spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pollock, V. P.
Right arrow Articles by Davies, S.-A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pollock, V. P.
Right arrow Articles by Davies, S.-A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
The Journal of Experimental Biology 206, 901-911 (2003)
Copyright © 2003 The Company of Biologists Limited
doi: 10.1242/jeb.00189

norpA and itpr mutants reveal roles for phospholipase C and inositol (1,4,5)- trisphosphate receptor in Drosophila melanogaster renal function

Valerie P. Pollock1, Jonathan C. Radford1, Susan Pyne2, Gaiti Hasan3, Julian A. T. Dow1 and Shireen-A. Davies1,*

1 Institute of Biomedical and Life Sciences, Division of Molecular Genetics, University of Glasgow, Glasgow G11 6NU, UK
2 Department of Physiology and Pharmacology, Strathclyde Institute for Biomedical Sciences, University of Strathclyde, Glasgow G4 ONR, UK
3 National Centre for Biological Sciences, UAS-GKVK Campus, Bangalore 560065, India

* Author for correspondence (e-mail: s.a.davies{at}bio.gla.ac.uk)

Accepted 2 December 2002


    Summary
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Mutants of norpA, encoding phospholipase Cß (PLCß), and itpr, encoding inositol (1,4,5)-trisphosphate receptor (IP3R), both attenuate response to diuretic peptides of Drosophila melanogaster renal (Malpighian) tubules. Intact tubules from norpA mutants severely reduced diuresis stimulated by the principal cell- and stellate cell-specific neuropeptides, CAP2b and Drosophila leucokinin (Drosokinin), respectively, suggesting a role for PLCß in both these cell types. Measurement of IP3 production in wild-type tubules and in Drosokinin-receptor-transfected S2 cells stimulated with CAP2b and Drosokinin, respectively, confirmed that both neuropeptides elevate IP3 levels.

In itpr hypomorphs, basal IP3 levels are lower, although CAP2b-stimulated IP3 levels are not significantly reduced compared with wild type. However, CAP2b-stimulated fluid transport is significantly reduced in itpr alleles. Rescue of the itpr90B.0 allele with wild-type itpr restores CAP2b-stimulated fluid transport levels to wild type. Drosokinin-stimulated fluid transport is also reduced in homozygous and heteroallelic itpr mutants.

Measurements of cytosolic calcium levels in intact tubules of wild-type and itpr mutants using targeted expression of the calcium reporter, aequorin, show that mutations in itpr attenuated both CAP2b- and Drosokinin-stimulated calcium responses. The reductions in calcium signals are associated with corresponding reductions in fluid transport rates.

Thus, we describe a role for norpA and itpr in renal epithelia and show that both CAP2b and Drosokinin are PLCß-dependent, IP3-mobilising neuropeptides in Drosophila. IP3R contributes to the calcium signalling cascades initiated by these peptides in both principal and stellate cells.

Key words: CAP2b, leucokinin, photoreception, TRP, TRPL, Drosokinin, Drosophila, inositol (1,4,5)-trisphosphate receptor (IP3R), itpr, norpA


    Introduction
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The accepted paradigm for hormonally stimulated increases in intracellular cytosolic calcium concentration ([Ca2+]i) in non-excitable cells centres on G-protein-coupled activation of phospholipase Cß (PLCß) upon ligand—receptor binding, resulting in an increase in intracellular levels of the second messengers diacylglycerol (DAG) and inositol (1,4,5)-trisphosphate (IP3). IP3 binds to its receptor on the endoplasmic reticulum (ER), IP3R, which functions as a calcium-release channel. Calcium is released from intracellular stores, with associated calcium entry via plasma membrane calcium channels by an unknown mechanism termed `capacitative calcium entry' (Berridge, 1997Go; Putney, 1997Go).

The processes of calcium signalling in vivo have been intensely investigated in Drosophila phototransduction, where novel calcium channels and associated signalling proteins have been discovered in forward genetic screens (Hardie and Raghu, 2001Go). Importantly, studies in Drosophila have subsequently revealed vertebrate and human homologues of such signalling complexes (Harteneck et al., 2000Go). Light-driven phototransduction has been shown to be PLC-dependent; as such, most studies of PLC function in vivo in Drosophila have utilised the photoreceptor model. Two genes encode PLCß in Drosophila: norpA and Plc21C. Mutants in norpA severely reduce phototransduction (Pak et al., 1970Go). Molecular cloning of the gene, together with biochemical analyses of PLC activity in the eye of norpA mutants showed that norpA encodes a retinal-specific PLC similar to bovine brain PLC (Bloomquist et al., 1988Go). By contrast, Plc21C is more generally expressed, with a 7 kb transcript in the eye and central nervous system (CNS) and a 5.6 kb transcript in heads and bodies (Shortridge et al., 1991Go).

Mutagenic analysis of the IP3R has also been informative in insects. In Drosophila, a single gene, itpr-83, encodes IP3R (Hasan and Rosbash, 1992Go; Yoshikawa et al., 1992Go). Drosophila IP3R has most similarity to type I IP3R in vertebrates. Embryonic expression of itpr has been documented, and a delayed-development phenotype has been identified in mutants (Venkatesh and Hasan, 1997Go). In the adult, expression has been shown in photoreceptors, brain and antennae, with expression also documented in the eye, which suggests a role for IP3R in chemosensation and in visual processes. However, in spite of the documented role of PLC in the eye, recent work has shown that IP3 signalling is unnecessary for phototransduction to occur (Hardie and Raghu, 1998Go; Venkatesh and Hasan, 1997Go).

While norpA and itpr have been assigned neural roles — indeed, norpA is generally considered to be visual system specific — it is likely that much more general roles for these genes exist but have yet to be documented due to lack of an informative physiological phenotype. The Drosophila Malpighian tubule is an ideal genetic model for transporting epithelia and provides a robust phenotype for the integrative physiology of cell signalling and transport genes (Dow and Davies, 2001Go). Previous work has established that ion transport and cell signalling process are compartmentalised into different tubule cell subtypes: the principal and stellate cells (Dow and Davies, 2001Go). Furthermore, direct measurements of cell-specific intracellular calcium signalling mechanisms using targeted aequorin show a direct modulation of fluid transport by agents that mobilise intracellular calcium (O'Donnell et al., 1998Go; Rosay et al., 1997Go; Terhzaz et al., 1999Go; MacPherson et al., 2001Go). The Drosophila neurohormones capa-1 (a member of the CAP2b family; Kean et al., 2002Go) and Drosophila leucokinin (Drosokinin; Terhzaz et al., 1999Go) have been shown to stimulate fluid transport rates, which are associated with increases in cytoplasmic calcium concentration in principal and stellate cells, respectively, in tubule main segment. The CAP2b response is dependent on extracellular calcium (Rosay et al., 1997Go); furthermore, it has been recently demonstrated that TRP/TRPL (transient receptor potential/TRP-like) and L-type calcium channels play a role in this response (MacPherson et al., 2000Go, 2001Go). However, the relative contribution of intracellular calcium stores to these neurohormone-induced responses is still unclear. Use of the ER Ca2+-ATPase inhibitor thapsigargin in the presence of extracellular calcium results in elevation of intracellular calcium levels in both principal and stellate cells and increased fluid transport rates (Rosay et al., 1997Go). However, in the absence of extracellular calcium the response is abolished in principal cells but remains in stellate cells. Thus, it appears that the contribution of ER calcium stores, and thus of calcium signalling via IP3R to capacitative calcium entry in tubule cells, is cell-type specific. Alternatively, the putative thapsigargin-sensitive pool in principal cells is very small and is emptied too rapidly to monitor. It is thus of interest to try to dissect the different contributions of calcium signalling genes in the context of principal and stellate cell function.

In this study, we show that mutations in norpA reduce stimulation of fluid transport by both CAP2b and Drosokinin. Furthermore, CAP2b and Drosokinin both elevate IP3 levels. Thus, PLCß and IP3 are involved in stimulated fluid transport; we have thus utilised itpr mutants to define the contribution of IP3R to neurohormone-mediated increases in epithelial fluid transport. Genetic blockade of IP3R function results in inhibition of neuropeptide-fluid transport rates associated with either CAP2b or Drosokinin. In itpr mutants, downregulation of fluid transport is associated with reductions in neuropeptide-stimulated intracellular calcium levels. Thus, PLCß-mediated IP3 signalling plays a functional role in calcium signalling and epithelial fluid transport in Drosophila, confirming that the important norpA and itpr genes are not neural specific.


    Materials and methods
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Materials
Coelenterazine was purchased from Molecular Probes (Leiden, The Netherlands) and dissolved in ethanol before use. Schneider's medium was obtained from GIBCO Life Technologies (Invitrogen Ltd, Paisley, UK). Neuropeptides CAP2b (pyroELYAFPRV-amide; Davies et al., 1995Go) and Drosokinin (NSVVLGKKQRFHSWG-amide; Terhzaz et al., 1999Go) were synthesised by Research Genetics, Inc. (Invitrogen Ltd). All other chemicals were obtained from Sigma (Pool, UK).

Drosophila stocks
Drosophila melanogaster (Meigen) were maintained on a 12h: 12h L:D cycle on standard cornmeal—yeast—agar medium at 25°C. Oregon R (OrR) wild-type flies used were those described previously (Dow et al., 1994Go). Mutant lines of norpA (Bloomquist et al., 1988Go; Pearn et al., 1996Go) and itpr (Venkatesh and Hasan, 1997Go) have been described previously. itpr lines were used as out-crossed lines to OrR to rule out the effects of balancer chromosomes on the tubule phenotype. Multiple alleles were utilised in this study in order to control for any effects of genetic background in individual lines. Choice of alleles was based on the health of the lines. Lines used were as follows: norpAH52/norpAH52 (temperature-sensitive allele); norpAP24/norpAP24 (kind gifts of R. C. Hardie, University of Cambridge); itprXR12/+ (X-ray inversion); itpr90B.0/+, itpr1664/+, itpr1664/itprXR12, itpr1664/itpr90B.0 and itpr1664/itpr1664 (P-element insertions); itprWC361/itprUG3 (EMS alleles). itpr lines were slow-growing due to eclosion defects (Venkatesh and Hasan, 1997Go). Additionally, the following lines were also utilised: hsGAL4;itpr90B.0 and UAS-itpr (Venkatesh et al., 2001Go). Temperature-sensitive (ts) and hsGAL4 lines were heat-shocked at 37°C for 30 min and left to recover at 23°C before experimentation.

To produce flies in which tubule calcium measurements could be made using the calcium reporter aequorin (Rosay et al., 1997Go; Terhzaz et al., 1999Go), it was necessary to generate itpr lines in an aequorin background under control of an hsGAL4 promoter. These were based on an X-chromosome insertion of UAS-aeq, and an hsGAL4 construct on chromosome 2, leaving chromosome 3 free for itpr alleles. The following lines were generated and utilised for this study: aeq;hsGAL4;itprXR12/+, aeq;hsGAL4;itpr90B.0/+, aeq;hsGAL4;itpr1664/+, aeq;hsGAL4;itpr1664/itpr1664 and aeq;hsGAL4;itprWC361/itprUG3. Extremely poor viability of the itpr1664/itprXR12 and itpr1664/itpr90B.0 heteroallelics in the aequorin background did not allow use of these lines for calcium measurements. Verification of aequorin expression was achieved at several stages of the crossing procedure by measuring total light output by dissected, intact tubules after lysis in Triton/CaCl2 as described below. The presence of the appropriate itpr allele was verified in progeny of aeq;itpr flies by RT-PCR. Maintenance of the itpr phenotype was assessed by fluid transport assays in the presence of either CAP2b or Drosokinin.

Transport (fluid secretion) assays
Flies were cooled on ice and then decapitated prior to isolation of whole tubules. Malpighian tubules were isolated into 10 µl drops of a 1:1 mixture of Schneider's medium and Drosophila saline (NaCl, 117.5 mmoll-1; KCl, 20 mmoll-1; CaCl2, 2 mmoll-1; MgCl2, 8.5 mmoll-1; NaHCO3, 10.2 mmoll-1; NaH2PO4, 4.3 mmoll-1; Hepes, 15 mmoll-1; glucose 20 mmoll-1) under liquid paraffin, and fluid secretion rates were measured as described previously (Dow et al., 1994Go) under the different conditions described in the text. CAP2b and Drosokinin were added as solutions in assay medium at 30 min.

Heterologous expression of the Drosokinin receptor
The recently characterised Drosokinin receptor (Radford et al., 2002Go) was used to assay Drosokinin-stimulated IP3 production. In order to transfect S2 cells with Drosokinin receptor, the protocol described below was adopted.

Expression constructs
Primers were designed for the Drosokinin receptor (CG1062; Radford et al., 2002Go) to allow amplification from the start to the stop codon of the coding sequence. Forward primers were designed to include a 5' Kozak translational initiation sequence (G/ANNATGG). Amplification was carried out with EXPAND High Fidelity Polymerase (Roche Diagnostics Ltd, Lewes, UK) according to manufacturers instructions. Forward (GACATGGACTTAATCGAGCAGGAG) and reverse (TTAAAGTGGTTGCCACAAGGAC) primers were used to generate a fragment of 1626bp. OrR cDNA was used as template. The PCR product was purified by gel extraction and directly cloned into the pMT-V5/His TOPO TA inducible expression vector (Invitrogen). The construct was verified by restriction enzyme digestion and sequencing to ensure that no mutations had been induced during cloning.

S2 cell culture
S2 cells were maintained in DES (Drosophila expression system) medium (Invitrogen) supplemented with 10% heat-inactivated foetal calf serum (FCS; Invitrogen). Cells were grown in suspension at an initial density of 2-4x106 cells ml-1 at 23°C. S2 cells were transiently transfected at a density of 1x106 cells ml-1 using calcium phosphate (Invitrogen), according to manufacturer's instructions. Cells were transfected with 20µg of the Drosokinin receptor expression construct and were used 24h post-induction of the metallothionein promoter with Cu2+ ions.

Mass measurement of inositol (1,4,5)-trisphosphate (IP3) levels
IP3 levels in tubules were measured by a quantitative radioligand-binding assay as described elsewhere (Palmer et al., 1989Go) using an IP3-binding protein preparation derived from bovine adrenal gland.

Tubule preparations
Tubules (20 per sample) were dissected from wild-type and itpr mutants into 9µl of Schneider's medium. Samples were stimulated with CAP2b (10-7 moll-1) for 0 s (control), 2 s or 5 s in a final sample volume of 10µl and performed in triplicate. Initial experiments showed that IP3 levels peaked at 5 s post-stimulation (data not shown); this time was used for all subsequent experiments.

S2 cell preparations
To stimulate S2 cells, Drosokinin (Terhzaz et al., 1999Go) was diluted to working concentration in DES medium/FCS, then added to 5x104 cells (approximating to 5000 transfected cells) in DES medium/FCS to a final concentration of 10-7 moll-1 for the appropriate time. Initial experiments showed that peak IP3 generation occurred at 10 s after peptide stimulation (data not shown). Cells were co-transfected with an eGFP (enhanced green fluorescent protein) control plasmid in order to measure transfection efficiency using a haemocytometer. The same transfection batch was used for all samples in any one data set; stimulations were performed in duplicate.

For both tubule and S2 cell preparations, reactions were terminated with 10% (v/v) ice-cold perchloric acid and samples were homogenised using a Polytron homogeniser on ice. Cellular debris was removed by centrifugation and the supernatants neutralised with 1.5 moll-1 KOH/60 mmoll-1 Hepes in the presence of 2µl Universal Indicator. Precipitated salts were spun down and the supernatants transferred to fresh tubes. Additions of 2500 d.p.m. [3H]Ins(1,4,5)P3 ([3H]IP3; specific activity 370-1850 GBq mmoll-1; Amersham Biosciences UK Ltd, Little Chalfont, UK), incubation buffer and binding protein were made [final concentrations: 25 mmoll-1 Tris-HCl (pH 9); 5 mmoll-1 NaHCO3; 1 mmoll-1 EDTA; 1 mmoll-1 EGTA; 0.25 mmoll-1 dithiothreitol (DTT); 1 mg ml-1 bovine serum albumin (Fraction V); 0.4 mg ml-1 binding protein] to a final volume of 400µl, and the samples were incubated on ice for 45 min prior to centrifugation at 12 000g (4°C) for 1 min. Supernatants were removed by aspiration, the pellets dissolved in 1 ml of scintillation fluid and the radioactivity therein determined by scintillation counting. A standard curve, using 0-40 pmol IP3 per sample, was generated in parallel. Non-specific binding was determined using 100 pmol IP3. Standard curves were plotted as %B/Bo versus pmol of unlabelled IP3, where B is the specific binding of [3H]IP3 (at a given concentration of unlabelled IP3), and Bo is the maximal specific binding of [3H]IP3 (at 0 pmol of unlabelled IP3). A similar calculation was made using values of specific binding of [3H]IP3 of tissue samples and the IP3 content therein determined using the standard curve.

Protein concentrations in tubule samples were assessed by Lowry assays. Three replicate samples were pooled for assay of IP3 content in order to obtain measurable levels of IP3. Duplicate samples were assayed for each experimental sample.

Measurements of [Ca2+]i using an aequorin transgene under heat-shock control
hsGAL4;aeq (Rosay et al., 1997Go) were used as control animals, and protocols used were essentially those previously described. For each assay, 20-40 tubules from 4- 14-day-old adults were dissected in Schneider's medium 2 h after heat-shock (37°C for 30 min). Tubules were pooled in 160µl of the same buffer and aequorin reconstituted with the cofactor coelenterazine (final concentration, 2.5 µmoll-1). Bioluminescence recordings were made with a luminometer (LB9507; Berthold, Pforzheim, Germany); recordings were made every 0.1 s for each tube. Each tube of 20 tubules was used for a single data point: after recording [Ca2+]i levels, tissues were disrupted in 350µl lysis solution [1% (v/v) Triton X-100/100 mmoll-1 CaCl2], causing discharge of the remaining aequorin and allowing estimation of the total amount of aequorin in the sample. Calibration of the aequorin system and calculation of [Ca2+]i were performed as previously described (Rosay et al., 1997Go). Mock injections with Schneider's medium were applied to all samples prior to treatment with neuropeptides.


    Results
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
PLCß contributes to CAP2b and Drosokinin-induced fluid transport
Two norpA alleles of differing severity were available for study. norpAP24 eyes do not express norpA protein, as assessed by western blots, and show markedly reduced PLC activity (Pearn et al., 1996Go); as expected, norpAP24 shows no electroretinogram response to any light stimulus. This allele, therefore, would be expected to display a severe phenotype if norpA acted in tubule function. In norpAH52, however, some norpA transcript is detectable at the restrictive temperature, although this is severely reduced compared with wild type (Bloomquist et al., 1988Go). As such, any epithelial phenotype would not be expected to be as severe as that of norpAP24.

Both norpA mutants manifest an epithelial phenotype (Fig. 1). No significant change in basal secretion rate was observed repeatedly in norpA mutants; however, both alleles, norpAH52 and norpAP24, severely attenuated CAP2b-induced secretion to similar extents (Fig. 1A). By contrast, for Drosokinin-stimulated fluid transport, the norpA alleles were distinguishable (Fig. 1B); in the eye, norpAP24 displays a much more severe phenotype compared with norpAH52. Kinetics of the fluid secretion response in all lines were similar.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. An epithelial phenotype for norpA: phospholipase Cß (PLCß) is required for neuropeptide stimulation of principal and stellate cells. Fluid transport assays were performed on intact tubules from wild-type (Oregon R), norpAH52 and norpAP24 flies as described in the Materials and methods. Either (A) 10-7 moll-1 CAP2b or (B) 10-7 moll-1 Drosokinin were added at 30 min (arrow), and transport rates were measured for a further 30 min. Data are expressed as mean secretion rates ± S.E.M. (N=8).

 

Thus, the data show that fluid transport induced by both CAP2b and Drosokinin requires a PLCß-dependent signalling pathway; as such, norpA function is not confined to phototransduction.

CAP2b and Drosokinin stimulate IP3 production
CAP2b and Drosokinin have both been shown to act through intracellular calcium; so, if their action relies on PLC (Fig. 1), they should also each act to raise IP3 in tubules. Table 1 shows that CAP2b, which acts only on principal cells, increases IP3 levels in intact wild-type tubules. This, together with the data in Fig. 1, shows that CAP2b acts via a phosphoinositide (PI)-PLC-dependent mechanism.


View this table:
[in this window]
[in a new window]
 
Table 1. CAP2b and Drosokinin stimulate IP3 production

 

Aedes leucokinins have been shown to stimulate IP3 production in mosquito tubules (Cady and Hagedorn, 1999Go). However, as Drosokinin exerts its effects solely via stellate cells in Drosophila tubules (Terhzaz et al., 1999Go), and as Drosophila tubules each contain only 22 stellate cells (Sozen et al., 1997Go), Drosokinin-stimulated IP3 levels could not be reliably quantified in intact tubules (data not shown). Accordingly, an in vitro approach was used. Drosophila S2 cells transfected with the Drosokinin receptor have been shown to display increased cytosolic intracellular calcium when stimulated with Drosokinin (Radford et al., 2002Go). Data in Table 1 show that Drosokinin increases IP3 content in these cells by approximately eightfold. As the Drosokinin receptor has been localised to only stellate cells in vivo (Radford et al., 2002Go), it is probable that Drosokinin stimulates IP3 production in stellate cells in intact tubules. As with CAP2b, Drosokinin action requires activation of PI-PLC.

Resting and CAP2b-stimulated levels of IP3 are significantly reduced in itpr mutants
Intracellular signalling is frequently regulated by feedback. If IP3 signalling contributes to the biological effects of neuropeptides in tubules, lesions in the IP3R might feed back to downregulate the IP3 signalling molecule in vivo.

Measurement of basal IP3 levels in wild-type and itpr tubules shows that disruption of IP3R results in a reduction in resting IP3 levels. Significant reductions in basal IP3 levels are observed in heterozygous alleles, homozygous itpr1664/itpr1664 and heteroallelic lines (Fig. 2A).



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 2. Resting and CAP2b-stimulated inositol (1,4,5)-trisphosphate (IP3) levels in itpr mutants. (A) Resting IP3 levels are shown for tubules from the following lines: Oregon R (control), itprXR12/+, itpr90B.0/+, itpr1664/+, itpr1664/itprXR12, itpr1664/itpr90B.0, itpr1664/itpr1664 and itprWC361/itprUG3. In order to aid comparison between experiments, data are shown as the % difference between IP3 levels in itpr mutants compared with wild type (100%) ± S.E.M. (N=4). Typical IP3 content of wild-type tubules was as described in Table 1. (B) CAP2b stimulates IP3 production in itpr lines. Stimulated IP3 levels were measured in CAP2b-stimulated tubules (10-7 moll-1, 5s). Data are expressed as the % increase of unstimulated IP3 levels (calculated as [stimulated IP3]/[resting IP3]x100%; [IP3] measured in pmol µg protein-1) ± S.E.M. (N=3-4). Significant differences between IP3 content in wild-type and itpr lines are denoted by * (P<0.05, Student's t-test, unpaired samples).

 

IP3 levels were also measured in neurohormone-stimulated intact tubules. As Drosokinin-stimulated IP3 production was not measurable in intact tubules, experiments were conducted only on CAP2b-stimulated wild-type and itpr tubules (Fig. 2B). IP3 content is increased in all CAP2b-stimulated itpr tubules, although to a lesser extent in homozygous itpr1664/itpr1664 and heteroallelic itprWC361/itprUG3 lines compared with wild type. However, these differences are not statistically significant. Thus, tubules from itpr mutants are able to generate IP3 in response to CAP2b, suggesting that PI-PLC-dependent signalling is not compromised in these lines.

Diuresis is inhibited by disruption of itpr
As mutations in norpA result in an epithelial phenotype, we investigated the possibility of uncovering such phenotypes in itpr mutants. We show that CAP2b stimulation of fluid transport is inhibited in heterozygous, homozygous and heteroallelic itpr alleles (Fig. 3A). Significant inhibition is observed in itpr90B.0/+, itpr1664/itprXR12 and itpr1664/itpr90B.0. However, CAP2b-stimulated fluid transport is almost completely abolished in the homozygous itpr1664/itpr1664 and heteroallelic itprWC361/itprUG3 lines. It is possible that the non-correlation between the severity of the alleles (itpr1664/itpr90B.0 versus itpr1664/itpr1664) and CAP2b-stimulated transport in these alleles is due to either differences in genetic background or by impact of the mutations on other interacting signalling pathways that are activated by CAP2b.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 3. CAP2b- and Drosokinin-stimulated fluid transport are inhibited in itpr mutants. Fluid transport assays were performed on intact tubules as described in Fig. 1 for the following lines: Oregon R (control), itprXR12/+, itpr90B.0/+, itpr1664/+, itpr1664/itprXR12, itpr1664/itpr90B.0, itpr1664/itpr1664 and itprWC361/itprUG3. Either (A) 10-7 moll-1 CAP2b or (B) 10-7 moll-1 Drosokinin were added at 30 min, and transport rates were measured for a further 30 min. No change in basal secretion rate was observed in itpr mutants. Furthermore, kinetics of the fluid secretion response in all lines were similar (data not shown). To aid comparison between stimulated transport rates, data are expressed as the % stimulation of secretion [(maximal stimulated rates minus the mean of three basal secretion rate readings)/(mean basal rate)x100% ± S.E.M.; N=15-20] upon stimulation with CAP2b or Drosokinin. Stimulated fluid transport rates that are significantly different from wild type are denoted by * (P<0.05, Student's t-test, unpaired samples).

 

By contrast, Drosokinin-stimulated fluid transport is not affected by either heterozygous itprXR12/+, itpr90B.0/+ or itpr1664/+ alleles (Fig. 3B). Significant inhibition is only observed in the heteroallelics itpr1664/itprXR12, itpr1664/itpr90B.0 and itprWC361/itprUG3 and in the homozygous itpr1664/itpr1664. Furthermore, there are marked differences in the severity of inhibition between Drosokinin- and CAP2b-stimulated fluid transport, especially in itpr1664/itpr1664 and itprWC361/itprUG3 alleles.

Thus, itpr acts in both principal and stellate cells to transduce CAP2b and Drosokinin diuretic signals.

Rescue of itpr90B.0 restores CAP2b-stimulated fluid transport levels
Sometimes, phenotypes ascribed to mutant loci in Drosophila are subsequently found to be caused by second-site mutations or other genetic accidents incidental to the original study. It is thus desirable to confirm that mutant effects are genuinely due to the locus of interest. Crosses were established between heterozygous hsGAL4;itpr90B.0 and UAS-itpr homozygotes to allow rescue of itpr90B.0. Tubules from flies with the w/UAS-itpr;+/hsGAL4;+/itpr90B.0 genotype were used in transport assays. Control lines used were OrR and UAS-itpr. Non-heat-shocked w/UAS-itpr;+/hsGAL4;+/itpr90B.0 were not used as controls, as the heat-shock promoter is `leaky' and is transcribed at 25°C (G. Hasan, unpublished).

Fig. 4 shows that expression of itpr restores CAP2b-stimulated fluid transport to levels indistinguishable from wild-type. Although disruption of itpr may compromise associated signalling pathways resulting in downregulation of CAP2b-stimulated transport, successful rescue of itpr90B.0/+ with USA-itpr provides strong evidence that the epithelial phenotype observed in this line is associated with mutated itpr.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4. itpr rescues the transport phenotype of the itpr90B.0 allele. Fluid transport assays were performed on the hsGAL4;itpr90B.0 line. The data show that CAP2b-stimulated fluid transport is decreased in this line. Rescue of hsGAL4;itpr90B.0 with UAS-itpr results in wild-type levels of stimulated fluid transport. Fluid secretion rates were measured for 30 min prior to addition of neuropeptide (arrow), after which measurements were taken for a further 30 min. Data are expressed as mean fluid secretion rates (nl min-1) ± S.E.M. (N=6-10). UAS-itpr tubules display similar secretion rates to those of wild-type tubules (data not shown).

 

CAP2b-induced calcium signalling is impaired in itpr mutants
Previous work has shown that capa peptides (Kean et al., 2002Go) increase intracellular calcium in tubule main segment principal cells (Rosay et al., 1997Go) via plasma membrane calcium channels (MacPherson et al., 2000Go, 2001Go). However, release from intracellular stores is not measurable in this cell type (Rosay et al., 1997Go), thus calling into question the role of IP3R-sensitive stores in principal cells. If release of calcium from IP3-sensitive internal stores does occur upon CAP2b stimulation, changes in this response may be observed in itpr mutants.

Using targeted aequorin, cytosolic calcium measurements in wild-type and itpr tubules stimulated with CAP2b were performed; typical traces are shown in Fig. 5A. Fig. 5Ai shows the biphasic rise, consisting of a rapid primary peak followed by a slow secondary rise in cytosolic calcium in CAP2b-stimulated wild-type aeq;hsGAL4 tubules. This calcium signature is also observed in capa/CAP2b-stimulated wild-type tubules (Kean et al., 2002Go). The response is reduced in heterozygous itpr alleles, aeq;hsGAL4;itprXR12/+ and aeq;hsGAL4;itpr90B.0/+ (Fig. 5B), which may result in the transport phenotype observed. Interestingly, in heterozygous itpr1664/+, the primary response is unaffected, with only the secondary response being reduced; in this line, stimulated fluid transport is not significantly different from control (Fig. 3A). By contrast, the alleles that display the most severe transport phenotype (itpr1664/itpr1664 and itprWC361/itprUG3) also display an attenuated calcium response to CAP2b (Fig. 5Av,vi,B). Both reduction in the primary peak and loss of the secondary rise are observed in these lines. However, none of the itpr alleles completely abolish CAP2b-stimulated calcium signalling. This is consistent with itpr being an essential gene and with viable alleles all being hypomorphs rather than nulls.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5. CAP2b-induced cytosolic calcium signals in itpr mutants. (A) Typical traces of changes in intracellular Ca2+ concentration ([Ca2+]i) in tubule principal cells stimulated by 10-7 moll-1 CAP2b (arrows) in the following lines: (i) aeq;hsGAL4;+ (control), (ii) aeq;hsGAL4;itprXR12/+, (iii) aeq;hsGAL4;itpr90B.0/+, (iv) aeq;hsGAL4;itpr1664/+, (v) aeq;hsGAL4;itpr1664/itpr1664 and (vi) aeq;hsGAL4;itprWC361/itprUG3. Each sample contains 20 intact tubules. While no changes in the resting [Ca2+]i is seen in any of the mutants, changes in amplitude of the primary and/or secondary response can be observed in all lines (also in B). (B) Pooled results of changes in tubule [Ca2+]i in itpr mutants in response to 10-7 moll-1 CAP2b are shown. Results are expressed as means ± S.E.M. (N=8) for background (open bars), CAP2b-stimulated primary peaks (filled bars) and CAP2b-stimulated secondary peaks (hatched bars) for the lines described in A. The measure of secondary peak is taken as the average [Ca2+]i over 4 min post-stimulation with CAP2b. CAP2b-stimulated primary peaks that are significantly different from aeq;hsGAL4 tubules are denoted by *, and statistically significant differences in secondary peaks compared to wild type are denoted by {dagger} (P<0.05, Student's t-test, unpaired samples).

 

These results thus suggest that IP3R-mediated calcium release from intracellular stores contributes significantly to calcium signalling, and consequent diuresis, in principal cells.

itpr mutants reduce Drosokinin-induced calcium signals
We have shown previously that leucokinin (Rosay et al., 1997Go; O'Donnell et al., 1998Go) and endogenous Drosophila leucokinin (Terhzaz et al., 1999Go) elevate intracellular calcium levels in stellate cells. Furthermore, experiments in calcium-free medium show that stellate cells display emptying of intracellular calcium stores in the presence of the ER-calcium ATPase inhibitor, thapsigargin (Rosay et al., 1997Go). Thus, Drosokinin-stimulated calcium increases should be reduced in itpr mutants.

Data in Fig. 6A show typical traces of Drosokinin-stimulated increases in cytosolic calcium in wild-type and itpr tubules. A rapid response is observed in wild-type tubules (Fig. 6Ai; Terhzaz et al., 1999Go; Radford et al., 2002Go). This response is severely reduced in itpr1664/itpr1664 and itprWC361/itprUG3 flies (Fig. 6Av,vi,B). Drosokinin-stimulated fluid transport is also reduced in these lines (Fig. 3B); thus, functional IP3R contributes to Drosokinin-stimulated calcium signalling and fluid transport.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 6. Drosokinin-induced cytosolic calcium signals in itpr mutants. (A) Typical traces of changes in intracellular Ca2+ concentration ([Ca2+]i) in tubule stellate cells stimulated by 10-7 mol l-1 Drosokinin (arrows) in the following lines: (i) aeq;hsGAL4;+ (control), (ii) aeq;hsGAL4; itprXR12/+, (iii) aeq;hsGAL4;itpr90B.0/+, (iv) aeq;hsGAL4;itpr1664/+, (v) aeq;hsGAL4;itpr1664/itpr1664 and (vi) aeq;hsGAL4;itprWC361/itprUG3. Each sample contains 20 intact tubules. While no changes in the resting [Ca2+]i is seen in any of the mutants, changes in amplitude of the calcium peak can be observed in aeq;hsGAL4;itpr1664/itpr1664 and aeq;hsGAL4;itprWC361/itprUG3 (also in B). (B) Pooled results of changes in tubule [Ca2+]i in itpr mutants in response to 10-7 moll-1 Drosokinin. Results are expressed as means ± S.E.M. (N=8) for background (open bars) and Drosokinin-stimulated peaks (filled bars) for the lines described in A. Drosokinin-stimulated primary peaks that are significantly different from aeq;hsGAL4;+ tubules are denoted by * (P<0.05, Student's t-test, unpaired samples).

 


    Discussion
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The role of PLC in vivo has been most studied in Drosophila phototransduction. Experimental evidence suggested that norpA and plc21 were expressed in the eye or CNS (Bloomquist et al., 1988Go; Shortridge et al., 1991Go); furthermore, the dependence of phototransduction on PI-PLC supported specific roles for these genes in the eye. However, RT-PCR data show that norpA and plc21 are both expressed in tubules (M. R. MacPherson and V. P. Pollock, unpublished). We have shown here that norpA mutants display an epithelial phenotype, which is revealed upon neuropeptide stimulation. Furthermore, the severity of the epithelial response for each allele correlates with that observed in the eye and also with the levels of expression of norpA and biochemical activity of PLC. However, while we have established an epithelial role for norpA, it has been difficult to assess the contribution of plc21 to epithelial transport and signalling due to our lack of genetic tools and suitable antibodies.

IP3 and IP3R have been shown to be critical for calcium signalling in non-excitable cells via a mechanism of IP3-induced release of calcium from internal stores. Previous work has shown that IP3R is expressed in Malpighian tubules (Pollock et al., 2000Go; Blumenthal, 2001Go). We now ascribe functional significance to this finding and show that CAP2b stimulates IP3 production in intact Drosophila tubules. Furthermore, we show that Drosokinin mobilises IP3 in Drosokinin receptor-transfected S2 cells.

A role for IP3R in neurohormone-stimulated epithelial transport has been demonstrated using an allelic series of itpr mutants. These itpr lines have been extensively investigated previously in order to determine the role of IP3R in vivo. itprXR12/+ (inversion), itpr90B.0/+ (null) and itpr1664/+ (hypomorph) display delayed moulting and reduced expression of the ecdysone-inducible gene E74. In terms of severity, itpr90B.0 and itprXR12 are the most severe alleles (Venkatesh and Hasan, 1997Go). These lines, as well as itprWC361/itprUG3, have also been used in studies of olfaction, where it has been shown that, in the most severe alleles, olfactory adaptation is not maintained (Deshpande et al., 2000Go). CAP2b-stimulated epithelial transport is reduced in the null mutant (itpr90B.0) compared with wild-type tubules, while the most severe phenotypes are observed in itpr1664 homozygotes and the heteroallelics. Rescue of the itpr90B.0 transport phenotype is demonstrated with UAS-itpr, which strongly suggests that the tubule phenotype is associated with disruption in IP3R. Interestingly, while the null mutant displays a phenotype upon CAP2b stimulation, only the most severe itpr1664 homozygotes and the heteroallelics affect Drosokinin-stimulated secretion. Therefore, reduced CAP2b-stimulated fluid transport in itpr90B.0 may be due to principal cell-specific signalling processes associated with the null mutation.

Intriguingly, resting levels of IP3 in tubules are significantly reduced in all itpr mutants apart from itpr1664/itprXR12, suggesting a possible feedback mechanism between receptor (IP3R) and second messenger (IP3). However, this is not associated with an epithelial phenotype, as no difference in basal rate is observed in tubules from itpr lines as compared to wild-type flies.

We have previously shown that the neuropeptide CAP2b induces a rise in cytosolic calcium in only principal cells that is dependent on extracellular calcium; these calcium signalling events, which may mediate NO/cGMP signalling, correlate with CAP2b-stimulated fluid transport. The CAP2b-induced response is abolished by L-type calcium channel inhibitors and also in mutants for the plasma membrane calcium channels, TRP and TRPL (MacPherson et al., 2000Go, 2001Go). Thus, CAP2b-induced calcium signalling occurs via multichannel mechanisms. We demonstrate here that IP3R plays a role in CAP2b-induced calcium signalling (Fig. 5). Extensive work using norpA mutants has shown that norpA-encoded PLC plays a critical role in rhabdomeres. Thus, PLCß, which is required for the cleavage of phosphatidylinositol (4,5)-bisphosphate (PIP2) to IP3 and diacylglycerol (DAG), is necessary for phototransduction. Interestingly, however, using the itpr null and itpr1664 mutants, IP3 signalling has been shown to be unnecessary to activate light-activated conductance (Raghu et al., 2000aGo). This response is, however, dependent on calcium entry via TRP/TRPL channels. DAG has been shown to activate native TRP and TRPL channels in photoreceptors and recombinant TRPL channels (Chyb et al., 1999Go). Furthermore, recent studies have supported the role of DAG in TRP/TRPL action: DAG kinase mutants display constitutive activation of TRP and TRPL channels (Raghu et al., 2000bGo), and, in vertebrate cells, TRPC3 (transient receptor potential-like channel 3) has been shown to be activated by DAG independently of IP3R (Venkatachalam et al., 2001Go). Thus, PLC is involved in regulation of TRP/TRPL plasma membrane calcium channels without a requirement for IP3. It is possible, then, that PLC-activated DAG generation may regulate TRP/TRPL channels in tubules, which may contribute significantly to the `multichannel' mode of action of CAP2b. Furthermore, if DAG/TRP/TRPL signalling were compromised in some itpr lines, this may explain the significant impact of itpr alleles (for example, itpr null) on CAP2b-stimulated, but not Drosokinin-stimulated, fluid transport and calcium signalling (Figs 3, 5).

Previous work has shown that leucokinin and Drosokinin increase cytosolic calcium concentration in only stellate cells in tubules, which express the Drosokinin receptor (Rosay et al., 1997Go; Terhzaz et al., 1999Go; Radford et al., 2002Go). This suggests that IP3-mediated calcium signalling may occur in stellate cells. Activation of calcium signalling may be linked to chloride shunt conductance, which is also confined to stellate cells (O'Donnell et al., 1998Go). It is thus possible that Drosokinin stimulates PLCß-dependent, IP3-mediated calcium signalling in stellate cells in vivo, which increases chloride conductance, resulting in increased fluid transport.

Thus, Malpighian tubules, in contrast to photoreceptors, require both functional PLCß and IP3R for neuropeptide-activated signal transduction in principal and stellate cells. The expression of plc21 in tubules, however, and the role of DAG on plasma membrane calcium channels suggest that extremely complex mechanisms of signalling are used by tubule cells.

In summary, we have demonstrated non-neuronal, epithelial phenotypes for norpA (PLCß) and itpr (IP3R) and have correlated cell-specific signalling events for both IP3 and calcium to transport phenotypes.


    Acknowledgments
 
This work was supported by the BBSRC.


    References
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

Berridge, M. J. (1997). Elementary and global aspects of calcium signalling. J. Exp. Biol. 200,315 -319.[Abstract]

Bloomquist, B. T., Shortridge, R. D., Schneuwly, S., Perdew, M., Montell, C., Steller, H., Rubin, G. and Pak, W. L. (1988). Isolation of a putative phospholipase C gene of Drosophila, norpA, and its role in phototransduction. Cell 54,723 -733.[CrossRef][Medline]

Blumenthal, E. M. (2001). Characterization of transepithelial potential oscillations in the Drosophila Malpighian tubule. J. Exp. Biol. 204,3075 -3084.[Abstract/Free Full Text]

Cady, C. and Hagedorn, H.E. (1999). Effects of putative diuretic factors on intracellular second messenger levels in the Malpighian tubules of Aedes aegypti. J. Insect. Physiol. 45,327 -337.[CrossRef][Medline]

Chyb, S., Raghu, P. and Hardie, R. C. (1999). Polyunsaturated fatty acids activate the Drosophila light-sensitive channels TRP and TRPL. Nature 397,255 -259.[CrossRef][Medline]

Davies, S. A., Huesmann, G. R., Maddrell, S. H. P., O'Donnell, M. J., Skaer, N. J. V., Dow, J. A. T. and Tublitz, N. J. (1995). CAP2b, a cardioacceleratory peptide, is present in Drosophila and stimulates tubule fluid secretion via cGMP. Am. J. Physiol. 269,R1321 -R1326.[Abstract/Free Full Text]

Deshpande, M., Venkatesh, K., Rodrigues, V. and Hasan, G. (2000). The inositol 1,4,5-trisphosphate receptor is required for maintenance of olfactory adaptation in Drosophila antennae. J. Neurobiol. 43,282 -288.[CrossRef][Medline]

Dow, J. A., Maddrell, S. H., Gortz, A., Skaer, N. J., Brogan, S. and Kaiser, K. (1994). The Malpighian tubules of Drosophila melanogaster: a novel phenotype for studies of fluid secretion and its control. J. Exp. Biol. 197,421 -428.[Abstract]

Dow, J. A. T. and Davies, S. A. (2001). The Drosophila melanogaster Malpighian tubule. Adv. Insect Physiol. 28,1 -83.

Hardie, R. C. and Raghu, P. (1998). Activation of heterologously expressed Drosophila TRPL channels: Ca2+ is not required and InsP3 is not sufficient. Cell Calcium 24,153 -163.[CrossRef][Medline]

Hardie, R. C. and Raghu, P. (2001). Visual transduction in Drosophila. Nature 413,186 -193.[CrossRef][Medline]

Harteneck, C., Plant, T. D. and Schultz, G. (2000). From worm to man: three subfamilies of TRP channels. Trends Neurosci. 23,159 -166.[CrossRef][Medline]

Hasan, G. and Rosbash, M. (1992). Drosophila homologs of two mammalian intracellular Ca(2+)-release channels: identification and expression patterns of the inositol 1,4,5-triphosphate and the ryanodine receptor genes. Development 116,967 -975.[Abstract]

Kean, L., Cazenave, W., Costes, L., Broderick, K. E., Graham, S., Pollock, V. P., Davies, S. A., Veenstra, J. A. and Dow, J. A. (2002). Two nitridergic peptides are encoded by the gene capability in Drosophila melanogaster. Am. J. Physiol. Regul. Integr. Comp. Physiol. 282,R1297 -R1307.[Abstract/Free Full Text]

MacPherson, M. R., Pollock, V. P., Broderick, K. B., Dow, J. A. and Davies, S. A. (2000). The role of TRP channels in epithelial fluid transport. A. Dros. Res. Conf. 41, 816B.

MacPherson, M. R., Pollock, V. P., Broderick, K. B., Kean, L., O'Connell, F. C., Dow, J. A. T. and Davies, S.-A. (2001). Model organisms: New insights into ion channel and transporter function: L-type calcium channels regulate epithelial fluid transport in Drosophila melanogaster. Am. J. Physiol. Cell Physiol. 280,C394 -C407.[Abstract/Free Full Text]

O'Donnell, M. J., Rheault, M. R., Davies, S. A., Rosay, P., Harvey, B. J., Maddrell, S. H. P., Kaiser, K. and Dow, J. A. T. (1998). Hormonally-controlled chloride movement across Drosophila tubules is via ion channels in stellate cells. Am. J. Physiol. 43,R1039 -R1049.

Pak, W. L., Grossfield, J. and Arnold, K. (1970). Mutants of the visual pathway of Drosophila melanogaster. Nature 227,518 -520.[Medline]

Palmer, S., Hughes, K. T., Lee, D. Y. and Wakelam, M. J. (1989). Development of a novel, Ins(1,4,5)P3-specific binding assay. Its use to determine the intracellular concentration of Ins(1,4,5)P3 in unstimulated and vasopressin-stimulated rat hepatocytes. Cell Signal 1,147 -156.[CrossRef][Medline]

Pearn, M. T., Randall, L. L., Shortridge, R. D., Burg, M. G. and Pak, W. L. (1996). Molecular, biochemical, and electrophysiological characterization of Drosophila norpA mutants. J. Biol. Chem. 271,4937 -4945.[Abstract/Free Full Text]

Pollock, V. P., Davies, S. A., Hasan, G. and Dow, J. A. T. (2000). Disruption of the IP3R gene in Drosophila melanogaster affects epithelial function. Comp. Biochem. Physiol. A 126, S121.

Putney, J. W. J. (1997). Type 3 inositol 1,4,5-trisphosphate receptor and capacitative calcium entry. Cell Calcium 21,257 -261.[CrossRef][Medline]

Radford, J. C., Davies, S. A. and Dow, J. A. T. (2002). Systematic GPCR analysis in Drosophila melanogaster identifies a leucokinin receptor with novel roles. J. Biol. Chem. 277,38810 -38817.[Abstract/Free Full Text]

Raghu, P., Colley, N. J., Webel, R., James, T., Hasan, G., Danin, M., Selinger, Z. and Hardie, R. C. (2000a). Normal phototransduction in Drosophila photoreceptors lacking an InsP(3) receptor gene. Mol. Cell Neurosci. 15,429 -445.[CrossRef][Medline]

Raghu, P., Usher, K., Jonas, S., Chyb, S., Polyanovsky, A. and Hardie, R. C. (2000b). Constitutive activity of the light-sensitive channels TRP and TRPL in the Drosophila diacylglycerol kinase mutant, rdgA. Neuron 26,169 -179.[CrossRef][Medline]

Rosay, P., Davies, S. A., Yu, Y., Sozen, M. A., Kaiser, K. and Dow, J. A. T. (1997). Cell-type specific calcium signalling in a Drosophila epithelium. J. Cell Sci. 110,1683 -1692.[Abstract]

Shortridge, R. D., Yoon, J., Lending, C. R., Bloomquist, B. T., Perdew, M. H. and Pak, W. L. (1991). A Drosophila phospholipase C gene that is expressed in the central nervous system. J. Biol. Chem. 266,12474 -12480.[Abstract/Free Full Text]

Sozen, H. A., Armstrong, J. D., Yang, M. Y., Kaiser, K. and Dow, J. A. T. (1997). Functional domains are specified to single-cell resolution in a Drosophila epithelium. Proc. Natl. Acad. Sci. USA 94,5207 -5212.[Abstract/Free Full Text]

Terhzaz, S., O'Connell, F. C., Pollock, V. P., Kean, L., Davies, S. A., Veenstra, J. A. and Dow, J. A. (1999). Isolation and characterization of a leucokinin-like peptide of Drosophila melanogaster.J. Exp. Biol. 202,3667 -3676.[Abstract]

Venkatachalam, K., Ma, H. T., Ford, D. L. and Gill, D. L. (2001). Expression of functional receptor-coupled TRPC3 channels in DT40 triple receptor InsP3 knockout cells. J. Biol. Chem. 276,33980 -33985.[Abstract/Free Full Text]

Venkatesh, K. and Hasan, G. (1997). Disruption of the IP3 receptor gene of Drosophila affects larval metamorphosis and ecdysone release. Curr. Biol. 7, 500-509.[CrossRef][Medline]

Venkatesh, K., Siddhartha, G., Joshi, R., Patel, S. and Hasan, G. (2001). Interactions between the inositol 1,4,5-trisphosphate and cyclic AMP signaling pathways regulate larval molting in Drosophila. Genetics 158,309 -318.[Abstract/Free Full Text]

Yoshikawa, S., Tanimura, T., Miyawaki, A., Nakamura, M., Yuzaki, M., Furuichi, T. and Mikoshiba, K. (1992). Molecular cloning and characterization of the inositol 1,4,5-trisphosphate receptor in Drosophila melanogaster. J. Biol. Chem. 267,16613 -16619.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J. Exp. Biol.Home page
E. M. Blumenthal
Isoform- and cell-specific function of tyrosine decarboxylase in the Drosophila Malpighian tubule
J. Exp. Biol., December 1, 2009; 212(23): 3802 - 3809.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
S. A. Davies and S. Terhzaz
Organellar calcium signalling mechanisms in Drosophila epithelial function
J. Exp. Biol., February 1, 2009; 212(3): 387 - 400.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
T. D. Southall, S. Terhzaz, P. Cabrero, V. R. Chintapalli, J. M. Evans, J. A. T. Dow, and S.-A. Davies
Novel subcellular locations and functions for secretory pathway Ca2+/Mn2+-ATPases
Physiol Genomics, September 14, 2006; 26(1): 35 - 45.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Terhzaz, T. D. Southall, K. S. Lilley, L. Kean, A. K. Allan, S. A. Davies, and J. A. T. Dow
Differential Gel Electrophoresis and Transgenic Mitochondrial Calcium Reporters Demonstrate Spatiotemporal Filtering in Calcium Control of Mitochondria
J. Biol. Chem., July 7, 2006; 281(27): 18849 - 18858.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
E. M. Blumenthal
Modulation of tyramine signaling by osmolality in an insect secretory epithelium
Am J Physiol Cell Physiol, November 1, 2005; 289(5): C1261 - C1267.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. R. MacPherson, V. P. Pollock, L. Kean, T. D. Southall, M. E. Giannakou, K. E. Broderick, J. A. T. Dow, R. C. Hardie, and S. A. Davies
Transient Receptor Potential-Like Channels Are Essential for Calcium Signaling and Fluid Transport in a Drosophila Epithelium
Genetics, March 1, 2005; 169(3): 1541 - 1552.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
P. Cabrero, V. P. Pollock, S. A. Davies, and J. A. T. Dow
A conserved domain of alkaline phosphatase expression in the Malpighian tubules of dipteran insects
J. Exp. Biol., September 1, 2004; 207(19): 3299 - 3305.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. E. Broderick, L. Kean, J. A. T. Dow, N. J. Pyne, and S. A. Davies
Ectopic Expression of Bovine Type 5 Phosphodiesterase Confers a Renal Phenotype in Drosophila
J. Biol. Chem., February 27, 2004; 279(9): 8159 - 8168.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
M.-J. Yu and K. W. Beyenbach
Effects of leucokinin-VIII on Aedes Malpighian tubule segments lacking stellate cells
J. Exp. Biol., February 1, 2004; 207(3): 519 - 526.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pollock, V. P.
Right arrow Articles by Davies, S.-A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pollock, V. P.
Right arrow Articles by Davies, S.-A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?