|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online October 10, 2003
Analysis of myostatin gene structure, expression and function in zebrafish

Center of Marine Biotechnology, University of Maryland Biotechnology Institute, Baltimore, MD 21202, USA
Author for correspondence (e-mail:
dus{at}umbi.umd.edu)
Accepted 30 July 2003
| Summary |
|---|
|
|
|---|
Key words: zebrafish, Danio rerio, muscle, Myostatin, hyperplasia, transgenic fish
| Introduction |
|---|
|
|
|---|
Like other members of the TGF-ß family, Myostatin is synthesized as a
prepro-peptide that undergoes two steps of proteolytic cleavage to generate
the biologically active C-terminal domain
(Thomas et al., 2000
;
Rios et al., 2001
). The
bioactive C-terminal domain dimerizes and binds to membrane receptors on
target cells (Thomas et al.,
2000
). The mature TGF-ß C-terminal dimer often forms an
inactive complex with the N-terminal prodomain of TGF-ß
(McPherron and Lee, 1996
).
This observation suggested that the Myostatin C-terminal active domain might
also exist as a secreted latent complex with the Myostatin prodomain
(Lee and McPherron, 1999
;
Thies et al., 2001
). Recently,
Thies and colleagues (2001
)
showed that Myostatin prodomain was able to bind to the bioactive Myostatin
C-terminal active domain and inhibit its biological activity, presumably by
preventing Myostatin active domain from binding to its receptor on the cell
surface. Transgenic mice expressing the Myostatin prodomain in muscle cells
showed enhanced muscle growth similar to myostatin knockout mice
(Lee and McPherron, 2001
;
Yang et al., 2001
).
Studies in mice and cattle have demonstrated that myostatin mRNA
was specifically expressed in developing somite and skeletal muscles
(McPherron et al., 1997
;
Kambadur et al., 1997
). Recent
studies, however, revealed that in addition to muscle cells,
myostatin mRNA was also expressed in several other tissues, such as
cardiomyocytes, mammary glands and, at a lower level, in adipose tissue
(Ji et al., 1998
;
Sharma et al., 1999
). In fish,
myostatin mRNA was found to be expressed in muscles, eyes, gill
filaments, spleen, ovaries, gut, brain and, to a lesser extent, in testes
(Rodgers et al., 2001
;
Maccatrozzo et al., 2001a
).
Myostatin expression in skeletal muscles appeared to be restricted to
certain types of muscle fibers. Carlson et al.
(1999
) demonstrated that
myostatin mRNA was mainly expressed in fast muscle fibers in mice.
Roberts and Goetz (2001
)
reported that myostatin mRNA was primarily expressed in red muscles
in brook trout, king mackerel, and yellow perch, but expression in the little
tunny is in the white muscles. Consistent with the study by Roberts and Goetz
(2001
), Rescan et al.
(2001
) showed that trout
myostatin-2 mRNA was predominantly expressed in red muscles. It
remains to be determined if Myostatin is involved in different muscle growth
of fast and slow muscles in fish.
Although myostatin cDNA has been cloned from zebrafish
(McPherron and Lee, 1997
), the
temporal and spatial pattern of its expression is unknown. It is not clear
when and where it is expressed in zebrafish embryos. Is it expressed in
developing somites and skeletal muscles as in mammals? Is the muscle
expression restricted to specific types of muscle fibers? Moreover, does
Myostatin inhibit muscle growth in fish? We have reported here the isolation
and characterization of myostatin genomic gene from zebrafish and
analysis of its expression in zebrafish embryos, larvae and adult skeletal
muscles. Our data showed a weak myostatin expression in early stage
embryos and a strong expression in swimming larvae and juveniles, and the
skeletal muscles of adult zebrafish. Overexpression of the Myostatin prodomain
in skeletal muscles of transgenic zebrafish had no effect on the expression of
myogenic regulatory genes. However, the adult transgenic fish showed
hyperplasia in their skeletal muscles compared with non-transgenic
controls.
| Materials and methods |
|---|
|
|
|---|
Mapping of zebrafish myostatin gene
The chromosomal position of zebrafish myostatin gene was mapped
using the LN 54 radiation hybrid panel generated by Hukriede et al.
(1999
). The panel was produced
by irradiation of zebrafish fin fibroblasts prior to fusion with mouse B78
melanoma cells. DNA from 93 hybrid cell lines was used for PCR analysis to
detect the presence of the zebrafish myostatin gene using E1.3/E2.1R
primers. The PCR was done as described above. The results of the PCR from the
radiation hybrid panel were scored according to Hudson et al.
(1995
) using a web-based
interface RHVECTOR at
http://mgchd1.nichd.nih.gov:8000/zfrh/beta.cgi.
Construction of myostatin-GFP plasmid
The myostatin-GFP gene construct was obtained by amplifying the
5' flanking sequence of zebrafish myostatin by PCR using the
Ap2 primer at the 5' and a gene-specific primer
myostatin5R1
(5'-GCGTCGACGTTCCAAGGCGTGCTAAAGGATG-3') based on the
5' UTR sequence of the zebrafish myostatin gene. To minimize
mutation introduced by PCR, pfu DNA polymerase was used in the PCR reaction.
PCR was carried out in a 50 µl reaction solution containing 1 µmol
l-1 of each primer, four deoxyribonucleotide triphosphates at 0.2
mmol l-1 for each, and 2.5 units of pfu DNA polymerase (Stratagene,
La Jolla, CA, USA). PCR was carried out for 35 cycles. Each cycle included 30
s at 94°C, 30 s at 60°C and 5 min at 72°C. A SalI site
was introduced at the end of the 5' UTR primer. The 1.2 kb 5'
flanking sequence was first cloned into the SmaI site of Bluescript
SK. The 5' flanking sequence was then released from the Bluescript SK
vector by SalI digestion and cloned into the SalI site of
the GFP construct (Du and Dienhart,
2001
). The resulting plasmid was confirmed by DNA sequencing and
designated as myostatin-GFP.
Construction of the mylc-MSTNpro transgene encoding the
myostatin prodomain
To construct the transgene encoding the Myostatin prodomain, the complete
coding region of zebrafish myostatin was first amplified by PCR using
pfu DNA polymerase. A BamHI and a XhoI site were introduced
by the PCR primers at the 5' and 3', respectively.
5'-primer: 5'-GGATCCAACATGCATTTTACACAGGTTTT-3',
3'-primer: 5'-CTCGAGGGTTCATGAGCAGCCACAGCGG-3'. PCR was
carried out in a 50 µl reaction solution containing 1 µmol
l-1 of each primer, four deoxyribonucleotide triphosphates at 0.2
mmol l-1 each, and 2.5 units of pfu DNA polymerase (Stratagene).
PCR was carried out for 30 cycles. Each cycle included 30 s at 94°C, 30 s
at 60°C, and 3 min at 72°C. The PCR fragment was purified on a gel and
then cloned into a plasmid Bluescript SK SmaI site. To generate the
Myostatin prodomain construct, a stop codon (TAA) was introduced immediately
after the RIRR proteolytic cleavage site at position 783 in the
myostatin coding region using the QuickChange Site Directed
Mutagenesis Kit (Stratagene). The gene construct encoding the Myostatin
prodomain and its signal peptide were released from the plasmid by
EcoRI digestion and cloned downstream of the rat mylc
promoter/enhancer at the EcoRI site
(Donoghue et al., 1991
). In
addition, SV 40 polyadenylation and transcription termination signals were
included at the 3' end of the Myostatin preprodomain to ensure proper
transcription termination and polyadenylation of the mRNA encoding the
Myostatin prodomain.
Microinjection in zebrafish embryos
The plasmids were diluted in distilled water to a final concentration of 50
µg ml-1. Phenol Red was added to the injection solution at a
final concentration of 0.1% to facilitate visualization during microinjection.
Approximately 2 nl of DNA solution were microinjected into the cytoplasm of
zebrafish embryos at the one- or two-cell stage. Microinjection was carried
out under a dissection microscope (MZ8, Leica, Deerfield, IL, USA) using a
PLI-100 pico-injector (Medical System Corp., New York, NY, USA). 500 embryos
were injected for each construct.
Whole-mount in situ hybridization and antibody staining
The whole-mount in situ hybridization and antibody staining was
carried out as previously described (Du and
Dienhart, 2001
). The Dig-labeled probe was synthesized by T7 RNA
polymerase in vitro using BamHI linearized plasmid pBSMSTN
that contains the full-length zebrafish myostatin cDNA
(McPherron and Lee, 1997
). For
embryos of 24 h and older, proteinase K treatment was performed to enhance the
permeability of the embryos, as described by Du and Dienhart
(2001
).
Expression analysis of the endogenous myostatin gene and the
prodomain transgene by RT-PCR
Total RNA was extracted from zebrafish Danio rerio embryos,
larvae, juvenile and adult muscle with TRIzol reagent (Invitrogen Corp.,
Carlsbad, CA, USA) according to the manufacturer's instructions. cDNA was
synthesized using the first strand cDNA synthesis kit (Life Sciences Inc., St
Petersburg, FL, USA). The expression of myostatin mRNA was analyzed
by reverse transcriptase (RT)-PCR using two pairs of myostatin
primers. One pair is a set of transgene-specific primers
(myostatin5pc/E2.1r). The myostatin5pc primer
(5'-CTGCAGCCCGGATCCAACATGCAT-3') was based on part of the 5'
UTR sequence of the rat mylc promoter and part of the
myostatin coding region near the ATG site. The E2.1R primer
(5'-CTGCCAAGACGTGACTCCTGCGTTCA-3') was based on part of the
sequence in myostatin exon 2. PCR using this pair of primers
generated a 627 bp fragment from the mylc-myostatinpro
transgene. Another pair of primers was myostatin E1.3/E2.1R. E1.3
(5'-CAAATTCTTAGCAAACTCCGACTCAAG-3') was based on
myostatin exon 1, while primer E2.1R was from the exon 2 sequence
shown above. PCR using this pair of primers generated a 432 bp fragment from
the endogenous myostatin gene and the prodomain transgene. Elongation
factor 1-
(Ef-1
) was used as RT-PCR control. The primers for the
Ef-1
5' and 3' primers were EF-1
-5'
(GCATACATCAAGAAGATCGGC) and Ef-1
-3' (GCAGCCTTCTGTGCAGACTTTG),
respectively. PCR was carried out for 35 cycles (30 s at 94°C, 30 s at
60°C and 1 min at 72°C) in a 25 µl reaction solution containing 1
µmol l-1 of each primer, four deoxyribonucleotide triphosphates
at 0.2 mmol l-1 for each, and 0.5 units of Taq DNA polymerase
(Promega). 20 µl of the amplified product was analyzed by electrophoresis
on a 1% agarose gel.
PCR screening of founder transgenic fish and transgenic
offspring
To screen germline transgenic fish, DNA was extracted from a batch of 100
F1 embryos from each cross. Briefly, 500 µl of lysis buffer (50
mmol l-1 KCl, 10 mmol l-1 Tris, pH 8.8, 1.5 mmol
l-1 MgCl2, 0.1% Triton X-100) was added to a group of
100 embryos, 48 h.p.f. (hours post fertilization). The embryos were gently
homogenized in the lysis buffer. The homogenate was boiled for 5 min, and was
then digested with proteinase K (100 µg ml-1) for 1 h at
55°C. Proteinase K was inactivated by boiling for 10 min after the
digestion. The samples were centrifuged at 12 000 g for 5 min
and 1.5 µl of the supernatant was used for the PCR reaction. PCR was
carried out in a 25 µl reaction solution containing 1 µmol
l-1 of each primer, four deoxyribonucleotide triphosphates at 0.2
mmol l-1 for each, and 0.5 units of Taq DNA polymerase (Promega).
PCR was carried out for 35 cycles. Each cycle included 30 s at 94°C, 30 s
at 60°C and 1 min at 72°C. 10 µl of the amplified product was
analyzed by electrophoresis on a 1% agarose gel.
To screen adult transgenic offspring, DNA was extracted from a small
portion of the caudal fin as described (Du
and Dienhart, 2001
) and used for PCR analysis. PCR was carried out
using transgene-specific primers (mylc-p2/E2.1R) based on the mylc
5' flanking sequence (mylc-p2,
5'-CACCACTGCTCTTCCAAGTGTCA-3') and part of exon 2 (E2.1R)
of zebrafish myostatin. This PCR yields a 704 bp product. Control PCR
primers HH-F (5'-GGACGGTGACACTTGGTGATG-3') and HH-R
(5'-CGAGTGGATGGAAAGAGTCTC-3') were derived from the sense and
antisense strand of the tiggy winkle hedgehog exon 3 sequence,
respectively. PCR using this set of control primers produced a 615 bp DNA
fragment. PCR reaction was carried out as described above for the embryos.
Real-time PCR analysis of myogenic gene expression
Expression of MyoD, Myf5 and myogenin mRNAs was analyzed
by real-time PCR in transgenic and non-transgenic fish at 2, 7, 45 and 240
days of age. For 2- and 7-day-old fish, total RNA was extacted from 100
embryos or larvae using TRIzol. For 45-day-old fish, individual fish were used
for RNA extraction. For 240-day-old fish,
60 mg of muscle tissue was used
for RNA extraction. The total RNA was digested with DNAses to remove
endogenous DNA contamination. First-strand cDNA was synthesized by reverse
transcriptase using oligo-dT primer (RETROscript Kit, Ambion, Austin, TX,
USA). Real-time RT-PCR was carried out using the following primers.
MyoD was amplified using MyoD 5'- and
3'-primers. The PCR product was a 288 bp fragment. Similarly,
Myf5 and myogenin were amplified with their specific primers
that generated a 482 bp and 319 bp fragment, respectively: MyoD 5':
5'-AGACGGAACAGCTATGACAGCTCT-3'; MyoD 3',
5'-ATTTTAAAGCACTTGATAAATG-3'; Myf-5 5',
5'-CACTCAGAAACCTTCAACACCAA-3'; Myf5 3',
5'-ATGCTCTCTGAGCAGCTGGAGGA-3'; Myogenin 5',
5'-TCTAGTGATCAGGGCTCTGGCAGCA-3'; Myogenin 3',
5'-TAAGCCCTCCAAGGCTTGTCTAACTTGC-3'.
Real-time PCR was carried on Sequence Detector (PRISM 7700; ABI, Foster City, CA, USA). Each reaction (50 µl) contained 3 µl cDNA and primers at a final concentration of 2 ng µl-1. SYBR Green was included in the PCR reaction as described in the protocol of SYBR Green PCR (ABI). The samples were first heated to 50°C for 2 min followed by 95°C for 10 min. The PCR reactions were carried out for 45 cycles at 95°C for 15 s and 60°C for 1 min. SDS v1.7a software was used to define the cycle in which each sample attained the threshold value.
Growth evaluations and determination of muscle fiber size and
number
To determine the muscle structure in transgenic zebrafish at juvenile and
adult stages, F2 transgenic fish were generated by crossing
transgenic males with wild-type females. Approximately 100 F2 fish,
including both transgenic and non-transgenic fish, were raised in the same
tank. These fish were weighed at 2.5, 3 and 5.5 months of age, after
anesthetization with 0.016% tricaine at two time points. The transgenic fish
were identified by PCR using DNA extracted from the tail fins. Mean body mass
was calculated for transgenic and non-transgenic males and females of
different ages. For fiber size and number analysis, five individual fish from
each group (female or male and transgene or wild type) were fixed with Bouin's
solution for 24 h followed by routine paraffin sectioning and
Haematoxylin/Eosin staining. A horizontal section at the base of the first pin
of the anal fin was selected for quantification of the number of muscle fibers
and measurement of the diameter of muscle fibers. A Student t-test
was used to determine whether significant differences existed between
wild-type and transgenic fish.
| Results |
|---|
|
|
|---|
|
Zebrafish is widely viewed as an excellent system for genetic study of gene
function. To map the position of the myostatin gene in zebrafish for
future identification of potential myostatin mutants, linkage group
analysis was carried out using the LN 54 radiation hybrid panel generated by
Hukriede et al. (1999
). The
results placed the zebrafish myostatin gene in chromosome 9, at
approximately 0.5 centiRay (1 cR isapproximately 148 kb) from the genetic
marker Z8363.
Characterization of myostatin mRNA expression in zebrafish
There is much evidence that myostatin mRNA is primarily expressed
in developing somite and skeletal muscles in mammals. Recent studies in fish
have also demonstrated that myostatin mRNA is predominantly expressed
in skeletal muscles. However, its expression pattern in early stage fish
embryos is not clear. A clear understanding of myostatin expression
in fish embryos would provide important insights into the role(s) of Myostatin
in regulating muscle development and growth in fish. To determine the temporal
and spatial pattern of myostatin mRNA expression in zebrafish
embryos, whole-mount in situ hybridization was carried out with
zebrafish embryos at several developmental stages (14 h post fertilization to
4 days post fertilization). The results showed that myostatin mRNA
could not be detected by in situ hybridization in zebrafish embryos
(Fig. 2A,B), suggesting that
myostatin mRNA was not expressed or only at a very low level in early
stage zebrafish embryos. To confirm the in situ data and to further
investigate its temporal pattern of expression in zebrafish, RT-PCR was used
to analyze myostatin expression using total RNA from whole zebrafish
embryos, larvae, juvenile and skeletal muscles of adult zebrafish. The results
confirmed that myostatin mRNA was weakly expressed in the early stage
zebrafish embryos (Fig. 2C). However, compared with day-4 embryo, myostatin mRNA expression
appeared to be increased in 2-week-old swimming larvae, 1-month-old juveniles
and skeletal muscle of 3-month-old adult zebrafish based on results from
regular RT-PCR (Fig. 2C).
|
Analysis of the zebrafish myostatin 5' flanking sequence revealed several putative E box sites that may be involved in its muscle-specific expression. To determine if the 5' flanking sequence could drive gene expression in muscle cells, the 1.2 kb DNA sequence of zebrafish myostatin 5' flanking region was ligated with the GFP reporter gene, and the DNA construct myostatin-GFP (Fig. 3) was microinjected into zebrafish embryos for transient expression analysis. As indicated by GFP expression and anti-GFP antibody staining in the injected embryos (Fig. 3A,B,D,E), the zebrafish myostatin 5' flanking sequence strongly targeted GFP expression in muscle cells of zebrafish embryos. Approximately 69% (N=148) of the injected embryos showed muscle expression, although some of the embryos also showed weak non-muscle expression in floor plate and head regions (Fig. 3C,F). These results indicate that the zebrafish myostatin 5' flanking sequence contained regulatory elements required for muscle expression and possibly other regulatory sequences for myostatin expression in other tissues.
|
Production of transgenic zebrafish expressing myostatin prodomain in
skeletal muscles
To investigate Myostatin function in fish muscle development and growth, a
transgenic approach was used to express Myostatin prodomain in zebrafish
muscle cells that could suppress Myostatin function. To identify a strong
muscle-specific promoter with which to target the expression of the Myostatin
prodomain in zebrafish skeletal muscles, we analyzed whether or not the rat
myosin light chain (mylc) gene promoter and its 1/3 enhancer
were muscle-specific in zebrafish. The mylc promoter/enhancer has
been shown to be muscle-specific in other vertebrates
(Donoghue et al., 1991
;
Lee and McPherron, 2001
). The
rat mylc gene promoter/enhancer was linked with the GFP reporter gene
(Fig. 4A). The
mylc-GFP construct was microinjected into zebrafish embryos. GFP
expression was analyzed by direct observation using a fluorescence microscope
or immunostaining using anti-GFP antibody. Over 80% (N=157) of the
injected embryos exhibited muscle-specific GFP expression
(Fig. 4C,D). The remaining
embryos that failed to express GFP in muscle cells did not exhibit GFP
expression in other tissues. These data demonstrated that the rat
mylc promoter/enhancer was muscle-specific in zebrafish and could be
used to drive the expression of Myostatin prodomain in zebrafish muscle
cells.
|
A gene encoding the zebrafish Myostatin prodomain was linked with the mylc promoter/enhancer (Fig. 4B). The resultant construct mylc-myostatinpro was microinjected into zebrafish embryos for transgenic fish production. Two independent germline transgenic founders (1 and 33) were identified (out of 184) by PCR screening of their F1 embryos. To determine the temporal and spatial expression of the transgene encoding the Myostatin prodomain, whole-mount in situ hybridization was used to analyze the expression of myostatin prodomain transgene in F1 embryos at 14, 16 and 24 h.p.f. Because the expression of the endogenous myostatin gene was undetectable by whole-mount in situ hybridization at these stages (Fig. 2A,B), the in situ expression pattern, thus represented the expression of the transgene. The results showed that the myostatin transgene was strongly expressed in developing somite and embryonic muscles of the transgenic fish embryos (Fig. 5A,C,E). The two transgenic lines exhibited different patterns of transgene expression. In line 33, the transgene was exclusively expressed in skeletal muscles, and it appeared that the expression was fast-fiber specific (Fig. 5H,I). In contrast, line 1 showed expression in skeletal muscle and weak expression in the brain and spinal cord (data not shown). Because line 33 exhibited a strong muscle-specific expression, this transgenic line was primarily used in this study.
|
The inheritance of the transgene in line 33 was analyzed in the F1, F2 and F3 generations. The transgene was inherited to the F2 and F3 generations in a Mendelian fashion, suggesting that it was integrated in a single site (data not shown). To determine if the transgene was expressed in skeletal muscles of adult transgenic fish, two sets of RT-PCR were employed to analyze the expression of the transgene and the endogenous myostatin gene (Fig. 6). The results showed that the transgene was strongly expressed in the skeletal muscles of adult transgenic fish. RT-PCR using the transgene-specific primers produced a predicted PCR product from the skeletal muscles of the transgenic fish (Fig. 6). In contrast, no PCR product of the transgene was found in non-transgenic fish. RT-PCR using another set of primers that amplify RNA transcripts from both the transgene and the endogenous myostatin gene generated a PCR product from both the transgenic and the non-transgenic fish (Fig. 6). Moreover, there were clearly more PCR products generated from the transgenic fish than the non-transgenic control (Fig. 6). This was probably because the transgenic fish contained RNA transcripts from both the endogenous myostatin gene and the transgene, whereas in the non-transgenic fish, the PCR product was solely derived from the endogenous gene transcripts. The PCR fragments were cloned, sequenced and confirmed to be derived from the myostatin gene or the transgene. Together with the in situ data (Fig. 5), these studies demonstrated that the myostatin prodomain transgene was inherited and expressed in a muscle-specific manner in the developing somite of transgenic zebrafish embryos. Moreover, this transgene is strongly expressed in adult skeletal muscles of the transgenic fish.
|
Inhibiting myostatin function induced hyperplasia in skeletal muscles
of transgenic fish
The development and growth of skeletal muscles were analyzed in the
transgenic fish at the morphological, histological and molecular levels.
Overall, there were no obvious morphological changes with the transgenic fish.
Transgenic fish showed normal development and growth. To determine if
inhibiting Myostatin function affected the expression of myogenic regulatory
genes, we analyzed the expression of MyoD, myogenin and
Myf-5 in transgenic fish embryos by in situ hybridization.
There was no significant change in MyoD, myogenin or Myf5
expression in transgenic zebrafish embryos
(Fig. 7). In addition, we
analyzed the formation of embryonic myofibers by F59 and MF20 antibody
staining, and found no difference between transgenic and non-transgenic fish
(data not shown). These results demonstrate that Myostatin may not be involved
in myogenesis in early stage embryos. To determine if inhibiting Myostatin
function affected the expression of myogenic regulatory genes at later stage
when myostatin mRNA expression was increased, we analyzed the
expression of MyoD, myogenin and Myf-5 in transgenic fish at
days 7, 45 and 240 by quantitative RT-PCR. The results showed the expression
levels of MyoD, myogenin and Myf-5 were very similar between
transgenic and non-transgenic fish (Fig.
8, Table 1).
Statistical analysis did not reveal any significant difference in myogenic
gene expression between transgenic and non-transgenic fish at 2, 7, 45 and 240
days of age.
|
|
|
To determine whether or not Myostatin plays a role in regulating muscle growth in adult fish, F2 transgenic fish were generated by crossing F1 (hemizygous) transgenic males with transgenic females, or transgenic males with non-transgenic females. The F2 generations from these crosses contained both homozygous and hemizygous transgenic fish as well as non-transgenic offspring. The body mass and muscle structures of the transgenic and non-transgenic fish were compared at several developmental stages. The hemizygous transgenic fish did not grow significantly larger than the non-transgenic siblings when analyzed at 3 and 5.5 months of age (Table 2). However, there appeared to be a significant increase in mass (10-15%) when homozygous transgenic fish were included in the analysis at 2.5 months of age (Table 2).
|
To determine whether or not the muscle growth was affected in the transgenic fish, samples of representative fish from transgenic and non-transgenic sibling were sectioned to determine fiber size and for number analysis at 3 and 5.5 months. The results showed that the transgenic fish had approximately 10% more myofibers than the non-transgenic fish that were in the similar body mass group (Table 3). To determine whether inhibiting Myostatin function caused hypertrophic muscle growth, fiber size was compared in transgenic and non-transgenic fish. Because the fiber size varies significantly in different cross section regions, we chose to compare myofibers from a defined region of the epaxial muscles where the fibers appear to be relatively uniform in size. The data revealed that there was no significant difference between fiber size in transgenic and non-transgenic fish (Table 3). Together, these data indicate that Myostatin may play an inhibitory role in hyperplastic myofiber formation, but has little effect on controlling the size of myofibers in zebrafish. Therefore, inhibiting Myostatin function in zebrafish results in a small but significant increase in muscle hyperplasia, but not in hypertrophy.
|
| Discussion |
|---|
|
|
|---|
Characterization of fish myostatin genes
Although fish myostatin genes share high sequence identity with
their mammalian counterparts, myostatin mRNA expression in fish is
different compared with that in mammals. In mice, myostatin mRNA is
strongly expressed in developing somite and skeletal muscles, and weakly
expressed in cardiomyocytes, mammary glands and adipose tissue
(McPherron et al., 1997
;
Ji et al., 1998
;
Sharma et al., 1999
). In fish,
several studies have demonstrated that, in addition to muscle expression,
myostatin mRNA was expressed in eyes, spleen, gill filaments,
ovaries, gut and brain and, to a lesser extent, in testes
(Rodgers et al., 2001
;
Maccatrozzo et al., 2001a
;
Roberts and Goetz, 2001
;
Ostbye et al., 2001
;
Radaelli et al., 2003
).
Moreover, in contrast to strong expression in developing somites in mouse
embryos, little or no myostatin mRNA expression could be detected in
developing somites of fish embryos by whole-mount in situ
hybridization. Myostatin mRNA expression in early stage zebrafish
embryos could only be detected by RT-PCR. This is consistent with a recent
report in seabream by Maccatrozzo et al.
(2001a
), and in zebrafish by
Vianello et al. (2003
).
The different pattern of myostatin expression in fish and mice
raised the question of whether the myostatin that we focused on in
this study was the mammalian homologue, and whether or not additional
myostatin genes are present in zebrafish, given that zebrafish have
more duplicated genes compared to mammals
(Wittbrodt et al., 1998
;
Robinson-Rechavi et al.,
2001
). Our BLAST search found two additional
myostatin-related genes in the zebrafish genome sequence. They share
approximately 60-70% identity with the zebrafish myostatin gene used
in this study. These two myostatin related genes, however, did not
show any expression in developing somites when examined by in situ
hybridization (data not shown) and their DNA sequences share less identity
with the mouse myostatin gene compared with the myostatin
gene characterized in this study.
Recently, a closely related gene GDF-11/BMP-11 was identified in human,
mouse and frog. GDF-11 is expressed in many tissues other than the skeletal
muscles, such as brain and eye (Nakashima
et al., 1999
; McPherron et
al., 1999
; Gamer et al.,
1999
). GDF-11 and myostatin are thought to be derived
from the same ancestral gene through gene duplication. The
myostatin-like genes in zebrafish could represent the zebrafish
GDF-11. These data suggest that the duplication event that generated
myostatin and GDF-11 might occur before the divergence of the fish
species. It is unknown at present whether the functions of Myostatin and
GDF-11 are highly specific, as in mammals. Further studies, especially the
characterization of fish GDF-11 expression and function, will provide more
insight into the possible function of these two highly related genes in
fish.
Myostatin functions in regulating fish muscle formation
Histological analysis revealed that the transgenic fish exhibited
stratified hyperplasia (data not shown). Stratified hyperplasia generates new
fibers along a distinct germinal layer. This type of hyperplasia is found in
all fish species. In addition to stratified hyperplasia, another type of
hyperplasia, mosaic hyperplasia, results in a large increase in total fiber
number during juvenile growth, and is therefore very common in commercially
important aquatic species that grow to a large size. Mosaic hyperplasia is
greatly reduced or entirely lacking in species such as zebrafish, guppies and
other fish that remain small (Van
Raamsdonk et al., 1983
; Weatherley and Gill,
1984
,
1985
;
Weatherley et al., 1988
). The
lack of a dramatic effect on enhancing muscle growth in zebrafish could be due
to the lack of mosaic hyperplasia in zebrafish. Nevertheless, inhibiting
Myostatin function resulted in a small but significant increase in fiber
numbers in the transgenic fish. This is consistent with the recent finding
that growth hormone transgenic zebrafish only grow 20% faster than
non-transgenic control (Morales et al.,
2001
). It will be interesting to determine if blocking Myostatin
function in large aquatic species has a more dramatic effect in stimulating
muscle growth.
The lack of a significant effect on hypertrophic growth in transgenic fish
differs from previous findings in mice. In the myostatin knockout
mice, the marked increase in muscle mass was attributed to both hypertrophy
and hyperplasia (McPherron et al.,
1997
), while the transgenic mice expressing the Myostatin
prodomain or the dominant negative form of Myostatin exhibited primarily
hypertrophy (Zhu, 2000
;
Yang et al., 2001
). The
different response to Myostatin in fish and mice could be due to the different
types of muscle growth in postnatal or post-larval stages. Postnatal muscle
growth in mammals is largely contributed by hypertrophy. In contrast, in most
fish species, muscle growth in post-embryonic life is attributed to continuous
hyperplastic and hypertrophic growth (reviewed by
Rowlerson and Veggetti, 2001
).
The less dramatic effect in fish could also be due to other reasons. Several
studies have demonstrated that there is no correlation between changes in
myostatin mRNA and Myostatin protein levels. Moreover, in zebrafish,
it has been shown that most of the Myostatin proteins exist as precursor
protein (Vianello et al.,
2003
). Therefore, overexpression of the Myostatin prodomain may
not have a dramatic effect in inhibiting Myostatin activity in zebrafish.
The possibility that myostatin related genes may be also involved
in the process should not be overlooked. Recently, Lee and McPherron
(2001
) demonstrated that
overexpression of Follistatin, a TGF-ß/BMPs inhibitor, in skeletal
muscles of transgenic mice induced hyperplasia and hypertrophy. Interestingly,
the muscle phenotype is more dramatic than that obtained from the
myostatin knockout, suggesting that Follistatin may have an
additional function than simply blocking Myostatin activity in skeletal
muscles (Lee and McPherron,
2001
). Follistatin has been cloned in zebrafish and was found to
be expressed in developing somite and skeletal muscles
(Bauer et al., 1998
). It
remains to be determined if overexpressing Follistatin in fish skeletal
muscles has a more dramatic effect in stimulating fish muscle growth.
Myostatin inhibits myoblast specification and differentiation by
downregulating Pax3, Myf-5 and MyoD expression in myoblasts
(Langley et al., 2002
). In
this study, we demonstrated that expression of MyoD, Myf-5 and
myogenin was not significantly affected in transgenic zebrafish
expressing the Myostatin prodomain. This result is not surprising considering
that only a 10% increase in hyperplasia was found in transgenic fish.
Regulation of myostatin gene expression
Although myostatin mRNA is predominantly expressed in skeletal
muscles, several studies have demonstrated that it is also expressed in other
tissues. To understand its regulation of expression in muscle cells, we
analyzed the activity of the zebrafish myostatin 5' flanking
sequence in zebrafish embryos. We found that the zebrafish myostatin
5' flanking sequence could drive GFP expression in muscle fibers of
zebrafish embryos. We also noticed that GFP expression in myofibers driven by
the myostatin flanking sequence was much stronger than
myostatin mRNA expression observed by in situ hybridization.
The discrepancy could be due to the fact that the fluorescent signal from GFP
is more sensitive than staining from the whole-mount in situ
hybridization. In addition, for microinjection, a large number of copies
(106) of the transgene were injected into zebrafish embryos.
Compared with the myostatin mRNA expression from the two copies of
the endogenous gene, GFP expression from the injected transgene is expected to
be significantly stronger. Moreover, it cannot be ruled out that the
myostatin 5' flanking sequence used in this study lacks some of
the inhibitory elements that restrict high levels of myostatin
expression in early stage embryos.
Myostatin expression is restricted to specific types of muscle
fibers (Kambadur et al., 1997
;
Ji et al., 1998
;
Kocamis et al., 1999
;
Roberts and Goetz, 2001
;
Rescan et al., 2001
). Because
of the mosaic nature of the transient expression assay, it was difficult to
determine if the expression of the myostatin-GFP transgene was
restricted to certain types of myofibers in zebrafish embryos. Future studies
are required to generate the myostatin-GFP transgenic model that
could be used to study the expression and regulation of myostatin
expression in zebrafish and to clarify whether its expression in zebrafish is
restricted to certain types of myofibers during development and growth.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Amthor, H., Huang, R., McKinnell, I., Christ, B., Kambadur, R., Sharma, M. and Patel, K. (2002). The regulation and action of Myostatin as a negative regulator of muscle development during avian embryogenesis. Dev. Biol. 251,241 -257.[CrossRef][Medline]
Bauer, H., Meier, A., Hild, M., Stachel, S., Economides, A., Hazelett, D., Harland, R. M. and Hammerschmidt, M. (1998). Follistatin and noggin are excluded from the zebrafish organizer. Dev. Biol. 204,488 -507.[CrossRef][Medline]
Carlson, C. J., Booth, F. W. and Gordon, S. E. (1999). Skeletal muscle myostatin mRNA expression is fiber-type specific and increases during hindlimb unloading. Am. J. Physiol. 277,R601 -606.
Donoghue, M. J., Merlie, J. P., Rosentha, l. N. and Sanes, J.
R. (1991). Rostrocaudal gradient of transgene expression in
adult skeletal muscle. Proc. Natl. Acad. Sci. USA
88,5847
-5851.
Du, S. J. and Dienhart, M. (2001). The zebrafish tiggy-winkle hedgehog promoter directs notochord and floor plate GFP expression in transgenic zebrafish embryos. Dev. Dyn. 222,655 -666.[CrossRef][Medline]
Du, S. J., Gao, J. and Anyangwe, V. (2003). Muscle-specific expression of myogenin in zebrafish embryos is controlled by multiple regulatory elements in the promoter. Comp. Biochem. Physiol. 134B,123 -134.
Gamer, L. W., Wolfman, N. M., Celeste, A. J., Hattersley, G., Hewick, R. and Rosen, V. (1999). A novel BMP expressed in developing mouse limb, spinal cord, and tail bud is a potent mesoderm inducer in Xenopus embryos. Dev. Biol. 208,222 -232.[CrossRef][Medline]
Grobet, L., Martin, L. J. R., Poncelet, D., Pirottin, D., Brouwers, B., Riquet, J., Schoeberlein, A., Dunner, S., Ménissier, F., Massabanda, J. et al. (1997). A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nature Genet. 17,71 -74.[CrossRef][Medline]
Grobet, L., Poncelet, D., Royo, L. J., Brouwers, B., Pirottin, D., Michaux, C., Ménissier, F., Zanotti, M., Dunner, S. and Georges, M. (1998). Molecular definition of an allele series of mutations disrupting the myostatin function and causing double-muscling in cattle. Mammal. Genome 9, 210-213.[CrossRef][Medline]
Hudson, T. J., Stein, L. D., Gerety, S. S., Ma, J., Castle, A. B., Silva, J., Slonim, D. K., Baptista, R., Kruglyak, L., Xu, S. H. et al. (1995). An STS-based map of the human genome. Science 270,1945 -1954.[Medline]
Hukriede, N. A., Joly, L., Tsang, M., Miles, J., Tellis, P.,
Epstein, J. A., Barbazuk, W. B., Li, F. N., Paw, B., Postlethwait, J. H. et
al. (1999). Radiation hybrid mapping of the zebrafish genome.
Proc. Natl. Acad. Sci. USA
96,9745
-9750.
Ji, S., Losinski, R. L., Cornelius, S. G., Frank, G. R., Willis, G. M., Gerrard, D. E., Depreux, F. F. and Spurlock, M. E. (1998). Myostatin expression in porcine tissues: tissue specificity and developmental and postnatal regulation. Am. J. Physiol. 275,R1265 -1273.
Kambadur, R., Sharma, M., Smith, T. P. L. and Bass, J. J.
(1997). Mutations in myostatin (GDF8) in
double-muscled Belgian Blue and Piedmontese cattle. Genome
Res. 7,910
-916.
Kocabas, A. M., Kucuktas, H., Dunham, R. A. and Liu, Z. (2002). Molecular characterization and differential expression of the Myostatin gene in channel catfish (Ictalurus punctatus). Biochim. Biophys. Acta 1575,99 -107.[Medline]
Kocamis, H., Kirkpatrick-Keller, D. C., Richter, J. and Killefer, J. (1999). The ontogeny of myostatin, follistatin and activin-B mRNA expression during chicken embryonic development. Growth Dev. Aging 63,143 -150.[Medline]
Langley, B., Thomas, M., Bishop, A., Sharma, M., Gilmour, S. and
Kambadur, R. (2002). Myostatin inhibits myoblast
differentiation by downregulating MyoD expression. J. Biol.
Chem. 277,49831
-49840.
Lee, S.-J. and McPherron, A. C. (1999). Myostatin and the control of skeletal muscle mass. Curr. Opin. Genet. Dev. 9,604 -607[CrossRef][Medline]
Lee, S. J. and McPherron, A. C. (2001).
Regulation of Myostatin activity and muscle growth. Proc. Natl.
Acad. Sci. USA 98,9306
-9311.
Maccatrozzo, L., Bargelloni, L., Radaelli, G., Mascarello, F. and Patarnello T. (2001a). Characterization of the Myostatin gene in the gilthead seabream (Sparus aurata): sequence, genomic structure, and expression pattern. Marine Biotechnol. 3, 224-230.
Maccatrozzo, L., Bargelloni, L., Cardazzo, B., Rizzo, G. and Patarnello, T. (2001b). A novel second myostatin gene is present in teleost fish. FEBS Lett. 509, 36-40.[CrossRef][Medline]
Maccatrozzo, L., Bargelloni, L., Patarnello, P., Radaelli, G., Mascarello, F. and Patarnello, T. (2002). Characterization of the myostatin gene and a linked microsatellite marker in shi drum (Umbrina cirrosa, Sciaenidae). Aquaculture 205, 49-60.[CrossRef]
McPherron, A. C. and Lee, S.-J. (1996). The transforming growth factor ß superfamily. Growth Fact. Cytokines Health Dis. 1B,357 -393.
McPherron, A. C. and Lee, S.-J. (1997). Double
muscling in cattle due to mutations in the myostatin gene.
Proc. Natl. Acad. Sci. USA
94,12457
-12461.
McPherron, A. C., Lawler, A. M. and Lee, S.-J. (1997). Regulation of skeletal muscle mass in mice by a new TGF-ß superfamily member. Nature 387, 83-90.[CrossRef][Medline]
McPherron, A. C., Lawler, A. M. and Lee, S.-J. (1999). Regulation of anterior/posterior patterning of the axial skeleton by growth/differentiation factor 11. Nature Genet. 22,260 -264.[CrossRef][Medline]
Morales, R., Herrera, M. T., Arenal, A., Cruz, O., Hernandez, O., Pimentel, R., Guillen, I., Martinez, R. and Estrada, M. P. (2001). Tilapia chromosomal growth hormone gene expression accelewrates grwoth in transgenic zebrafish (Danio rerio). Elec. J. Biotech. 4,51 -58.
Nakashima, M., Toyono, T., Akamine, A. and Joyner, A. (1999). Expression of growth/differentiation factor 11, a new member of the BMP/TGF beta superfamily during mouse embryogenesis. Mech. Dev. 80,185 -189.[CrossRef][Medline]
Ostbye, T. K., Galloway, T. F., Nielsen, C., Gabestad, I., Bardal, T. and Andersen, O. (2001). The two myostatin genes of Atlantic salmon (Salmo salar) are expressed in a variety of tissues. Eur. J. Biochem. 268,5249 -5257.[Medline]
Radaelli, G., Rowlerson, A., Mascarello, F., Patruno, M. and Funkenstein, B. (2003). Myostatin precursor is present in several tissues in teleost fish: a comparative immunolocalization study. Cell Tissue Res. 311,239 -250.[Medline]
Rescan, P. Y., Jutel, I. and Ralliere, C. (2001). Two Myostatin genes are differentially expressed in myotomal muscles of the trout (Oncorhynchus mykiss). J. Exp. Biol. 204,3523 -3529.
Roberts, S. B. and Goetz, F. W. (2001). Differential skeletal muscle expression of Myostatin across teleost species, and the isolation of multiple Myostatin isoforms. FEBS Lett. 491,212 -216.[CrossRef][Medline]
Robinson-Rechavi, M., Marchand, O., Escriva, H. and Laudet, V. (2001). An ancestral whole genome duplication may not have been responsible for abundance of duplicated fish genes. Curr. Biol. 11,R458 -R459.[CrossRef][Medline]
Rodgers, B. D., Weber, G. M., Sullivan, C. V. and Levine, M.
A. (2001). Isolation and characterization of Myostatin
complementary deoxyribonucleic acid clones from two commercially important
fish: Oreochromis mossambicus and Morone chrysops.
Endocrinol. 142,1412
-1418.
Rodgers, B. D. and Weber, G. M. (2001). Sequence conservation among fish Myostatin orthologues and the characterization of two additional cDNA clones from Morone saxatilis and Morone americana. Comp. Biochem. Physiol. 129B,597 -603.
Rios, R., Carneiro, I., Arce, V. M. and Devesa, J. (2001). Myostatin regulates cell survival during C2C12 myogenesis. Biochem. Biophys. Res. Commun. 280,561 -566.[CrossRef][Medline]
Rowlerson, A. and Veggetti, A. (2001). Muscle Development and Growth. Fish Physiology, Volume18 . New York, Academic Press, Inc.
Sharma, M., Kambadur, R., Matthews, K. G., Somers, W. G., Devlin, G. P., Conaglen, J. V., Fowke, P. J. and Bass, J. J. (1999). myostatin, a transforming growth factor-beta superfamily member, is expressed in heart muscle and is upregulated in cardiomyocytes after infarct. J. Cell Physiol. 180, 1-9.[CrossRef][Medline]
Spiller, M. P., Kambadur, R., Jeanplong, F., Thomas, M., Martyn,
J. K., Bass, J. J. and Sharma, M. (2002). The Myostatin gene
is a downstream target gene of basic helix-loop-helix transcription factor
MyoD. Mol. Cell Biol.
22,7066
-7082.
Taylor, W. E., Bhasin, S., Artaza, J., Byhower, F., Azam, M.,
Willard, D. H., Kull, F. C. and Gonzalez-Cadavid, N. (2001).
myostatin inhibits cell proliferation and protein synthesis in
C(2)C(12) muscle cells. Am. J. Physiol. Endocrinol.
Metab. 280,E221
-E228.
Thies, R. S., Chen, T., Davies, M. V., Tomkinson, K. N., Pearson, A. A., Shakey, Q. A. and Wolfman, N. M. (2001). GDF-8 propeptide binds to GDF-8 and antagonizes biological activity by inhibiting GDF-8 receptor binding. Growth Fact. 18,251 -259.
Thomas, M., Langley, B., Berry, C., Sharma, M., Kirk, S., Bass,
J. and Kambadur, R. (2000). myostatin, a negative
regulator of muscle growth, functions by inhibiting myoblast proliferation.
J. Biol. Chem. 275,40235
-40243.
Van Raamsdonk, W., Mos, W., Smit-Onel, M. J., van der Laarse, W. J. and Fehres, R. (1983). The development of the spinal motor column in relation to the myotomal muscle fibers in the zebrafish. I. Posthatching development. Anat. Embryol. 167,125 -139.[CrossRef][Medline]
Vianello, S., Brazzoduro, L., Dalla Valle, L., Belvedere, P. and Colombo, L. (2003). Myostatin expression during development and chronic stress in zebrafish (Danio rerio). J. Endocrinol. 176,47 -59.[Abstract]
Weatherley, A. H. and Gill, H. S. (1984). Growth dynamic of white myotomal muscle fibres in the bluntnose minnow, Pimephales notatus Rafinesque, and comparison with rainbow trout, Salmo gairdneri Richardson. J. Fish Biol. 25, 13-24.[CrossRef]
Weatherley, A. H. and Gill, H. S. (1985). Dynamics of increase in muscle fibers in fishes in relation to size and growth. Experientia 41,353 -354.[CrossRef]
Weatherley, A. H., Gill, H. S. and Lobo, A. F. (1988). Recruitment and maximal diameter of axial muscle fibres in teleosts and their relationship to somatic growth and ultimate size. J. Fish Biol. 33,851 -859.