride conductance, resulting in
increased fluid transport.
Thus, Malpighian tubules, in contrast to photoreceptors, require both functional PLCß and IP3R for neuropeptide-activated signal transduction in principal and stellate cells. The expression of plc21 in tubules, however, and the role of DAG on plasma membrane calcium channels suggest that extremely complex mechanisms of signalling are used by tubule cells.
In summary, we have demonstrated non-neuronal, epithelial phenotypes for norpA (PLCß) and itpr (IP3R) and have correlated cell-specific signalling events for both IP3 and calcium to transport phenotypes.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Berridge, M. J. (1997). Elementary and global aspects of calcium signalling. J. Exp. Biol. 200,315 -319.[Abstract]
Bloomquist, B. T., Shortridge, R. D., Schneuwly, S., Perdew, M., Montell, C., Steller, H., Rubin, G. and Pak, W. L. (1988). Isolation of a putative phospholipase C gene of Drosophila, norpA, and its role in phototransduction. Cell 54,723 -733.[CrossRef][Medline]
Blumenthal, E. M. (2001). Characterization of
transepithelial potential oscillations in the Drosophila Malpighian
tubule. J. Exp. Biol.
204,3075
-3084.
Cady, C. and Hagedorn, H.E. (1999). Effects of putative diuretic factors on intracellular second messenger levels in the Malpighian tubules of Aedes aegypti. J. Insect. Physiol. 45,327 -337.[CrossRef][Medline]
Chyb, S., Raghu, P. and Hardie, R. C. (1999). Polyunsaturated fatty acids activate the Drosophila light-sensitive channels TRP and TRPL. Nature 397,255 -259.[CrossRef][Medline]
Davies, S. A., Huesmann, G. R., Maddrell, S. H. P., O'Donnell,
M. J., Skaer, N. J. V., Dow, J. A. T. and Tublitz, N. J.
(1995). CAP2b, a cardioacceleratory peptide, is
present in Drosophila and stimulates tubule fluid secretion
via cGMP. Am. J. Physiol.
269,R1321
-R1326.
Deshpande, M., Venkatesh, K., Rodrigues, V. and Hasan, G. (2000). The inositol 1,4,5-trisphosphate receptor is required for maintenance of olfactory adaptation in Drosophila antennae. J. Neurobiol. 43,282 -288.[CrossRef][Medline]
Dow, J. A., Maddrell, S. H., Gortz, A., Skaer, N. J., Brogan, S. and Kaiser, K. (1994). The Malpighian tubules of Drosophila melanogaster: a novel phenotype for studies of fluid secretion and its control. J. Exp. Biol. 197,421 -428.[Abstract]
Dow, J. A. T. and Davies, S. A. (2001). The Drosophila melanogaster Malpighian tubule. Adv. Insect Physiol. 28,1 -83.
Hardie, R. C. and Raghu, P. (1998). Activation of heterologously expressed Drosophila TRPL channels: Ca2+ is not required and InsP3 is not sufficient. Cell Calcium 24,153 -163.[CrossRef][Medline]
Hardie, R. C. and Raghu, P. (2001). Visual transduction in Drosophila. Nature 413,186 -193.[CrossRef][Medline]
Harteneck, C., Plant, T. D. and Schultz, G. (2000). From worm to man: three subfamilies of TRP channels. Trends Neurosci. 23,159 -166.[CrossRef][Medline]
Hasan, G. and Rosbash, M. (1992). Drosophila homologs of two mammalian intracellular Ca(2+)-release channels: identification and expression patterns of the inositol 1,4,5-triphosphate and the ryanodine receptor genes. Development 116,967 -975.[Abstract]
Kean, L., Cazenave, W., Costes, L., Broderick, K. E., Graham,
S., Pollock, V. P., Davies, S. A., Veenstra, J. A. and Dow, J. A.
(2002). Two nitridergic peptides are encoded by the gene
capability in Drosophila melanogaster. Am. J. Physiol. Regul.
Integr. Comp. Physiol. 282,R1297
-R1307.
MacPherson, M. R., Pollock, V. P., Broderick, K. B., Dow, J. A. and Davies, S. A. (2000). The role of TRP channels in epithelial fluid transport. A. Dros. Res. Conf. 41, 816B.
MacPherson, M. R., Pollock, V. P., Broderick, K. B., Kean, L.,
O'Connell, F. C., Dow, J. A. T. and Davies, S.-A. (2001).
Model organisms: New insights into ion channel and transporter function:
L-type calcium channels regulate epithelial fluid transport in Drosophila
melanogaster. Am. J. Physiol. Cell Physiol.
280,C394
-C407.
O'Donnell, M. J., Rheault, M. R., Davies, S. A., Rosay, P., Harvey, B. J., Maddrell, S. H. P., Kaiser, K. and Dow, J. A. T. (1998). Hormonally-controlled chloride movement across Drosophila tubules is via ion channels in stellate cells. Am. J. Physiol. 43,R1039 -R1049.
Pak, W. L., Grossfield, J. and Arnold, K. (1970). Mutants of the visual pathway of Drosophila melanogaster. Nature 227,518 -520.[Medline]
Palmer, S., Hughes, K. T., Lee, D. Y. and Wakelam, M. J. (1989). Development of a novel, Ins(1,4,5)P3-specific binding assay. Its use to determine the intracellular concentration of Ins(1,4,5)P3 in unstimulated and vasopressin-stimulated rat hepatocytes. Cell Signal 1,147 -156.[CrossRef][Medline]
Pearn, M. T., Randall, L. L., Shortridge, R. D., Burg, M. G. and
Pak, W. L. (1996). Molecular, biochemical, and
electrophysiological characterization of Drosophila norpA mutants.
J. Biol. Chem. 271,4937
-4945.
Pollock, V. P., Davies, S. A., Hasan, G. and Dow, J. A. T. (2000). Disruption of the IP3R gene in Drosophila melanogaster affects epithelial function. Comp. Biochem. Physiol. A 126, S121.
Putney, J. W. J. (1997). Type 3 inositol 1,4,5-trisphosphate receptor and capacitative calcium entry. Cell Calcium 21,257 -261.[CrossRef][Medline]
Radford, J. C., Davies, S. A. and Dow, J. A. T.
(2002). Systematic GPCR analysis in Drosophila
melanogaster identifies a leucokinin receptor with novel roles.
J. Biol. Chem. 277,38810
-38817.
Raghu, P., Colley, N. J., Webel, R., James, T., Hasan, G., Danin, M., Selinger, Z. and Hardie, R. C. (2000a). Normal phototransduction in Drosophila photoreceptors lacking an InsP(3) receptor gene. Mol. Cell Neurosci. 15,429 -445.[CrossRef][Medline]
Raghu, P., Usher, K., Jonas, S., Chyb, S., Polyanovsky, A. and Hardie, R. C. (2000b). Constitutive activity of the light-sensitive channels TRP and TRPL in the Drosophila diacylglycerol kinase mutant, rdgA. Neuron 26,169 -179.[CrossRef][Medline]
Rosay, P., Davies, S. A., Yu, Y., Sozen, M. A., Kaiser, K. and Dow, J. A. T. (1997). Cell-type specific calcium signalling in a Drosophila epithelium. J. Cell Sci. 110,1683 -1692.[Abstract]
Shortridge, R. D., Yoon, J., Lending, C. R., Bloomquist, B. T.,
Perdew, M. H. and Pak, W. L. (1991). A Drosophila
phospholipase C gene that is expressed in the central nervous system.
J. Biol. Chem. 266,12474
-12480.
Sozen, H. A., Armstrong, J. D., Yang, M. Y., Kaiser, K. and Dow,
J. A. T. (1997). Functional domains are specified to
single-cell resolution in a Drosophila epithelium. Proc.
Natl. Acad. Sci. USA 94,5207
-5212.
Terhzaz, S., O'Connell, F. C., Pollock, V. P., Kean, L., Davies, S. A., Veenstra, J. A. and Dow, J. A. (1999). Isolation and characterization of a leucokinin-like peptide of Drosophila melanogaster.J. Exp. Biol. 202,3667 -3676.[Abstract]
Venkatachalam, K., Ma, H. T., Ford, D. L. and Gill, D. L.
(2001). Expression of functional receptor-coupled TRPC3 channels
in DT40 triple receptor InsP3 knockout cells. J. Biol.
Chem. 276,33980
-33985.
Venkatesh, K. and Hasan, G. (1997). Disruption of the IP3 receptor gene of Drosophila affects larval metamorphosis and ecdysone release. Curr. Biol. 7, 500-509.[CrossRef][Medline]
Venkatesh, K., Siddhartha, G., Joshi, R., Patel, S. and Hasan,
G. (2001). Interactions between the inositol
1,4,5-trisphosphate and cyclic AMP signaling pathways regulate larval molting
in Drosophila. Genetics
158,309
-318.
Yoshikawa, S., Tanimura, T., Miyawaki, A., Nakamura, M., Yuzaki,
M., Furuichi, T. and Mikoshiba, K. (1992). Molecular cloning
and characterization of the inositol 1,4,5-trisphosphate receptor in
Drosophila melanogaster. J. Biol. Chem.
267,16613
-16619.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
S. A. Davies and S. Terhzaz Organellar calcium signalling mechanisms in Drosophila epithelial function J. Exp. Biol., February 1, 2009; 212(3): 387 - 400. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. D. Southall, S. Terhzaz, P. Cabrero, V. R. Chintapalli, J. M. Evans, J. A. T. Dow, and S.-A. Davies Novel subcellular locations and functions for secretory pathway Ca2+/Mn2+-ATPases Physiol Genomics, September 14, 2006; 26(1): 35 - 45. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Terhzaz, T. D. Southall, K. S. Lilley, L. Kean, A. K. Allan, S. A. Davies, and J. A. T. Dow Differential Gel Electrophoresis and Transgenic Mitochondrial Calcium Reporters Demonstrate Spatiotemporal Filtering in Calcium Control of Mitochondria J. Biol. Chem., July 7, 2006; 281(27): 18849 - 18858. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Blumenthal Modulation of tyramine signaling by osmolality in an insect secretory epithelium Am J Physiol Cell Physiol, November 1, 2005; 289(5): C1261 - C1267. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. MacPherson, V. P. Pollock, L. Kean, T. D. Southall, M. E. Giannakou, K. E. Broderick, J. A. T. Dow, R. C. Hardie, and S. A. Davies Transient Receptor Potential-Like Channels Are Essential for Calcium Signaling and Fluid Transport in a Drosophila Epithelium Genetics, March 1, 2005; 169(3): 1541 - 1552. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Cabrero, V. P. Pollock, S. A. Davies, and J. A. T. Dow A conserved domain of alkaline phosphatase expression in the Malpighian tubules of dipteran insects J. Exp. Biol., September 1, 2004; 207(19): 3299 - 3305. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Broderick, L. Kean, J. A. T. Dow, N. J. Pyne, and S. A. Davies Ectopic Expression of Bovine Type 5 Phosphodiesterase Confers a Renal Phenotype in Drosophila J. Biol. Chem., February 27, 2004; 279(9): 8159 - 8168. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-J. Yu and K. W. Beyenbach Effects of leucokinin-VIII on Aedes Malpighian tubule segments lacking stellate cells J. Exp. Biol., February 1, 2004; 207(3): 519 - 526. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||