|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online August 8, 2003
Regulation of a renal urea transporter with reduced salinity in a marine elasmobranch, Raja erinacea
Department of Zoology, University of Guelph, Guelph, Ontario, Canada, N1G 2W1
* Author for correspondence (e-mail: patwrigh{at}uoguelph.ca)
Accepted 23 June 2003
| Summary |
|---|
|
|
|---|
Key words: osmoregulation, trimethylamine oxide, urea transporter gene, skate, Raja erinacea
| Introduction |
|---|
|
|
|---|
The elasmobranch nephron (Fig.
1) consists of five loops separated into two distinct regions
the dorsallateral bundle, which is enclosed by connective
tissue, and the ventral `mass', within which individual tubules meander
convolutedly in blood sinuses (Lacy and
Reale, 1985
). The arrangement of the loops allows for a
countercurrent system that may be involved in fluid regulation and the passive
reabsorption of urea (Lacy et al.,
1985
). Hentschel et al.
(1986
) reported the presence
of a lower urea concentration and a higher sodium concentration in the dorsal
bundle zone compared to the ventral zone. The differences in the mean urea
concentrations indicate a gradient between the two regions of the kidney. The
presence of a gradient suggests that the countercurrent arrangement of the
very early and late segments of single renal tubules supports the passive
reabsorption of urea in the dorsal region.
|
It has been speculated that a carrier-mediated process is involved in
elasmobranch renal urea absorption. It was first proposed that the
reabsorption process is active, possibly connected to the reabsorption of
sodium. Schmidt-Nielsen et al.
(1972
) found a 1:1.6
stoichiometry between urea and Na+ reabsorption in the shark
kidney. Recent evidence, however, supports the role of a facilitated urea
transporter (UT) in the renal reabsorption process in elasmobranchs. A shark
facilitated urea transporter has been isolated from the dogfish kidney, which
is 66% homologous to the mammalian UT-A2 urea transporter
(Smith and Wright, 1999
). In
the ureotelic gulf toadfish Opsanus beta and the Lake Magadi tilapia
Alcolapia grahami urea transporter cDNA has been isolated from the
gills and functional expression characterized (Walsh et al.,
2000
,
2001a
). A homologue of the
toadfish gill UT has been shown to exist in the gills of a wide range of
marine teleost fishes (Walsh et al.,
2001b
). Interestingly, in the ammonotelic eel Anguilla
japonica, a gill urea transporter has been isolated that is upregulated
upon transfer from freshwater to seawater
(Mistry et al., 2001
).
Regulation of renal UT mRNA expression in elasmobranchs has not been
examined.
In euryhaline and marginally euryhaline elasmobranchs, dilution of the
external salinity results in marked reductions of urea concentrations in body
fluids and, to a lesser extent, osmotic constituents such as TMAO and amino
acids (Price and Creaser,
1967
; Goldstein and Forster,
1971
; Forster and Goldstein,
1976
; Cooper and Morris,
1998
; Sulikowski and
Maginniss, 2001
). During environmental dilution in the little
skate, changes in urea permeability of gills are small, but renal urea
excretion is sensitively attuned to osmoregulatory demands
(Goldstein and Forster, 1971
;
Payan et al., 1973
). Renal
urea excretion is increased, resulting from increases in glomerular filtration
rate, urinary flow, filtered load of urea, urea clearance, and in the
percentage of urea excreted relative to filtered by the kidney
(Goldstein and Forster, 1971
;
Payan et al., 1973
). There is
very little evidence, however, to suggest what mechanisms regulate the changes
in renal urea reabsorption.
The focus of this study was twofold. Firstly, to examine the little skate
Raja erinacea kidney for gradients of osmolality, urea and TMAO
between the dorsallateral and ventral regions to help clarify the sites
of renal urea reabsorption. Secondly, to identify skate renal urea
transporters homologous to the shark facilitated UT (ShUT;
Smith and Wright, 1999
). A
partial cDNA (779 bp) sequence of a urea transporter was isolated from the
skate kidney to be used as a probe in northern analysis to measure SkUT:
ß-actin mRNA levels in skates exposed to 100% and 50% seawater. We
predicted that SkUT mRNA levels would be lower in skates exposed to 50%
seawater, based on previous reports of increased rates of renal excretion
relative to urea reabsorption (Goldstein
and Forster, 1971
; Payan et
al., 1973
).
| Materials and methods |
|---|
|
|
|---|
Experiment protocol
Two groups of skates were transferred to 250 litre tanks with a
flow-through, aerated system. One group was kept at 100% seawater (control,
N=10); the other (N=10) was exposed to 75% salinity for 24
h, after which the salinity was decreased again (by 2
per hour) to 50%
salinity and maintained for 5 days. Both groups were fasted for the duration
of the experiment. At the end of the experimental period, skates were killed
by a blow to the head, followed by severance of the spinal cord. The paired
kidneys were then rapidly removed and dissected into dorsolateral and ventral
sections, as described by Hentschel et al.
(1986
). The tissue was
immediately frozen in liquid nitrogen and stored at 80°C for later
analysis (within 3 months). Due to the small size of the skate kidney after
separation into sections (approximately 1 g), half of the samples (5) were
used for tissue analysis of urea, TMAO and osmolality, while the other samples
were used for northern analysis of SkUT. All samples were used in water
content determination.
Kidney tissue analysis
For urea and trimethylamine oxide (TMAO) determination, approximately 1 g
(wet mass) of kidney tissue was homogenized (Euro Turrax T20b, IKA
Labortechnik, Staufen, Germany), in 10 times (w/v) of 5% trichloroacetic acid
(TCA). The samples were then centrifuged at 10 000 g for 10
min and the supernatant removed for the measurement of urea
(Rahamatullah and Boyde, 1980
)
and TMAO (Wekell and Barnett,
1991
). For osmolality determination, the method outlined by
Schmidt-Nielson et al. (1983) was used. In brief, approximately 10 mg (wet
mass) of tissue was added to a microcentrifuge tube containing 25 µl of
dH2O. This tube was tightly sealed and placed in boiling water for
3 min. After brief centrifugation, the samples were stored at 4°C for 24 h
to allow diffusion. The samples were then briefly centrifuged and the
osmolality of the supernatant analyzed (VaproTM Vapour Pressure Osmometer
5520, Wescor, Logan, Utah, USA). To determine the final osmolality, a dilution
factor was used, as follows:
![]() |
RTPCR
To clone a species-specific kidney urea transporter from the little skate,
a reverse transcriptase/polymerase chain reaction (RTPCR) approach was
used. Total RNA was isolated from a little skate kidney by homogenization
(Euro Turrax T20b) of approximately 1 g of tissue with 10 times (w/v) of
phenolguanidium thiocyanate (Trizol reagent, Gibco BRL, Burlington, ON,
Canada) followed by standard chloroform extraction and isopropanol
precipitation (Sambrook et al.,
1989
).
First-strand cDNA was synthesized by Moloney Murine Leukemia Virus (M-MuLV) reverse transcriptase and oligo(dT) primers (Amersham, Oakville, ON, Canada). Nested PCR was performed on this cDNA using specific primers designed from a consensus of DNA sequences from shark (ShUT), toadfish (tUT) and rat urea transporters. These were sense F1: 5'ACAAAATCCATTCATGGAGCA3' (corresponding to bp 89109 of ShUT) and F2: 5'TCAGGTGATGTTTGTCAACAA3' (corresponding to bp 281301 of ShUT); antisense R1: 5'CCAAGTGCATGCAGGTAATC3' (corresponding to bp 10811100 of ShUT). HotStarTaq DNA polymerase (Qiagen, Mississauga, ON, Canada) was used for the PCR, and the conditions were 94°C for 30 s, 57.5°C for 30 s, 72°C for 60 s (40 cycles) followed by 72°C for 7.5 min. For nested PCR, 1 µl of the product from primers F1 and R1 was used in a second PCR reaction with primers F2 and R1.
PCR products were separated by gel electrophoresis (1.5% agarose gel in TAE buffer (40 mmol l1 Tris-acetate, 1 mmol l1 EDTA, pH 8.0), and the major band at 820 bp, corresponding to the band in the ShUT positive control, was gel-purified (Qiagen) and ligated into the plasmid vector pGEM-T Easy (Promega, Fisher, Mississauga, ON, Canada). The resultant plasmid was transfected by electrophoresis into One Shot TOP10 Electrocomp E. coli (Invitrogen, Burlington, ON, Canada). Standard blue/white screening on Luriabroth (LB) plates, containing 50 µg ml1 ampicillin and 160 µg ml1 X-Gal, identified positive colonies with potential inserts, which were then cultured in LB. The plasmid DNA was isolated by the alkaline lysis method (Qiagen). The insert DNA of several clones was sequenced and found to be homologous to the shark urea transporter (ShUT).
Northern blot analysis
Total RNA was extracted from kidneys of experimental skates as described
above. In a separate analysis, total RNA was extracted from several skate
tissues (kidney, liver, gill, brain, heart, skeletal muscle and intestine) to
determine the presence of SkUT in different tissues. Equal amounts (10 µg)
of total RNA were loaded onto a formaldehydeagarose gel (1.5% agarose),
electrophoresed and transferred to a nylon membrane (Hybond-N, Amersham) using
standard methods (Sambrook et al.,
1989
). Hybridization of the membrane is based on the method of
Church and Gilbert (1984
). In
general, membranes were pre-hybridized for 3 h at 65°C in hybridization
solution, containing 0.5 mol l1 phosphate buffer
(Na2HPO4, pH 7.2), 7% (w/v) lauryl sulfate (SDS), 1 mmol
l1 EDTA, pH 8.0 and 1% (w/v) bovine serum albumin (BSA). The
membrane was initially hybridized at 65°C in hybridization solution with
32P-labeled skate urea transporter (SkUT) probe of the 779 bp
fragment, followed by a 32P-labeled skate ß-actin probe as an
invariant control gene. [32P]-probe was produced by first
amplifying the DNA clone using a PCR reaction, followed by purification using
a PCR purification kit (Qiagen). The resulting probe was labeled with
[
-32P]-dCTP (Amersham) using the T7 QuickPrime kit
(Pharmacia Biotech, Mississauga, ON, Canada) and purified with QiaQuick
nucleotide removal kit (Qiagen). Final washes were performed at 65°C and
the wash solution contained 40 mmol l1
Na2HPO4, pH 7.2, 1% (w/v) SDS, 1 mmol
l1 EDTA, pH 8.0. After exposure on a PhosphorImager cassette
(Molecular Dynamics, Sunnyvale, CA, USA), the image was scanned using a
PhosphorImager SI (Molecular Dynamics) and densitometry was analyzed using the
program ImageQuant 5.0 (Molecular Dynamics). The membrane was then stripped
using Denhardt's solution (0.1x), 5 mmol l1 Tris-HCl,
pH 8.0 and 2 mmol l1 EDTA, pH 8.0 at 65°C for 1 h and
rehybridized with ß-actin probe as described above.
Statistical analysis
All data are presented as means ± standard error of the mean
(S.E.M.). A one-way analysis of variance (ANOVA) was used to
establish differences between the control and skates exposed to a dilute
environment. TukeyKramer tests and Student t-tests were used
to determine where differences were significant (P<0.05).
| Results |
|---|
|
|
|---|
|
|
|
Cloning the skate urea transporter (SkUT)
Using PCR, a 779 bp piece of cDNA was isolated (accession no. AY161305;
Fig. 4) with high homology to
published sequences of urea transporters (UTs), specifically the shark kidney
urea transporter (ShUT) (Smith and Wright,
1999
) and the gill urea transporters of the toadfish (tUT) and
Magadi tilapia (mtUT) (Walsh et al.,
2000
,
2001a
). The longest open
reading frame (ORF) begins at nucleotide 2 and extends to the end of the
fragment. This encodes for a 259-amino-acid-residue partial protein, which was
named `SkUT' (skate UT). This sequence is approximately 68% complete when
compared to the ShUT amino acid sequence.
|
Northern blot analysis
High-stringency northern analysis of different tissues revealed
hybridization of SkUT cDNA to mRNA in the kidney, with a strong signal at 3.1
kb and slightly weaker signals at 2.8 kb and 1.6 kb
(Fig. 5). Of the other tissues
studied (gill, liver, intestine, heart, muscle and brain), only brain showed a
weak signal at 3.1 kb; the other signals observed in the kidney were not
present in the brain. Examination of the relative expression levels in kidney
mRNA from skates exposed to 50% seawater indicated that there was a
significant decrease of 1.8- to 3.5-fold in all three bands in the dorsal
region and in the 3.1 kb and 1.6 kb bands in the ventral region
(Fig. 6), indicating a
downregulation of the SkUT mRNA.
|
|
| Discussion |
|---|
|
|
|---|
The counter-current model of Boylan
(1972
) predicts a zone of low
urea concentration around the terminal segment (i.e. collecting duct) of the
elasmobranch nephron. A lower urea concentration and higher water content was
reported in the dorsal bundle zone compared to the ventral zone in the kidney
of R. erinacea, but the actual amounts of urea were identical in the
two zones (Hentschel et al.,
1986
). In the present study, urea and water content were not
significantly different between the renal dorsal and ventral sections, leading
to the same conclusion. Thus, there is no evidence for urea zonation between
the two major sections in the skate kidney, unlike the situation between the
cortex and inner medulla in the mammalian kidney
(Bankir, 1995
).
The peritubular sheath appears to segregate the dorsal tubule bundle of a
single nephron from other tubule bundles
(Fig. 1). The presence of tight
junctions between the sheath cells suggests that they act as a barrier so that
the environment of solutes and water is different inside relative to outside
the bundle (Lacy and Reale,
1985
). This suggests that the dorsal part of a nephron surrounded
by its peritubular sheath forms its own counter-current exchange and that
there is a urea gradient from the tip of the bundle to the ventral end present
within each bundle (Hentschel et al.,
1998
). In order to examine this hypothesis, fine scale sampling
(e.g. micropuncture) of tubule sections would be needed, but complexity of the
elasmobranch nephron makes this extremely difficult.
Internal osmotic pressure in the skate is slightly higher relative to the
external environment. This results in a net uptake of water, which was evident
in our study by the increased water content of the kidney tissue in skates
exposed to a gradual reduction in salinity over 2 days and then maintained in
50% seawater for 5 days. This elevation in body mass, which persists after 5
days, is characteristic of partial-osmoregulators transferred to 50% seawater,
such as Trygonoptera testacea (7%) and Heterodontus
portusjacksoni (15%; Cooper and
Morris, 1998
). The ability to reverse initial water uptake and
return body mass to near pre-dilution levels is considered a criterion of
osmoregulation for marine elasmobranchs, such as Dasyatis sabina,
that tolerate wide variations in environmental salinity
(Goldstein and Forster, 1971
;
De Vlaming and Sage, 1973
).
During environmental dilution of varying degrees, it has been demonstrated
in several elasmobranch species that the decline in plasma urea concentration
was greater than that of sodium or chloride concentration
(Cooper and Morris, 1998
;
Sulikowski and Maginniss,
2001
). As predicted, skates in dilute seawater retained less urea
in the kidney. The significant decrease in osmolarity and urea concentrations
in the skate kidney at 50% seawater is comparable to other studies on marine
skates where changes in muscle, plasma and erythrocyte urea levels have been
determined (Goldstein and Forster,
1971
; Payan et al.,
1973
; Forster and Goldstein,
1976
; Boyd et al.,
1977
). For example, plasma osmolarity and urea decreased by 25%
(100% SW, 965 mmol kg1 to 50% SW, 719 mmol
kg1; Forster and
Goldstein, 1976
) and 44% (100% SW, 396 mmol l1
to 50% SW, 220 mmol l1;
Goldstein and Forster, 1971
)
after 1 week in a dilute environment.
Payan et al. (1973
)
reported a slight, but significant, increase in total body urea clearance in
the little skate on the fifth day after introduction to a dilute environment,
the net change between an increase in renal urea excretion and a reduction in
branchial urea excretion. It is possible that, upon the initial exposure to a
dilute environment (e.g. 024 h), a more pronounced increase in renal
urea excretion occurs prior to a decrease in branchial urea excretion
(Goldstein and Forster, 1971
;
Payan et al., 1973
), and the
net effect is a higher rate of total body urea loss to the environment, which,
in turn, would have an impact on tissue urea levels. This putative large
initial increase in renal urea excretion would be partially due to a decrease
in fractional urea reabsorption (Goldstein
and Forster, 1971
; Payan et
al., 1973
), which could be related, in part, to the downregulation
of urea transport proteins such as SkUT (see below). It would be very
interesting to compare the time course of the downregulation of SkUT mRNA and
protein levels with the changes in renal urea excretion rates. A rapid
decrease in the rate of urea biosynthesis may also play a role in reducing
internal urea levels (Goldstein and
Forster, 1971
), but further research on the activity of the
ornithineurea cycle enzymes during environmental dilution is
needed.
The other key osmoregulatory solute in elasmobranchs is trimethylamine
oxide (TMAO). During environmental dilution, however, the kidney tissue levels
of TMAO remained unchanged. Similar findings have been observed in muscle
tissue, whereas plasma and erythrocyte concentrations significantly decreased
(Goldstein and Forster, 1971
;
Forster and Goldstein, 1976
).
This indicates that in little skate kidneys, at least, TMAO is not critically
important in short-term osmoregulatory adjustments. The TMAO concentration of
kidney tissue in this study is similar to that reported in skate plasma and
liver in other studies (S. Steele and P. Wright, unpublished data), but is
considerable lower than that found in dogfish Squalus acanthias
plasma or muscle tissue (for a review, see
Ballantyne, 1997
). This species
difference is probably due to the higher levels of other organic osmolytes in
skate tissues (but not in plasma) in comparison with the dogfish shark
(Boyd et al., 1977
). Indeed, in
very recent studies we discovered that in skate liver and muscle tissue these
`other osmolytes' (e.g. ß-alanine, betaine, inositol, sarcosine, taurine)
have a combined concentration that is 1.7- and 3.7 fold, respectively, higher
relative to TMAO concentrations (S. Steele, P. Yancey and P. Wright,
manuscript submitted). Hence, further work is necessary to elucidate the
physiological role of methylamines and other osmolytes in renal mechanisms of
osmoregulation in skates.
Skate kidney urea transporter
Overall, SkUT has 88%, 66%, 68%, 67% and 64% amino acid identity with ShUT,
tUT, mtUT, eUT (eel UT) and rUT (rat UT-A3), respectively
(Fig. 4). This homology
indicates a greater identity with ShUT, while the rest approximates the level
of identity between ShUT and mammalian urea transporters
(Smith and Wright, 1999
).
Several signature sequences of characteristic domains of UTs
(Walsh et al., 2001a
), e.g.
the NIT potential N-glycosylation site (residues 137139) and
the amino acid motifs: WDLPVFTLPFN (residues 97107), PVGVGQVYGCDNPW
(residues 153166) and TWQTHILA (residues 232239)
(Mistry et al., 2001
), are
highly conserved (Fig. 4).
Notably, the ALE domain, which is a signature of UT-B proteins (residues
215217 in rat UT-B), is absent from SkUT, strongly suggesting that SkUT
is an UT-A-like protein. SkUT has slightly higher identity (6668%) with
the toadfish (tUT), Magadi tilapia (mtUT) and eel (eUT) gill UTs than with the
mammalian kidney UT families (Walsh et al.,
2000
,
2001a
;
Mistry et al., 2001
). This
similarity suggests that the piscine UTs constitute a phylogenetically
ancestral form of the mammalian UT families.
High-stringency northern analysis of mRNA from skate kidney revealed three
bands of 3.1, 2.8 and 1.6 kb. This pattern of multiple bands has often been
reported. Smith and Wright
(1999
) detected three bands
when various dogfish tissues were probed with ShUT under low-stringency
conditions. In the gulf toadfish Opsanus beta, two bands were
reported in gill tissue (Walsh et al.,
2001a
). Northern analysis of mammalian kidney mRNA has revealed as
many as five bands when hybridized with different UT-specific probes
(Karakashian et al., 1999
).
Each of these five bands in the mammalian kidney is a functional urea
transporter, created by alternative splicing of the UT-A1 gene
(Fenton et al., 2002
). UT-A1
is the complete isoform while the other four are truncated versions. This
suggests that the bands seen in the skate kidney belong to three isoforms of a
urea transporter family, with the longest (3.2 kb) as the full-length sequence
and the shorter two as differently spliced isoforms. It is interesting to note
that the 3.1 kb band appears to be more sensitive to salinity changes than the
1.6 kb band. Further investigation of the full-length sequence and the
function of each transcript will be necessary, however, to show if a family of
urea transporter proteins exists in the kidney of elasmobranchs.
In skates exposed to environmental dilution, as predicted, there was a
downregulation (1.8- to 3.5-fold) in the relative expression of SkUT in kidney
mRNA. Very few researchers have demonstrated a change in UT expression during
environmental modification. Mistry et al.
(2001
) reported the induction
of an eel Anguilla japonica gill UT during acclimation from
freshwater to seawater. However, the functional significance of this induction
is not clear. In fish, changes in the external environment can directly
influence kidney function (e.g. Wood et
al., 1999
), whereas in mammals the same sort of changes can be
linked to variations in the internal environment (e.g.
Wright et al., 1992
). In rat
kidney, Wang et al. (2002
)
demonstrated a decrease in the abundance of UT-A1 and UT-A3 during
extracellular fluid (ECF) volume expansion (i.e. increased water content).
Associated with the downregulation of UT-A1 and UT-A3 was a decrease in serum
urea concentration and an increase in urea clearance. It was hypothesized that
the decrease in the abundance of the UTs would counterbalance the ECF volume
expansion by stimulating an increase in water excretion
(Wang et al., 2002
). Despite
the fact that mammals and elasmobranchs have very different renal
osmoregulatory strategies, a similar situation occurs in the skate during
environmental dilution, where renal tissue water content is elevated
(Table 1). The downregulation
of SkUT mRNA levels would presumably decrease SkUT protein levels and may
reduce the renal capacity for tubular urea reabsorption. Interestingly, in a
companion study on urea transport kinetics of skate kidney brush-border
membranes (Morgan et al.,
2003
), we present evidence for the possible involvement of renal
aquaporins as well in water and urea movement. In contrast to the mammalian
kidney, very little is known about the relationship between urea and water
reabsorption in the elasmobranch kidney. As a first step in developing a
model, the relative permeabilities of water and urea along different nephron
segments need to be determined in the kidney of marine elasmobranchs.
In conclusion, we found no evidence for solute gradients between the ventral and dorsal bundle zone of the skate kidney. Upon exposure to a dilute environment, urea and osmolality decreased, whereas water content increased in both zones of the kidney. A partial cDNA of a skate urea transporter (SkUT) was cloned, and the physiological changes were correlated with significant decreases in SkUT mRNA levels. Taken together, our data provide evidence that urea transporter(s) in the skate kidney play a role in urea retention.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Ballantyne, J. S. (1997). Jaws: the inside story. The metabolism of elasmobranch fishes. Comp. Biochem. Physiol. 118B,703 -742.
Bankir, L. (1995). Urea and the kidney. In The Kidney (5th edition) (ed. B. M. Brenner and F. C. Rector, Jr), pp. 571-606. Philadelphia, PA: Saunders.
Boyd, T. A., Cha, C.-J., Forster, R. P. and Goldstein, L. (1977). Free amino acids in tissues of the skate Raja erinacea and the stingray Dasyatis sabina: effects of environmental dilution. J. Exp. Zool. 199,435 -442.[CrossRef][Medline]
Boylan, J. W. (1967). Gill permeability in Squalus acanthias. In Sharks, Skates and Rays (ed. P. W. Gilbert, R. F. Mathewson and D. P. Rall), pp.197 -206. Baltimore: Johns Hopkins Press.
Boylan, J. W. (1972). A model for passive urea reabsorption in the elasmobranch kidney. Comp. Biochem. Physiol. 42A,27 -30.
Church, G. M. and Gilbert, W. (1984). Genomic
sequencing. Proc. Natl. Acad. Sci. USA
81,1991
-1995.
Clark, R. W. and Smith, H. W. (1932). Absorption and excretion of water and salts by the elasmobranch fishes. III. The use of xylose as a measure of the glomerular filtrate in Squalus acanthias. J. Cell. Comp. Physiol. 1, 131-143.[CrossRef]
Cooper, A. R. and Morris, S. (1998). Osmotic, ionic and haematological response of the Port Jackson shark Heterodontus portusjacksoni and the common stingaree Trygonoptera testacea upon exposure to diluted seawater. Mar. Biol. 132, 29-42.[CrossRef]
De Vlaming, V. L. and Sage, M. (1973). Osmoregulation in the euryhaline elasmobranch, Dasyatis sabina.Comp. Biochem. Physiol. 45A,31 -44.
Fenton, R. A., Cottingham, C. A., Stewart, G. S., Howorth, A., Hewitt, J. A. and Smith, C. P. (2002). Structure and characterization of the mouse UT-A gene (Slc14a2). Am. J. Physiol. 282,F630 -F638.
Fines, G. A., Ballantyne, J. S. and Wright, P. A. (2001). Active urea transport and an unusual basolateral membrane composition in the gills of a marine elasmobranch. Am. J. Physiol. 280,R16 -R24.
Forster, R. P. and Goldstein, L. (1976).
Intracellular osmoregulatory role of amino acids and urea in marine
elasmobranchs. Am. J. Physiol.
230,925
-931.
Goldstein, L. and Forster, R. P. (1971).
Osmoregulation and urea metabolism in the little skate Raja erinacea.Am. J. Physiol. 220,742
-746.
Hentschel, H., Elger, M. and Schmidt-Nielsen, B. (1986). Chemical and morphological differences in the kidney zones of the elasmobranch, Raja erinacea, Mitch. Comp. Biochem. Physiol. 84A,553 -557.
Hentschel, H., Storb, U., Teckhaus, L. and Elger, M. (1998). The central vessel of the renal countercurrent bundles of two marine elasmobranchs dogfish (Scyliorhinus caniculus) and skate (Raja erinacea) as revealed by light and electron microscopy with computer-assisted reconstruction. Anat. Embryol. 198,73 -89.[CrossRef][Medline]
Karakashian, A., Timmer, R. T., Klein, J. D., Gunn, R. B.,
Sands, J. M. and Bagnasco, S. M. (1999). Cloning and
characterization of two new isoforms of the rat kidney urea transporter: UT-A3
and UT-A4. J. Am. Soc. Nephrol.
10,230
-237.
Lacy, E. R. and Reale, E. (1985). The elasmobranch kidney. II. Sequence and structure of the nephrons. Anat. Embryol. 173,163 -186.[CrossRef][Medline]
Lacy, E. R. and Reale, E. (1999). Urinary System. In Sharks, Skates and Rays. The biology of elasmobranch fishes (ed. W. C. Hamlett), pp.353 -397. Baltimore: The Johns Hopkins University Press.
Lacy, E. R., Reale, E., Schlusselberg, D. S., Smith, W. K. and
Woodward, D. J. (1985). A renal counter-current system in
marine elasmobranch fish: a computer-assisted reconstruction.
Science 227,1351
-1354.
Mistry, A. C., Honda, S., Hirata, T., Kato, A. and Hirose, S. (2001). Eel urea transporter is localized to chloride cells and is salinity dependent. Am. J. Physiol. 281,R1594 -R1604.
Morgan, R. L., Wright, P. A. and Ballantyne, J. S.
(2003). Urea transport in kidney brush-border membrane vesicles
from an elasmobranch, Raja erinacea. J. Exp. Biol.
206,3293
-3302.
Payan, P., Goldstein, L. and Forster, R. P.
(1973). Gills and kidneys in ureosmotic regulation in euryhaline
skates. Am. J. Physiol.
224,367
-372.
Price, K. S., Jr and Creaser, E. P., Jr (1967). Fluctuations in two osmoregulatory components, urea and sodium chloride, of the clearnose skate, Raja eglanteria Bosc 1802 I. Upon laboratory modification of external salinities. Comp. Biochem. Physiol. 23,65 -76.[Medline]
Rahamatullah, M. and Boyde, T. R. C. (1980). Improvements in the determination of urea using diacetyl monoxime; methods with and without deproteinisation. Clin. Chim. Acta. 107, 3-9.[CrossRef][Medline]
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edition. New York: Cold Spring Harbor Laboratory Press.
Schmidt-Nielsen, B., Graves, B. and Roth, J. (1983). Water removal and solute addition determining increases in renal medullary osmolality. Am. J. Physiol. 244,F472 -F482.
Schmidt-Nielsen, B., Truniger, B. and Rabinowitz, L. (1972). Sodium-linked urea transport by the renal tubule of the spiny dogfish, Squalus acanthias. Comp. Biochem. Physiol. 42A,13 -25.
Smith, C. P. and Wright, P. A. (1999). Molecular characterization of an elasmobranch urea transporter. Am. J. Physiol. 276,R622 -R626.
Smith, H. W. (1936). The retention and physiological role of urea in the elasmobranchii. Biol. Rev. 11,49 -82.
Sulikowski, J. A. and Maginniss, L. (2001). Effects of environmental dilution on body fluid regulation in the yellow stingray, Urolophus jamaicensis. Comp. Biochem. Physiol. 128A,223 -232.
Walsh, P. J., Grosell, M., Goss, G. G., Bergman, H. L., Bergman, A. N., Wilson, P., Laurent, P., Alper, S. L., Smith, C. P., Kamunde, C. and Wood, C. M. (2001a). Physiological and molecular characterization of urea transport by the gills of the Lake Magadi tilapia (Alcolapia grahami). J. Exp. Biol. 204,509 -520.[Abstract]
Walsh, P. J., Heitz, M. J., Campbell, C. E., Cooper, G. J., Medina, M., Wang, Y. S., Goss, G. G., Vincek, V., Wood, C. M. and Smith, C. P. (2000). Molecular characterization of a urea transporter in the gill of the gulf toadfish (Opsanus beta). J. Exp. Biol. 203,2357 -2364.[Abstract]
Walsh, P. J. and Smith, C. P. (2001). Physiology of urea transport in fish. In: Nitrogen Excretion, Vol. 20 (ed. P. A. Wright and P. M. Anderson), pp. 289-295. New York: Academic Press.
Walsh, P. J., Wang, Y., Campbell, C. E., De Boeck, G. and Wood, C. M. (2001b). Patterns of nitrogenous waste excretion and gill urea transporter mRNA expression in several species of marine fish. Mar. Biol. 139,839 -844.[CrossRef]
Wang, X.-Y., Beutler, K., Nielsen, J., Nielsen, S., Knepper, M. A. and Masilamani, S. (2002). Decreased abundance of collecting duct urea transporters UT-A1 and UT-A3 with ECF volume expansion. Am. J. Physiol. 282,F577 -F584.
Wekell, J. C. and Barnett, H. (1991). New method for analysis of trimethylamine oxide using ferrous sulfate and EDTA. J. Food. Sci. 56,132 -138.[CrossRef]
Wood, C. M., Milligan, L. and Walsh, P. J. (1999). Renal responses of trout to chronic respiratory and metabolic acidoses and metabolic alkalosis. Am. J. Physiol. 277,R482 -R492.
Wood, C. M., Pärt, P. and Wright, P. A. (1995). Ammonia and urea metabolism in relation to gill function and acidbase balance in a marine elasmobranch, the spiny dogfish (Squalus acanthias). J. Exp. Biol. 198,1545 -1558.[Abstract]
Wright, P. A., Packer, R. K., Garcia-Perez, A. and Knepper, M. A. (1992). Time course of renal glutamate dehydrogenase induction during NH4Cl loading in rats. Am. J. Physiol. 262,F999 -F1006.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
W. W. Dowd, B. N. Harris, J. J. Cech Jr, and D. Kultz Proteomic and physiological responses of leopard sharks (Triakis semifasciata) to salinity change J. Exp. Biol., January 15, 2010; 213(2): 210 - 224. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. K. Ip, A. M. Loong, B. Ching, G. H. Y. Tham, W. P. Wong, and S. F. Chew The freshwater Amazonian stingray, Potamotrygon motoro, up-regulates glutamine synthetase activity and protein abundance, and accumulates glutamine when exposed to brackish (15{per thousand}) water J. Exp. Biol., December 1, 2009; 212(23): 3828 - 3836. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Rodela, K. M. Gilmour, P. J. Walsh, and M. D. McDonald Cortisol-sensitive urea transport across the gill basolateral membrane of the gulf toadfish (Opsanus beta) Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2009; 297(2): R313 - R322. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Y. C. Hung, F. Galvez, Y. K. Ip, and C. M. Wood Increased gene expression of a facilitated diffusion urea transporter in the skin of the African lungfish (Protopterus annectens) during massively elevated post-terrestrialization urea excretion J. Exp. Biol., April 15, 2009; 212(8): 1202 - 1211. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Rodela, J. S. Ballantyne, and P. A. Wright Carrier-mediated urea transport across the mitochondrial membrane of an elasmobranch (Raja erinacea) and a teleost (Oncorhynchus mykiss) fish Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2008; 294(6): R1947 - R1957. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Konno, S. Hyodo, K. Matsuda, and M. Uchiyama Effect of osmotic stress on expression of a putative facilitative urea transporter in the kidney and urinary bladder of the marine toad, Bufo marinus J. Exp. Biol., April 1, 2006; 209(7): 1207 - 1216. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. F. Chew, N. K. Poothodiyil, W. P. Wong, and Y. K. Ip Exposure to brackish water, upon feeding, leads to enhanced conservation of nitrogen and increased urea synthesis and retention in the Asian freshwater stingray Himantura signifer J. Exp. Biol., February 1, 2006; 209(3): 484 - 492. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Mistry, G. Chen, A. Kato, K. Nag, J. M. Sands, and S. Hirose A novel type of urea transporter, UT-C, is highly expressed in proximal tubule of seawater eel kidney Am J Physiol Renal Physiol, March 1, 2005; 288(3): F455 - F465. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Morgan, P. A. Wright, and J. S. Ballantyne Urea transport in kidney brush-border membrane vesicles from an elasmobranch, Raja erinacea J. Exp. Biol., September 15, 2003; 206(18): 3293 - 3302. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||