|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
Vacuolar-type proton pump in the basolateral plasma membrane energizes ion uptake in branchial mitochondria-rich cells of killifish Fundulus heteroclitus, adapted to a low ion environment
Ocean Research Institute, University of Tokyo, 1-15-1 Minamidai, Nakano, Tokyo 164-8639, Japan
* Author for correspondence (e-mail: fkatoh{at}ori.u-tokyo.ac.jp)
Accepted 21 November 2002
| Summary |
|---|
|
|
|---|
Key words: mitochondria-rich cell, ion uptake, gill epithelia, freshwater-adapted, killifish, Fundulus heteroclitus, V-ATPase
| Introduction |
|---|
|
|
|---|
The killifish Fundulus heteroclitus is a euryhaline species that
can be adapted to a wide range of salinities
(Griffith, 1974
;
Hardy, 1978
). Killifish
branchial MR cells are larger in freshwater than in seawater
(Katoh et al., 2001
). By
contrast, in most fish examined so far, seawater-type MR cells are more
developed in terms of cell size, extension of the tubular system, density of
mitochondria and Na+/K+-ATPase activity
(Langdon and Thorpe, 1985
;
Richman et al., 1987
;
McCormick, 1995
; Uchida et
al., 1996
,
2000
;
Sasai et al., 1998
). In
freshwater-adapted killifish, the apical membrane of branchial MR cells show
projections with microvilli that expand the apical surface area, suggesting
active ion absorption through MR cells
(Katoh et al., 2001
).
The Na+/H+-exchanger (NHE) in the apical membrane of
gill MR cells has been advocated as the major pathway for Na+
uptake and H+ excretion in freshwater teleosts. However, it is now
considered less likely that Na+ uptake occurs via NHE,
since the driving force for such uptake is lacking in this model
(Lin and Randall, 1993
).
Meanwhile, an alternative model incorporating the vacuolar-type proton pump
(V-ATPase) and a conductive Na+ channel has been proposed as the
Na+- absorbing mechanism. In this model, V-ATPase in the apical
membrane and Na+/K+-ATPase in the basolateral membrane
create the driving force permitting passive electrodiffusion of Na+
through the Na+ channel (Avella
and Bornancin, 1989
). This model has been supported by inhibitory
effects of bafilomycin A1, a selective inhibiter of V-ATPase, on
H+ secretion and N+ absorption in frog skins
(Klein et al., 1997
).
Furthermore, Fenwick et al.
(1999
) reported that
bafilomycin A1 inhibits not only Na+ but also
Cl- uptake in gills of tilapia larvae and carp, suggesting a link
between Cl- uptake and H+ secretion by V-ATPase.
V-ATPase is one type of ATP-dependent proton pump that is responsible for
the acidification of intracellular compartments of eukaryotic cells
(Forgac, 1999
). V-ATPase also
energizes animal plasma membranes (Harvey
and Wieczorek, 1997
), and is composed of a catalytic V1
domain responsible for ATP hydrolysis and an integral V0 domain
that forms a channel for H+ to cross the plasma or vacuolar
membranes (Forgac, 1999
). Most
studies on V-ATPase in fish have been performed in the context of
acidbase regulation (Lin et al.,
1994
; Sullivan et al.,
1996
; Perry et al.,
2000
). Although the gills have been identified as the site of
V-ATPase activity, the cellular localization of V-ATPase in the gills is still
controversial. Immunocytochemical studies with heterologous antibodies have
shown that V-ATPase is distributed in both MR and pavement cells in rainbow
trout Oncorhynchus mykiss (Lin et
al., 1994
; Wilson et al.,
2000a
), and in pavement cells but not in MR cells in tilapia
Oreochromis mossambicus (Hiroi et
al., 1998
; Wilson et al.,
2000a
).
In this study, we investigated effects of environmental NaCl concentrations on the morphology and function of gill MR cells in killifish. The MR cell morphology was compared in fish acclimated to defined fresh waters with different NaCl concentrations. Furthermore, to examine the possible involvement of V-ATPase in Na+ and Cl- uptake through gill epithelia, we cloned and sequenced a cDNA encoding the A-subunit of killifish V-ATPase. Using a homologous antibody specific for killifish V-ATPase, we also examined the immunolocalization of V-ATPase in the gill epithelia by light and electron microscopy.
| Materials and methods |
|---|
|
|
|---|
|
Tissue sampling for morphological observations
The fish were anesthetized with 0.05% 2-phenoxyethanol and blood was
collected from the caudal vessels into capillary tubes. The plasma was
separated by centrifugation at 4000 g for 5 min. Plasma osmolality
was measured with a vaporpressure osmometer (Wascor 5500, UT, USA). Plasma
Na+ concentrations were measured using an atomic absorption
spectrophotometer (Hitachi Z-5300, Japan). For the measurement of
Na+/K+-ATPase activity, gill filaments were removed from
the gill arch and stored in 200 µl of buffer containing 150 mmol
l-1 sucrose, 10 mmol l-1 Na2 EDTA and 50 mmol
l-1 imidazole (SEI buffer) at -80°C until analysis. For
whole-mount immunocytochemistry, the gills were removed and fixed in 4%
paraformaldehyde (PFA) in 0.1 moll-1 phosphate buffer (PB, pH 7.4)
for 24h. For transmission (TEM) and scanning (SEM) electron microscopy, the
gills were fixed in 2% PFA-2% glutaraldehyde (GA) in 0.1 moll-1 PB
for 24h, postfixed in 1% osmium tetroxide in 0.1 moll-1 PB for 1 h,
and stored in 70% ethanol. For light- and electronmicroscopic
immunocytochemistry, the gill filaments were fixed in 2% PFA-0.2% GA in 0.1
moll-1 PB for 3 h, and stored in 70% ethanol. For each experimental
group, we examined five animals for the whole-mount immunocytochemistry and
three for the electron microscopy.
Measurement of gill Na+/K+-ATPase activity
Gill Na+/K+-ATPase activity was measured by a
microassay method (Katoh et al.,
2001
). After 50 µl of SEI buffer containing 0.5% sodium
deoxycholic acid was added, the gill filaments stored in 200 µl of SEI
buffer were homogenized with a motorized Polytron homogenizer on ice and
centrifuged at 3000 g for 10 s to remove insoluble material. The
supernatant was assayed for Na+/K+-ATPase activity and
protein content. Homogenate samples (10 µl) were placed in the wells of a
96-well plate in quadruplicate. The assay mixture (200 µl) with or without
0.5 mmol l-1 ouabain was added to the wells in duplicate just
before reading absorbance at a wavelength of 340 nm. The linear rate of NADH
disappearance was measured every 2 min up to 10 min. The protein content of
the sample was determined using a BCA Protein Assay Kit (Pierce, IL, USA). The
Na+/K+-ATPase activity was calculated as the difference
in ATP hydrolysis between the presence and absence of ouabain, and expressed
as µmol ADP mg protein-1 h-1.
Molecular identification of the A-subunit of V-ATPase
The fish acclimated to a low-NaCl environment were anesthetized with 0.05%
2-phenoxyethanol. The gill filaments were dissected out, frozen in liquid
N2, and stored at -80°C.
Total RNA was extracted from the gill filaments by the AGPC method
described by Chomczynski and Sacchi
(1987
). Poly(A)+ RNA
purified with Oligotex-dT30 Super (JSR and Nippon Roche, Japan) was treated
with the reagents in a Kit (Smart cDNA Library Construction Kit, Clontech
Laboratories, CA, USA) to obtain double-stranded cDNAs with 3' and
5' terminal adapters. Polymerase chain reactions (PCRs) were performed
using high-fidelity Ex-Taq DNA polymerase (Takara, Japan). The resulting
products were ligated into a pT7Blue T-Vector (Novagen, Germany), and then the
nucleotide sequences were determined in an automated DNA sequencer (PRISM 310,
Perkin-Elmer/Applied Biosystems, CA, USA). The sequences were compared using
Genetix-Mac software.
Degenerate PCR primers were designed on the basis of sequences from
selected animals (Pan et al.,
1991
; Graf et al.,
1992
; Sander et al.,
1992
; Hille et al.,
1993
; Hernando et al.,
1995
; Gill et al.,
1998
) to obtain a partial cDNA fragment of killifish V-ATPase
A-subunit, sense: VATPAf1, GA (A/G) TA(C/T) TT(C/T)(A/C) G (A/C/G/T) GA(C/T)
ATGGG; antisense: VATPAr3, CCA (A/G) AA (A/C/G/T) AC(C/T) TG (A/C/G/T) AC
(A/G/T) AT (A/C/G/T) CC (Fig.
4). After an initial denaturation at 96C for 2 min, 30 cycles of
PCR were performed, each consisting of 50s denaturation at 94°C, 30 s
annealing at 50°C and 90 s extension at 72°C. Gene-specific primers
VATPAf4 and VATPAr1, were designed for the 3'- and 5'-RACE method,
respectively: VATPf4, TGGCGGTGACTTCTCTGACC; and VATPr1, CCAACGCGAGGTGGAGTCGG
(Fig. 4). VATPAf4 and CDS
III/3' PCR primer (Smart cDNA Library Construction Kit), and VATPAr1 and
5' PCR primer (Smart cDNA Library Construction Kit) were applied to
amplify the 3' and 5' ends, respectively. After a 2 min initial
denaturation at 96°C, 35 cycles of PCR were performed as stated above
except that the annealing was conducted at 60°C.
|
To confirm the nucleotide sequence obtained by the 5'- and 3'-RACE method, two gene-specific primers were designed: sense, VATPAf5; CAGCTGACCTCAGCTTACCGTCACG and antisense, VATPAr6; CACACTTGCACATTCACCCACAGAG (Fig. 4). After an initial denaturation at 96°C for 2 min, 35 cycles of the above-mentioned PCR were performed, but the reactions involved 30 s annealing at 57°C and 3 min extension at 72°C.
Antibody
A polyclonal antiserum was raised in a rabbit against a synthetic peptide
based on the highly conserved and hydrophilic region in the A-subunit of
V-ATPase. The antigen designed was
Cys-Ala-Glu-Met-Pro-Ala-Asp-Ser-Gly-Tyr-Pro-Ala-Tyr-Leu-Gly-Ala-Arg. The
antigen conjugated with keyhole limpet hemocyanin (KLH) was emulsified with
complete Freund's adjuvant, and immunization was performed in a New Zealand
white rabbit (Sawady Technology, Japan). The antibody was affinity-purified
using the synthetic peptide.
Western blot analysis
The specificity of the raised antibody, named VATP317, was confirmed using
western blot analysis. Membrane fractions were prepared from the gills of
killifish adapted to low-NaCl freshwater. The gills were homogenized on ice in
a buffer consisting of 25 mmol l-1 Tris-HCl (pH 7.4), 0.25
moll-1 sucrose and a pellet (50 ml-1) of Complete
Protein Inhibitor (Boehringer Mannheim, Germany). The homogenate was initially
centrifuged at 4500 g for 15 min, and the supernatant was
subjected to a second centrifugation at 200 000 g for 1 h. The
pellet was resuspended in the same buffer. All the above procedures were
performed at 4°C. The protein content of the sample was quantified with a
BCA Protein Assay Kit (Pierce). The samples (10 µg) were solubilized in a
sample-loading buffer, (0.25 moll-1 Tris-HCl, pH 6.8, 2% sodium
dodecyl sulfate (SDS), 10% ß-mercaptoethanol, 30% glycerol and 0.01%
Bromophenol Blue) and heated at 70°C for 15 min. They were separated by
SDS-polyacrylamide gel electrophoresis using 7.5% polyacrylamide gels. After
electrophoresis, the protein was transferred from the gel to a polyvinyliden
difluoride membrane (Atto, Japan).
The membranes were pre-incubated in 50 mmol l-1 Tris-buffered saline (TBS, pH 7.6) containing 0.05% Triton X-100 and 2% skimmed milk at 4°C overnight, and incubated with the antibody diluted at 1:100 with NB-PBS [0.01 moll-1 phosphate-buffered saline (PBS, pH 7.4) containing 2% normal goat serum (NGS), 0.1% bovine serum albumin (BSA), 0.02% KLH and 0.01% sodium azide] for 1 h at room temperature. The specificity of the immunoreactivity was confirmed by incubating the membranes with the antibody pre-absorbed with the synthetic peptide (1 µg ml-1). After rinsing in washing buffer (TBS, 0.05% Triton X-100), the membranes were stained by the avidinbiotinperoxidase complex (ABC) method, using commercial reagents (Vectastain ABC kit, Vector Laboratories, CA, USA).
Confocal laser scanning microscopy
For the detection of chloride cells in the whole-mount preparations of the
gill filaments, we used an antibody specific for
Na+/K+-ATPase. The antiserum (NAK121) was raised in a
rabbit against a synthetic peptide corresponding to part of the highly
conserved region of the Na+/K+-ATPase
-subunit
(Katoh et al., 2000
), which
was based on the method described by Ura et al.
(1996
). The specific antibody
was affinity-purified and labeled with fluorescein isothiocyanate (FITC) as a
fluorescent marker. The specificity of the antibody had been confirmed by
western blot analysis (Katoh et al.,
2000
).
The gill filaments were removed from the gill arch prior to the whole-mount immunocytochemistry. After washing in 0.01 moll-1 PBS, the whole-mount preparations of the gill filaments were incubated overnight at 4°C with FITC-labeled NAK121 diluted 1:500 v/v with PBS containing 0.05% Triton X-100, 10% NGS, 0.1% BSA, 0.02% KLH and 0.01% sodium azide. The samples were then washed in PBS for at least 1 h, placed in a chamber slide with a coverslip over, and observed with a confocal laser scanning microscope (LSM 310, Zeiss, Germany). The 488 nm line of an argon-ion laser was used as the excitation wavelength, and the emission was recorded at 515-565 nm.
Quantitative analysis of MR cells
The size of MR cells stained by the whole-mount immunocytochemistry was
measured on stored LSM images by means of an internal program. The MR cell
area was obtained from 20 cells per individual (N=5), which were
randomly selected from gill filaments. For the determination of MR cell
density, an area corresponding to 9000-10000 µm2 was randomly
selected from the flat region of the afferent-vascular edge, which lacked gill
lamellae, of gill filaments in each experimental fish (N=5). The MR
cells in the selected areas were counted and the density was expressed as cell
number per mm2.
Scanning electron microscopy
The gills fixed for electron microscopy were dehydrated in ethanol,
immersed in 2-methyl-2-propanol, and dried using a freeze-drying device (JEOL
JFD-300, Japan). Dried samples were mounted on specimen stubs, coated with
platinum palladium in an ion sputter (Hitachi E-1030), and examined by SEM
(Hitachi S-4500).
Transmission electron microscopy
After dehydration in ethanol, the gill tissues were transferred to
propylene oxide and embedded in Spurr's resin. Ultrathin sections were cut
with a diamond knife, mounted on grids, stained with uranyl acetate and lead
citrate, and observed with a TEM (Hitachi H-7100).
Immunofluorescence microscopy
The gill filaments fixed in 2% PFA-0.2% GA in 0.1 mol l-1 PB
were immersed in 30% sucrose in 0.01 mol l-1 PBS for 1 h, and
embedded in Tissue-Tek OCT compound (Sakura Finetek, Japan) at -20°C.
Cryosections (2 µm) were cut on a cryostat (CM 1100, Leica, Germany) at
-20°C, and collected onto gelatin-coated slides. The compound-removed
sections were incubated sequentially with: (1) 2% NGS for 30 min, (2)
anti-V-ATPase diluted 1:100 v/v with NB-PBS overnight at 4°C and (3) goat
anti-rabbit IgG labeled with Alexa fluor 488 (Molecular Probes, OR, USA) for 2
h at room temperature. To confirm the specificity of the immunoreaction,
another cryosection was incubated with the antibody pre-incubated with the
synthetic peptide (1 µg ml-1). These sections were
double-stained with the antibody against Na+/K+-ATPase
(NAK121) labeled with Alexa fluor 546 at a dilution of 1:1000 overnight at
4°C. The sections were observed under a fluorescence microscope (Nikon
E800, Japan).
Immuno-electron microscopy
The gill filaments fixed in 2% PFA-0.2% GA in 0.1 mol l-1 PB
were immersed in 30% sucrose in 0.01 mol l-1 PBS for 1 h, and
embedded in Tissue-Tek OCT compound (Sakura Finetek) at -20°C.
Cryosections (16 µm) were cut on a cryostat (CM 1100, Leica) at -20°C,
and collected onto gelatin-coated slides. The cryosections were
immunocytochemically stained with the antibody against V-ATPase by the ABC
method, as described previously. The stained sections were then treated with
1% osmium tetroxide in 0.1 mol l-1 PB for 30 min. After dehydration
in ethanol, the sections were transferred to propylene oxide and embedded in
Spurr's resin. Ultrathin sections were cut with a diamond knife, and then
mounted on grids. These sections were viewed on a TEM (Hitachi H-7100)
Statistics
All data are presented as the mean ± standard error of the mean
(S.E.M.). The significance of a difference was determined by Games Howell's
test. Before the determinations, analysis of variance (ANOVA) was examined by
Bartlett's test.
| Results |
|---|
|
|
|---|
|
Confocal laser scanning microscopy
A large number of Na+/K+-ATPase-immunoreactive MR
cells were detected in the whole-mount preparations of the gill filaments in
the three experimental groups (Fig.
1). Immunoreactive MR cells were mostly located in a flat region
of the afferent-vascular (trailing) edge of the filament, which lacked gill
lamellae, and in the gill filaments between lamellae on the afferent-vascular
side. As the environmental NaCl concentration decreased, MR cells extended
their distribution toward the efferent side; however, there was no significant
difference in MR cell density between three experimental groups
(Table 2). Concomitant with the
extension of the cell distribution, the cells became significantly larger at
lower NaCl concentrations (Table
2).
|
Scanning electron-microscopic observations
MR cells were in contact with the external environment through their apical
surface. The apical membranes of MR cells were located at the boundary of
pavement cells, and most frequently observed on the afferent edge of gill
filament epithelia. In low- and mid-NaCl environments, the apical membrane of
MR cells did not form a pit, but appeared as a flat or slightly projecting
disk among pavement cells (Fig.
2A,C). The apical membrane was equipped with microvilli on its
surface (Fig. 2B,D). In the
high-NaCl group, in contrast, the apical membrane of most MR cells formed an
apical pit, which appeared as a pore among pavement cells
(Fig. 2E,F).
|
Transmission electron-microscopic observations
In the three experimental groups, MR cells were generally characterized by
a rich population of mitochondria and an extensive tubular system in the
cytoplasm (Fig. 3C,F,I). As was
seen with SEM, the apical membrane of MR cells was flat or slightly projecting
and equipped with numerous microvilli in the low- and mid-NaCl groups
(Fig. 3A,B,D,E). In the
high-NaCl group, however, the apical membrane of most MR cells was invaginated
to form a pit (Fig. 3G,H).
Thus, the surface area exposed to ambient water was much larger in fish
adapted to lower NaCl environments. In the high-NaCl environment, the MR cells
often interdigitated with neighboring accessory cells, forming multicellular
complexes. The MR and accessory cells shared an apical pit in the high-NaCl
environment, linked by shallow leaky junctions
(Fig. 3G,H).
|
V-ATPase A subunit
We cloned and sequenced a full-length cDNA encoding the A-subunit of
killifish V-ATPase (2573 bases), and obtained the deduced amino acid sequence
(618 amino acids) (Fig. 4). The
molecular mass of the killifish V-ATPase A-subunit was estimated to be 68 kDa.
The amino acid sequence showed a high degree of identity with V-ATPases from
other animal species. The cDNA sequence has been deposited in the DDBJ
database with the accession number AB066243.
Western blot analysis
The antibody to the V-ATPase A-subunit recognized four protein bands of
molecular mass 70-80 kDa (Fig.
5B). However, the two higher protein bands were not affected by
pre-incubation of the antibody with the antigen, whereas the lower two bands
disappeared when the membrane was incubated with the antigen-absorbed antibody
(Fig. 5A). These results
indicate that the lower two bands are specific for killifish V-ATPase
A-subunit.
|
Immunocytochemical detection of V-ATPase
By immuno-fluorescence microscopy, sagittal sections stained with
anti-Na+/K+-ATPase showed that MR cells were mainly
present at the filaments and the base of lamellae
(Fig. 6B,D,F,H). Intense
V-ATPase-immunoreactivity was detected in
Na+/K+-ATPase-immunoreactive MR cells in the low-NaCl
group; the distribution pattern of V-ATPase coincided well with
Na+/K+-ATPase immunolocalization
(Fig. 6A,B). The control
procedure in which the specific antibody was pre-incubated with the synthetic
peptide resulted in complete extinction of the immunoreactivity
(Fig. 6G,H). By contrast,
V-ATPase-immunoreactivity in MR cells was much weaker in the mid- and
high-NaCl groups than the low-NaCl group
(Fig. 6C-F).
|
The immuno-electron microscopy revealed that V-ATPase was distributed throughout the extensive tubular system, which was continuous with the basolateral membrane of MR cells (Fig. 7). The immunoreaction was detected neither in the apical membrane nor in mitochondria. V-ATPase-immunoreactivity in the basolateral membrane was much stronger in the low-NaCl group (Fig. 7A,B) than mid-NaCl group (Fig. 7C,D).
|
| Discussion |
|---|
|
|
|---|
Since Na+/K+-ATPase is located in the basolateral
membrane of MR cells, the antiserum specific for this enzyme serves as a
specific marker for their immunocytochemical detection
(Ura et al., 1996
). In the
present study, MR cells were detected by LSM in the whole-mount preparations
of gill filaments, as observed in European sea bass by Varsamos et al.
(2002
). Although there were no
significant differences in the density of MR cells between the three groups,
the distribution of MR cells extended toward the efferent-vascular side in
lower NaCl environments. Accordingly, the total number of MR cells increased
in lower NaCl environments. These results suggest that MR cells in killifish
participate in active Na+ and/or Cl- absorption from the
environment.
Our SEM and TEM observations showed two distinct types of MR cells. When
the ambient NaCl concentration was typical of freshwater level or lower (low-
and mid-NaCl groups), the apical membrane of MR cells showed slight
projections with microvilli. This morphological feature may indicate that
killifish MR cells take up ions through the expanded apical surface in lower
NaCl environments. A similar structure to the apical membrane has been
observed in several species of freshwater-adapted fish
(Hossler et al., 1985
;
Laurent and Hebibi, 1988
;
Perry et al., 1992
;
Perry, 1998
;
Kelly et al., 1999
). The
apical membrane of MR cells in the high-NaCl group, however, was invaginated
to form an apical pit. Furthermore, MR and accessory cells form multicellular
complexes, sharing an apical pit. These features are characteristic of MR
cells in seawater-adapted fish, and is also the case in killifish
(Katoh et al., 2001
).
Although ion concentrations in the high-NaCl group were much lower than
those in seawater, the ultrastructure of MR cells was similar to that observed
typically in seawater-adapted fish. Considering the occurrence of seawater-
and freshwater-type MR cells in the respective environments
(Katoh et al., 2001
), the MR
cells observed in high-NaCl experimental water might be an intermediate type
between seawater and freshwater types. This suggests that the occurrence of
two types reflects different functional phases of MR cells. A recent study has
demonstrated that freshwater-type MR cells in the yolk-sac membrane of
Mozambique tilapia embryos are transformed into seawater-type cells in
response to transfer from freshwater to seawater, suggesting plasticity of
ion-transporting functions of MR cells
(Hiroi et al., 1999
). It has
been proposed that V-ATPase is involved in ion absorption through gill
epithelia in freshwater-adapted fish. In previous studies, antisera raised
against mammalian and insect V-ATPases have been applied to immunolocalization
of V-ATPase in teleost gills (Lin et al.,
1994
; Sullivan et al.,
1995
; Wilson et al.,
2000a
,b
).
To obtain more reliable evidence for immunolocalization of V-ATPase, a cDNA
encoding the killifish V-ATPase A-subunit was cloned and a specific antibody
was raised in this study. The cDNA and deduced amino acid sequences showed
high degrees of identity with those of V-ATPase A-subunits from other animals
such as bovine (93%, amino acid; 68%, nucleotides;
Pan et al., 1991
), mouse (93%,
70%; Laitala-Leinonen et al.,
1996
) and chicken (92%, 68%;
Hernando et al., 1995
).
In western blot analysis, the antibody recognized two specific protein
bands of molecular size approximately 70 kDa, in agreement with the expected
size of the killifish V-ATPase A-subunit. It is possible that there exist two
V-ATPase A-subunits with different molecular masses in killifish, as is the
case in humans (Hille et al.,
1993
) and chickens (Hernando
et al., 1995
). The specificity of immunocytochemistry with
antibody to V-ATPase was also confirmed; gill MR cells in fish adapted to the
low-NaCl environment were intensely stained with the antibody, but the
immunoreactivity was extinguished when the antibody had been pre-incubated
with the antigen.
The immunoreactivity of V-ATPase was detected in the basolateral membrane
of MR cells in the present study, which disagrees with previous observations
in teleost gills. In rainbow trout gill epithelia, the V-ATPase is located in
the apical membranes of both MR and pavement cells
(Perry and Fryer 1997
;
Wilson et al., 2000a
).
V-ATPase immunoreactivity has also been detected in the apical membrane of
lamellar MR cells in mudskipper (Wilson et
al., 2000b
) and in pavement cells in tilapia
(Wilson et al., 2000a
). In the
gills of euryhaline stingray Dasyatis sabina, however, the V-ATPase
immunoreactivity was detected in the cytoplasm of gill epithelial cells
(Piermarini and Evans, 2001
),
presumably in vesicles or the basolateral membrane, which is in accordance
with our observation in killifish. These conflicting results may indicate
possible diversity in the distribution and function of V-ATPase in the gill
epithelia among different species. A current model in fish gill epithelia and
ion-transporting organs of other animal species implicates V-ATPase in both
Na+ and Cl- absorption in freshwater. In the mammalian
kidney, two subtypes of intercalated cells are present,
- and
ß-types, which are involved in H+ and bicarbonate secretion,
respectively. V-ATPase is located on the apical plasma membrane in
-cells, and on the basolateral membrane in ß-cells. Furthermore,
the localization of the Cl-/HCO3- anion exchanger (band
3) has been demonstrated on the basolateral membrane in
-cells and on
the apical membrane in ß-cells (Brown and Breton
1996
,
2000
). In these intercalated
cells, carbonic anhydrase II catalyzes the dehydration of CO2 to
produce H+ and HCO3-. In euryhaline stingray,
pendrin (a kind of anion exchanger) immunoreactivity occurred on the apical
region of cells rich in basolateral V-ATPase
(Piermarini et al., 2002
). In
the present study, V-ATPase was detected in the basolateral membrane of
branchial MR cells, as was seen in mammalian ß-type intercalated cells
and branchial cells of stingray. It is thus possible that H+
transport from the MR cell to blood by V-ATPase facilitates Cl-
absorption through the apically located anion exchanger. In the present study,
however, the Na+ concentration was much lower than that in normal
fresh water in the low-NaCl group (Table
1), where V-ATPase was intensely expressed in MR cells.
Accordingly, it is more likely that the MR cell development and expression of
V-ATPase in the basolateral membrane are attributable to a low Na+
concentration, rather than a low Cl- concentration. In
freshwater-adapted fish, NHE has been considered one possible pathway for
Na+ uptake through gill epithelia
(McCormick, 1995
); however,
there is no logical explanation of the driving force for NHE
(Lin and Randall, 1995
). The
Na+ gradient between the surrounding water and epithelial cells
could be the driving force for Na+ uptake; however, Na+
concentrations in the gill epithelial cells should be much higher than those
in fresh water. Using a fluorescent Na+ indicator, Li et al.
(1997
) estimated
Na+ concentration in the cytoplasm of the gill epithelial cells to
be approximately 12 mmol l-1. Thus, the Na+ gradient
across the apical membrane could not possibly drive NHE
(Avella and Bornancin, 1989
).
By contrast, V-ATPase coupled with an amiloride-sensitive Na+
channel, another possible pathway for Na+ uptake, is plausible
because the driving force for Na+ uptake can be created by
ATPase.
The model of Na+ uptake by V-ATPase coupled with the
amiloride-sensitive Na+ channel has been well described in frog
skin, in which V-ATPase is located in the apical membrane of MR cells. In a
freshwater environment (1 mmol l-1 Na2SO4),
bafilomycin A1 (10 µmoll-1) blocked H+
excretion and therefore Na+ absorption in open-circuited skins
(Klein et al., 1997
). In
recent studies, it has also been reported that bafilomycin A1
reduces whole-body Na+ influx in tilapia larvae and carp fry
(Fenwick et al., 1999
),
supporting this model in fish species. Li et al.
(1997
) also revealed that
amiloride and tetrodotoxin inhibit Na+ flux in MR cells isolated
from Mozambique tilapia.
Based on our observations that Na+/K+-ATPase and
V-ATPase are co-localized in the basolateral membrane in killifish gill MR
cells, we propose another model for Na+ uptake through gill MR
cells in freshwater-adapted killifish. When basolaterally located
Na+/K+-ATPase and V-ATPase transport Na+ and
H+, respectively, from MR cells to blood, the MR cells would be
negatively charged. According to the electrical gradient established by
Na+/K+-ATPase and V-ATPase, Na+ is absorbed
via apically located Na+ channels. Actually, in the
granular cells of frog, another cell type in frog skin epithelia, it is
supposed that Na+ is absorbed by the electrical gradient created by
Na+/K+-ATPase located in the basolateral membrane
(Ehrenfeld and Klein, 1997
). In
killifish, V-ATPase facilitated the creation of a steeper electrical gradient
in collaboration with Na+/K+-ATPase for absorption of
Na+ from low Na+ environments. This may explain why
V-ATPase was intensively expressed in the extremely low Na+
environment.
Wilson et al. (2000a
)
examined the immunolocalization of Na+ channels using an antibody
to the ß-subunit of human epithelial Na+ channels. They
reported that Na+ channel and V-ATPase immunoreactivities were
co-localized in pavement cells in freshwater tilapia and rainbow trout,
although the apical labeling of Na+ channels was also found in MR
cells in rainbow trout. The localization of Na+ channels was not
addressed in the present study; however, it is highly possible that the
Na+ channel is located in the apical membrane of MR cells in
killifish.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Avella, M. and Bornancin, M. (1989). A new
analysis of ammonia and sodium transport through the gills of the freshwater
rainbow trout (Salmo gairdneri). J. Exp.
Biol. 142,155
-175.
Brown, D. and Breton, S. (1996). Mitochondria-rich, proton-secreting epithelial cells. J. Exp. Biol. 199,2345 -2358.[Abstract]
Brown, D. and Breton, S. (2000). H+ V-ATPase-dependent luminal acidification in the kidney collecting duct and the epididymis/vas deferens: vesicle recycling and transcytotic pathway. J. Exp. Biol. 203,137 -145.[Abstract]
Chomczynski, P. and Sacchi, N. (1987). Single-step of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 163,156 -159.[CrossRef]
Ehrenfeld, J. and Klein, U. (1997). The key role of the H+ V-ATPase in acidbase balance and Na+ transport process in frog skin. J. Exp. Biol. 200,247 -256.[Abstract]
Evans, D. H. (1993). Osmotic and ionic regulation. In The Physiology of Fishes (ed. D. H. Evans), pp. 315-341. Boca Raton, FL: CRC Press.
Fenwick, J. C., Wendelaar Bonga, S. E. and Flik, G. (1999). In vivo bafilomycin-sensitive Na+ uptake in young freshwater fish. J. Exp. Biol. 202,3659 -3666.[Abstract]
Forgac, M. (1999). Structure and properties of
the vacuolar (H+)-ATPases. J. Biol. Chem.
274,12951
-12954.
Gill, S. S., Chu, P. B., Smethurst, P., Pietrantonio, P. V. and Ross, L. S. (1998). Isolation of the V-ATPase A and c subunit cDNAs from mosquito midgut and malpighian tubules. Arch. Insect. Biochem. Physiol. 37,80 -90.[CrossRef][Medline]
Graf, R., Novak, F. J., Harvey, W. R. and Wieczorek, H. (1992). Cloning and sequencing of cDNA encoding the putative insect plasma membrane V-ATPase subunit A. FEBS Lett. 300,119 -122.[CrossRef][Medline]
Griffith, R. W. (1974). Environment and salinity tolerance in the genus Fundulus. Copeia 1974,319 -331.[CrossRef]
Hardy, J. D., Jr (1978). Development of Fishes of Mid-Atlantic Bight, vol. 2. Washington, DC: Government Printing Office.
Harvey, W. R. and Wieczorek, H. (1997). Animal plasma membrane eneragization by chemiosmotic H+ V-ATPase. J. Exp. Biol. 200,203 -216.[Abstract]
Hernando, N., Bartkiewicz, M., Collin-Osdoby, P., Osdoby, P. and
Barton, R. (1995). Alternative splicing generates a second
isoform of the catalytic A subunit of the vacuolar H+-ATPase.
Proc. Natl. Acad. Sci. USA
92,6087
-6091.
Hille, B. V., Richener, H., Evans, D. B., Green, J. R. and
Bilbe, G. (1993). Identification of two subunit A isoforms of
the vacuolar H+-ATPase in human osteoclastoma. J. Biol.
Chem. 268,7075
-7080.
Hiroi, J., Kaneko, T., Uchida, K., Hasegawa, S. and Tanaka, M. (1998). Immunolocalization of vacuolar-type H+-ATPase in the yolk-sac membrane of tilapia (Oreochromis mossambicus) larvae. Zool. Sci. 15,447 -453.
Hiroi, J., Kaneko, T. and Tanaka, M. (1999). In vivo sequential changes in chloride cell morphology in the yolk-sac membrane of Mozambique tilapia (Oreochromis mossambicus) embryos and larvae during seawater adaptation. J. Exp. Biol. 202,3485 -3495.[Abstract]
Hossler, F. E., Musil, G., Karnaky, K. J., Jr and Epstein, F. H. (1985). Surface structure of the gill arch of the killifish, Fundulus heteroclitus, from seawater and freshwater, with special reference to the morphology of apical crypt of chloride cells. J. Morphol. 185,377 -386.[CrossRef][Medline]
Katoh, F., Shimizu, A., Uchida, K. and Kaneko, T. (2000). Shift of chloride cell distribution during early life stages in seawater-adapted killifish, Fundulus heteroclitus. Zool. Sci. 17,11 -18.
Katoh, F., Hasegawa, S., Kita, J., Takagi, Y. and Kaneko, T. (2001). Distinct seawater and freshwater types of chloride cells in killifish, Fundulus heteroclitus. Can. J. Zool. 79,822 -829.[CrossRef]
Kelly, S. P., Chow, I. N. K. and Woo, N. Y. S. (1999). Haloplasticity of black seabream (Mylio macrocephalus): hypersaline of freshwater acclimation. J. Exp. Zool. 283,226 -241.[CrossRef]
Klein, U., Timme, M., Zeiske, W. and Ehrenfeld, J. (1997). The H+ pump in frog skin (Rana esculenta): Identification and localization of a V-ATPase. J. Membr. Biol. 157,117 -126.[CrossRef][Medline]
Laitala-Leinonen, T., Howell, M. L., Dean, G. E. and Vaananen, H. K. (1996). Resorption-cycle-dependent polarization of mRNAs for different subunits of V-ATPase in bone-resorbing osteoclasts. Mol. Biol. Cell 7,129 -142.[Abstract]
Langdon, J. S. and Thorpe, J. E. (1985). The ontogeny of smoltification: developmental patterns of gill Na+, K+-ATPase, SDH and chloride cells in juvenile Atlantic salmon Salmo Salar L. Aquaculture. 45, 83-95.
Laurent, P. and Hebibi, N. (1988). Gill morphology and osmoregulation. Can. J. Zool. 67,3055 -3063.
Li, J., Eygensteyn, J., Lock, B. A. C., Wendelaar Bonga, S. E. and Flik, G. (1997). Na+ and Ca2+ homeostatic mechanisms in isolated chloride cells of the teleost Oreochromis mossambicus analyzed by confocal laser scanning microscopy. J. Exp. Biol. 200,1499 -1508.[Abstract]
Lin, H. and Randall, D. J. (1993). H+-ATPase activity in crude homogenates of fish gill tissue: inhibitor sensitivity and environmental and hormonal regulation. J. Exp. Biol. 180,163 -174.[Abstract]
Lin, H., Pfeiffer, D. C., Vogl, A. W., Pan J. and Randall, D. J. (1994). Immunolocalization of H+-ATPase in the gill epithelia of rainbow trout. J. Exp. Biol. 195,169 -183.[Abstract]
Lin, H. and Randall, D. J. (1995). Proton pumps in fish gills. In Cellular and Molecular Approaches to Fish Ionic Regulation (ed. C. M. Wood and T. J. Shuttleworth), pp.229 -255. New York: Academic Press.
McCormick, S. D. (1995). Hormonal control of gill Na+, K+-ATPase and chloride cell function. In Cellular and Molecular Approaches to Fish Ionic Regulation (ed. C. M. Wood and T. J. Shuttleworth), pp.285 -315. New York: Academic Press.
Pan, Y. X., Xu, J., Strasser, J. E., Howell, M. and Dean, G. E. (1991). Structure and expression of subunit A from the bovine chromaffin cell vacuolar ATPase. FEBS Lett. 293, 89-92.[CrossRef][Medline]
Perry, S. F., Goss, G. G. and Laurent, P. (1992). The interrelation ships between gill chloride cell morphology and ionic uptake in four freshwater teleosts. Can. J. Zool. 70,1775 -1786.
Perry, S. F. and Fryer, J. N. (1997). Proton pumps in the fish gill and kidney. Fish Physiol. Biochem. 17,363 -369.[CrossRef]
Perry, S. F. (1998). Relationship between branchial chloride cells and gas transfer in freshwater fish. Comp. Biochem. Physiol. A 119,9 -16.[CrossRef]
Perry, S. F., Matthew, L. B. and Johnson, D. A. (2000). Cloning and molecular characterization of the trout (Oncorhynchus mykiss) vacuolar H+-ATPase B subunit. J. Exp. Biol. 203,459 -470.[Abstract]
Piermarini, P. M. and Evans, D. H. (2001).
Immunochemical analysis of the vacuolar proton-ATPase B-subunit in the gills
of a euryhaline stingray (Dasyatis sabina): effects of salinity and
relation to Na+/K+-ATPase. J. Exp.
Biol. 204,3251
-3259.
Piermarini, P. M., Verlander, J. W., Royaux, I. E. and Evans, D.
H. (2002). Pendrin immunoreactivity in the gill epithelium of
a euryhaline elasmobranch. Am. J. Physiol.
283,R983
-R992.
Richman, N. H., Tai de Dais, S., Nishioka, R. S., Prunet, P. and Bern, H. A. (1987). Osmoregulatory and endocrine relationships with chloride cell morphology and density during smoltification in coho salmon (Onchorhynchus kisutch). Aquaculture 135,185 -193.[CrossRef]
Sander, I., Lottspeich, F., Appelhans, H., Kojro, E., Spangenberg, J., Weindel, C., Haase, W. and Koepsell, H. (1992). Sequence analysis of the catalytic subunit of H+-ATPase from porcine renal brush-border membrane. Biochem. Biophys. Acta 1112,129 -141.[Medline]
Sasai, S., Kaneko, T., Hasegawa, S. and Tsukamoto, K. (1998). Morphological alternation in two types of gill chloride cells in Japanese eel (Anguilla japonica) during catadromous migration. Can. J. Zool. 76,1480 -1487.[CrossRef]
Shimizu, A. (1997). Reproductive cycles in a reared strain of the mummichog, a daily spawner. J. Fish. Biol. 51,724 -737.[CrossRef]
Sullivan, G. V., Fryer, J. N. and Perry, S. F. (1995). Immunolocalization of proton pumps (H+-ATPase) in pavement cells of rainbow trout gill. J. Exp. Biol. 198,2619 -2629.[Abstract]
Sullivan, G. V., Fryer, J. N. and Perry, S. F. (1996). Localization of mRNA for the proton pump (H+-ATPase) and Cl-/HCO3-exchanger in the rainbow trout gill. Can. J. Zool. 74,2095 -2103.
Uchida, K., Kaneko, T., Yamauchi, K. and Hirano, T. (1996). Morphometrical analysis of chloride cell activity in the filaments and lamellae and changes in Na+, K+-ATPase activity during seawater adaptation in chum salmon fry. J. Exp. Zool. 276,193 -200.[CrossRef]
Uchida, K., Kaneko, T., Miyazaki, H., Hasegawa, S. and Hirano, T. (2000). Excellent salinity tolerance of Mozambique tilapia (Oreochromis mossambicus): elevated chloride cell activity in the branchial and opercular epithelia of the fish adapted to concentrated seawater. Zool. Sci. 17,149 -160.[CrossRef]
Ura, K., Soyano, K., Omoto, N., Adachi, S. and Yamauchi, K.
(1996). Localization of Na+, K+-ATPase in
tissues of rabbit and teleosts using an antiserum detected against a partial
sequence of the
-subunit. Zool. Sci.
13,219
-277.[Medline]
Varsamos, S., Daiz, J. P., Charmantier, G., Blasco, C., Connes, R. and Flik, G. (2002). Localization and morphology of chloride cells during the post-embryonic development of the European sea bass, Dicentrarchus labrax. Anat. Embryol. 205,203 -213.[CrossRef][Medline]
Wilson, J. M., Laurent, P., Tufts, B., Benos, D. J., Donowitz, M., Vogl, A. W. and Randall, D. J. (2000a). NaCl uptake by the branchial epithelium in freshwater teleost fish: an immunological approach to ion-transport protein localization. J. Exp. Biol. 203,2279 -2296.[Abstract]
Wilson, J. M., Randall D. J., Donowitz, M., Wayne Vogl, A. and Alex, K. Y. I. P. (2000b). Immunolocalization of ion-transport proteins to branchial epithelium mitochondria-rich cells in the mudskipper (Periophthalmodon schlosseri). J. Exp. Biol. 203,2297 -2310.[Abstract]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
J.-L. Horng, P.-P. Hwang, T.-H. Shih, Z.-H. Wen, C.-S. Lin, and L.-Y. Lin Chloride transport in mitochondrion-rich cells of euryhaline tilapia (Oreochromis mossambicus) larvae Am J Physiol Cell Physiol, October 1, 2009; 297(4): C845 - C854. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-C. Tseng, R.-D. Chen, J.-R. Lee, S.-T. Liu, S.-J. Lee, and P.-P. Hwang Specific expression and regulation of glucose transporters in zebrafish ionocytes Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2009; 297(2): R275 - R290. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-P. Hwang Ion uptake and acid secretion in zebrafish (Danio rerio) J. Exp. Biol., June 1, 2009; 212(11): 1745 - 1752. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-F. Wang, Y.-C. Tseng, J.-J. Yan, J. Hiroi, and P.-P. Hwang Role of SLC12A10.2, a Na-Cl cotransporter-like protein, in a Cl uptake mechanism in zebrafish (Danio rerio) Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2009; 296(5): R1650 - R1660. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Inokuchi, J. Hiroi, S. Watanabe, P.-P. Hwang, and T. Kaneko Morphological and functional classification of ion-absorbing mitochondria-rich cells in the gills of Mozambique tilapia J. Exp. Biol., April 1, 2009; 212(7): 1003 - 1010. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-L. Horng, L.-Y. Lin, and P.-P. Hwang Functional regulation of H+-ATPase-rich cells in zebrafish embryos acclimated to an acidic environment Am J Physiol Cell Physiol, April 1, 2009; 296(4): C682 - C692. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ivanis, M. Braun, and S. F. Perry Renal expression and localization of SLC9A3 sodium/hydrogen exchanger and its possible role in acid-base regulation in freshwater rainbow trout (Oncorhynchus mykiss) Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2008; 295(3): R971 - R978. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hiroi, S. Yasumasu, S. D. McCormick, P.-P. Hwang, and T. Kaneko Evidence for an apical Na-Cl cotransporter involved in ion uptake in a teleost fish J. Exp. Biol., August 15, 2008; 211(16): 2584 - 2599. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. Evans Teleost fish osmoregulation: what have we learned since August Krogh, Homer Smith, and Ancel Keys Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2008; 295(2): R704 - R713. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-Y. Lin, B.-K. Liao, J.-L. Horng, J.-J. Yan, C.-D. Hsiao, and P.-P. Hwang Carbonic anhydrase 2-like a and 15a are involved in acid-base regulation and Na+ uptake in zebrafish H+-ATPase-rich cells Am J Physiol Cell Physiol, May 1, 2008; 294(5): C1250 - C1260. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tresguerres, S. K. Parks, S. E. Sabatini, G. G. Goss, and C. M. Luquet Regulation of ion transport by pH and [HCO3-] in isolated gills of the crab Neohelice (Chasmagnathus) granulata Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2008; 294(3): R1033 - R1043. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-J. Yan, M.-Y. Chou, T. Kaneko, and P.-P. Hwang Gene expression of Na+/H+ exchanger in zebrafish H+-ATPase-rich cells during acclimation to low-Na+ and acidic environments Am J Physiol Cell Physiol, December 1, 2007; 293(6): C1814 - C1823. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Grosell, K. M. Gilmour, and S. F. Perry Intestinal carbonic anhydrase, bicarbonate, and proton carriers play a role in the acclimation of rainbow trout to seawater Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2007; 293(5): R2099 - R2111. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tresguerres, S. K. Parks, C. M. Wood, and G. G. Goss V-H+-ATPase translocation during blood alkalosis in dogfish gills: interaction with carbonic anhydrase and involvement in the postfeeding alkaline tide Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2007; 292(5): R2012 - R2019. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-L. Horng, L.-Y. Lin, C.-J. Huang, F. Katoh, T. Kaneko, and P.-P. Hwang Knockdown of V-ATPase subunit A (atp6v1a) impairs acid secretion and ion balance in zebrafish (Danio rerio) Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2007; 292(5): R2068 - R2076. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hyodo, J. D. Bell, J. M. Healy, T. Kaneko, S. Hasegawa, Y. Takei, J. A. Donald, and T. Toop Osmoregulation in elephant fish Callorhinchus milii (Holocephali), with special reference to the rectal gland J. Exp. Biol., April 15, 2007; 210(8): 1303 - 1310. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Esaki, K. Hoshijima, S. Kobayashi, H. Fukuda, K. Kawakami, and S. Hirose Visualization in zebrafish larvae of Na+ uptake in mitochondria-rich cells whose differentiation is dependent on foxi3a Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2007; 292(1): R470 - R480. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Catches, J. M. Burns, S. L. Edwards, and J. B. Claiborne Na+/H+ antiporter, V-H+-ATPase and Na+/K+-ATPase immunolocalization in a marine teleost (Myoxocephalus octodecemspinosus) J. Exp. Biol., September 1, 2006; 209(17): 3440 - 3447. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Katoh, M. Tresguerres, K. M. Lee, T. Kaneko, K. Aida, and G. G. Goss Cloning of rainbow trout SLC26A1: involvement in renal sulfate secretion Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2006; 290(5): R1468 - R1478. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Randall and T. K. N. Tsui Tribute to R. G. Boutilier: Acid-base transfer across fish gills J. Exp. Biol., April 1, 2006; 209(7): 1179 - 1184. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tresguerres, S. K. Parks, F. Katoh, and G. G. Goss Microtubule-dependent relocation of branchial V-H+-ATPase to the basolateral membrane in the Pacific spiny dogfish (Squalus acanthias): a role in base secretion J. Exp. Biol., February 15, 2006; 209(4): 599 - 609. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-Y. Lin, J.-L. Horng, J. G. Kunkel, and P.-P. Hwang Proton pump-rich cell secretes acid in skin of zebrafish larvae Am J Physiol Cell Physiol, February 1, 2006; 290(2): C371 - C378. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. P. Choe, A. Kato, S. Hirose, C. Plata, A. Sindic, M. F. Romero, J. B. Claiborne, and D. H. Evans NHE3 in an ancestral vertebrate: primary sequence, distribution, localization, and function in gills Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2005; 289(5): R1520 - R1534. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Scott, J. B. Claiborne, S. L. Edwards, P. M. Schulte, and C. M. Wood Gene expression after freshwater transfer in gills and opercular epithelia of killifish: insight into divergent mechanisms of ion transport J. Exp. Biol., July 15, 2005; 208(14): 2719 - 2729. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hiroi, S. D. McCormick, R. Ohtani-Kaneko, and T. Kaneko Functional classification of mitochondrion-rich cells in euryhaline Mozambique tilapia (Oreochromis mossambicus) embryos, by means of triple immunofluorescence staining for Na+/K+-ATPase, Na+/K+/2Cl- cotransporter and CFTR anion channel J. Exp. Biol., June 1, 2005; 208(11): 2023 - 2036. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tresguerres, F. Katoh, H. Fenton, E. Jasinska, and G. G. Goss Regulation of branchial V-H+-ATPase, Na+/K+-ATPase and NHE2 in response to acid and base infusions in the Pacific spiny dogfish (Squalus acanthias) J. Exp. Biol., January 15, 2005; 208(2): 345 - 354. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. Evans, P. M. Piermarini, and K. P. Choe The Multifunctional Fish Gill: Dominant Site of Gas Exchange, Osmoregulation, Acid-Base Regulation, and Excretion of Nitrogenous Waste Physiol Rev, January 1, 2005; 85(1): 97 - 177. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Scott, J. T. Rogers, J. G. Richards, C. M. Wood, and P. M. Schulte Intraspecific divergence of ionoregulatory physiology in the euryhaline teleost Fundulus heteroclitus: possible mechanisms of freshwater adaptation J. Exp. Biol., September 1, 2004; 207(19): 3399 - 3410. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Scott, J. G. Richards, B. Forbush, P. Isenring, and P. M. Schulte Changes in gene expression in gills of the euryhaline killifish Fundulus heteroclitus after abrupt salinity transfer Am J Physiol Cell Physiol, August 1, 2004; 287(2): C300 - C309. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. B. Kirschner The mechanism of sodium chloride uptake in hyperregulating aquatic animals J. Exp. Biol., April 1, 2004; 207(9): 1439 - 1452. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||