|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online July 23, 2003
Postnatal suppression of myomesin, muscle creatine kinase and the M-line in rat extraocular muscle
1 Department of Ophthalmology, Case Western Reserve University and
University Hospitals of Cleveland, Cleveland, OH 44106, USA
2 Department of Neurology, Case Western Reserve University and University
Hospitals of Cleveland, Cleveland, OH 44106, USA
3 Department of Neurosciences, Case Western Reserve University and
University Hospitals of Cleveland, Cleveland, OH 44106, USA
4 Department of Anatomy and Neurobiology, University of Kentucky Medical
Center, Lexington, KY 40536, USA
* Author for correspondence (e-mail: jdp7{at}po.cwru.edu)
Accepted 20 May 2003
| Summary |
|---|
|
|
|---|
Key words: extraocular muscle, M-line, myomesin, creatine kinase, myogenesis, rat, Rattus norvegicus
| Introduction |
|---|
|
|
|---|
Myomesin 1 (Myom1) and myomesin 2 (Myom2) represent the
principal structural components of the M-line. Myom1 exhibits tissue-
and developmental-stage-specific alternative splicing; two isoforms have been
identified in rodents (myomesin 1, or S-myomesin, and EH-myomesin 1) and four
have been identified in chickens (S-myomesin 1 and H-myomesin 1, with EH
splice variants of each). The EH and H isoforms are thought to be specific to
embryonic and adult cardiac muscle, respectively
(Agarkova et al., 2000
;
Bantle et al., 1996
;
Steiner et al., 1999
). Only
one myomesin 2 (M-protein) isoform has been described. In addition to acting
as structural components in adult striated muscle, the myomesin 1 and M-line
may play an important organizational role in developing sarcomeres
(Ehler et al., 1999
;
Grove et al., 1985
).
The M-line also serves as scaffolding for localization of homodimers of the
muscle creatine kinase (CK-M; Turner et
al., 1973
), which functions to cleave phosphocreatine and maintain
physiologically adequate muscle ATP:ADP ratios. CK-M may also contribute to
the cross-bridges at M-lines. A portion of total muscle CK becomes localized
to the M-line in the early postnatal period
(Carlsson et al., 1982
),
supporting renewal of ATP immediately at the site of energy utilization by
myofibrillar ATPase. Striated muscle also expresses sarcomeric mitochondrial
CK (sCK), localized to the mitochondria, and there is compelling evidence that
CK isoforms can, at least in part, functionally compensate for one another
(Roman et al., 1997
). CK
isoform heterogeneity is, however, tightly coupled to the organization of
energy production and utilization pathways and thus may be tailored to the
operational mode of a given muscle type
(Ventura-Clapier et al.,
1998
).
We have previously shown that extraocular muscle (EOM) is fundamentally
different from other skeletal muscles
(Cheng and Porter, 2002
;
Porter and Baker, 1996
;
Porter et al., 2001a
). Here,
we investigated the temporal expression patterns of the M-line and of myomesin
and CK isoforms in rat EOMs in comparison with those in other striated
muscles. Convergent evidence establishes a novel developmental downregulation
of adult myomesin and CK-M transcripts in EOM in coordination with a postnatal
repression of the M-line. Absence of both an M-line and CK-M suggests that EOM
differs from prototypic skeletal muscle in both sarcomeric structure and
myofiber energetics. Finally, using organotypic co-culture we established that
the developmental stage-specific M-line suppression might represent an early
adaptation to activity patterns and/or load in postnatal eye muscle.
| Materials and methods |
|---|
|
|
|---|
-helix, ß-sheet, turn,
coil, hydrophilic, amphipathic and flexible region content) was predicted
using algorithms in the Protean module of Lasergene.
|
Quantitative real-time RT-PCR (qPCR) of myomesin and CK isoforms
Total RNA was isolated from rat cardiac (E18, P0, P14, P28 and P45),
hindlimb (E18, P0, P7, P14, P21, P28 and P45) and extraocular (P0, P7, P14,
P28 and P45) muscle using Trizol (GibcoBRL, Rockville, MD), following the
manufacturer's instructions. Reverse transcription was carried out using
Superscript II RNase H-reverse transcriptase (GibcoBRL), with
oligo(dT)18 primer. The same primers used for sequencing were used
to amplify myomesin 1 and EH-myomesin 1 (pr1-pr2), EH-myomesin 1 alone
(pr3-pr4) and myomesin 2 (pr5-pr6). Primers were also designed for the known
CK isoforms: CK-M (GenBank REFSEQ NM_012530; forward, GAGATCTTCAAGAAGGCTGGTCA;
reverse, GAGATGTCGAACACGGCG; 227-bp product), sCK (GenBank accession number
X59736; forward, TTTCCAACATAGATCGGATCG; reverse, AGACTTCCTGTGTCTGTCATACCA;
211-bp product), CK-B (GenBank REFSEQ NM_012529; forward,
TGGCCTCACTCAGATTGAAA; reverse, GAACTTCTCGTGCTTTCCCAG; 160-bp product) and
ubiquitous CK (GenBank accession number X59737; forward,
GCGGATGTCTTTGACATCTCTAAT; reverse, TAGGACAGGGATTGAGAGGCA; 267-bp product).
qPCR used the Roche LightCycler (Mannheim, Germany) with the
LightCycler-FastStart DNA Master SYBR Green I kit, following the
manufacturer's standard conditions (40 cycles; 5 s at 95°C, 5 s at
58°C, 15 s at 95°C). Human genomic DNA and ß-globin primers were
used to generate an external standard curve for each reaction.
EOM and oculomotor motoneuron co-culture
Organotypic explant co-culture of P0 EOM with E16 midbrain slices
containing oculomotor motoneurons was performed as described previously
(Porter and Hauser, 1993
).
Briefly, motoneuron-containing midbrain slices were cultured for 2 days to
allow for neurite outgrowth. Newborn EOMs were dissected, minced and added in
close proximity to established midbrain explants. Cultures were grown on
rat-tail collagen-coated plastic cover slips in 22 mm wells incubated at
34°C, in 5% CO2/95% air and high humidity. Medium contained
18.6% donor horse serum, 59.1% alpha-modified Eagle's minimal essential
medium, 292 µg ml-1 glutamine, 9 mg ml-1 glucose, 1
mmol l-1 sodium pyruvate, 100 µg ml-1 transferrin, 4
ng ml-1 selenium, 16.1 µg ml-1 putrescene and 10
µg ml-1 gentamycin. Cultures were fed every 3-4 days.
Reduction of EOM activity by dark rearing
Timed-pregnant Sprague-Dawley (Harlan) rats were housed in total darkness.
This paradigm disrupts visual and oculomotor system development and
compromises EOM maturation (Brueckner and
Porter, 1998
). Animal maintenance (cage changing/feeding) was
conducted making brief use of a low intensity lamp with a red filter (Kodak 1A
safelight filter). Rat rod photoreceptors are barely sensitive to the extreme
end of the spectrum, so a dark-adapted eye may be exposed to fairly high
luminance levels of deep red light without loss of adaptation
(Davson, 1990
). After birth,
rats were kept in the dark for 14-56 days. Control rats were raised under a
standard 12 h:12 h light:dark cycle.
Ultrastructural analysis of EOM
Rat EOM sarcomere morphology was assessed by electron microscopy between
E17 and P56. Embryos isolated from timed-pregnant rats were fixed by immersion
in 1% paraformaldehyde and 1.25% glutaraldehyde in 0.1 mol l-1
phosphate buffer. Postnatal animals were perfused with saline followed by the
same fixative. Tissues were postfixed in osmium tetroxide, stained en
bloc in uranyl acetate, dehydrated in graded methanols and propylene
oxide, and embedded in epoxy resin. Ultrathin sections (
90 nm) were
stained with uranyl acetate and lead citrate and examined with an electron
microscope. Organotypic explant cultures were fixed with 4% glutaraldehyde and
then similarly processed and evaluated.
Myomesin immunocytochemistry
Myomesin was localized using a monoclonal antibody raised against skelemin,
an alternatively spliced isoform of myomesin 1 (Reddy et al.,
1998
,
2001
).
Total CK activity assay
Total CK activity was measured for hindlimb and EOM between P7 and P45
using the hexokinase/glucose-6-phosphate dehydrogenase-coupled enzyme system,
which yields reduced NADH proportional to total CK activity (Sigma Chemical
Co., St Louis, MO, USA) (Watchko et al.,
1996
).
| Results |
|---|
|
|
|---|
The deduced EH-myomesin 1 amino acid sequence was aligned with mouse, human and chicken using ClustalW, identifying homologies of 86.9%, 78.5% and 57.8%, respectively (Fig. 2). For the rat EH motif, 79 residues were identical, 13 residues represented conservative replacements (differing by <6 distance units) and five residues represented non-conservative changes (differing by <6 distance units, as determined from PAM 250; DNASTAR, Inc.) when compared with the consensus sequence.
|
Sequences of both the partial rat EH-Myom1 cDNA obtained here and
the complete mouse Myom1 cDNA (GenBank REFSEQ NM_010867) were used as
templates for a BLASTn search
(http://www.ncbi.nlm.nih.gov/genome/seq/RnBlast.html)
of rat genomic data at Rat Genome Database
(http://rgd.mcw.edu).
The search identified draft sequence Rattus norvegicus clone
CH230-98N18 (GenBank accession number AC103176.4). Since mouse and rat are
highly conserved at the nucleotide level, we then used the mouse cDNA as
reference to assemble rat EH-Myom1. Rat Myom1 coding
sequence extends over 130 kb of genomic sequence, including 40 exons and 39
introns. Actual coding sequence was
5 kb, encoding 1666 amino acids.
Using ClustalW, nucleotide/protein identity of the full-length rat
EH-Myom1 with mouse and human was 92.8%/94.5% and 83.6%/85.4%,
respectively.
By contrast, P45 hindlimb muscle mRNA amplified with pr1-pr2 yielded a
smaller, 393-bp fragment. Sequencing this fragment showed that it lacked the
EH-myomesin 1 domain, consistent with prior observations that the
alternatively spliced EH domain is absent from rodent skeletal muscle
(Agarkova et al., 2000
).
Nucleotide/deduced amino acid alignments performed using ClustalW showed this
rat Myom1 fragment to have highest homology with mouse (92.7%
nucleotide/95.2% amino acid), followed by human (87.9%/92.7%) and chicken
(76.1%/84.7%).
Pr5 and pr6 amplified a 376-bp fragment of Myom2 from P45 hindlimb muscle. After sequencing, an NCBI BLASTn search with the rat Myom2 sequence identified homologous sequences for chicken (D11474), mouse (XM_125012) and human (NM_003970) myomesin 2. Nucleotide/deduced amino acid sequence alignments performed using ClustalW showed this Myom2 fragment to have highest homology with mouse (94.9% nucleotide/99.2% amino acid), followed by human (81.6%/92.4%) and chicken (68.4%/81.4%).
Deduced EH-myomesin 1 domain secondary structure is highly conserved
in mammals
Agarkova et al. (2000
)
characterized EH-myomesin 1 in chicken and mouse embryonic heart and suggested
that it may confer flexibility to an otherwise rigid molecule that is
principally comprised of fibronectin III and immunoglobulin-like domains.
Using algorithms in Protean (DNASTAR, Inc.), we generated and compared
secondary structure predictions for chicken, rat, mouse and human EH motifs
and for representative Myom1 immunoglobulin-like (My2) and
fibronectin repeat (My4) domains. Fig.
3 shows predicted secondary structure, distribution of charged
domains and a backbone chain flexibility index for rat and chicken.
Comparisons of the rat EH domain (Fig.
3A) with those of mouse and human (data not shown) indicate
similarly low
-helical and ß-sheet domain content and high turn
and coil content. By contrast, the secondary structure of the chicken EH
domain includes higher
-helical and lower turn/coil content than rat,
yielding a less flexible structure (Fig.
3B). However, relative to the deduced secondary structure of
immunoglobulin-like (My2 shown in Fig.
3C) and fibronectin (My4 shown in
Fig. 3D) repeats that comprise
most of myomesin 1, backbone chain flexibility of the EH domain is high for
all four species.
|
Extraocular myomesin 1 and myomesin 2 transcripts are downregulated
from birth, while EH-myomesin 1 is upregulated
To determine if myomesin transcripts exhibit developmental stage
specificity, we performed qPCR analysis of rat cardiac muscle, skeletal muscle
and EOM. Data showed both developmental age and muscle class specificity in
myomesin transcript expression. At E18, nearly equivalent levels of
Myom1 were detected for heart and hindlimb (heart was 1.3-fold
greater than leg), and this relationship was maintained as levels roughly
paralleled one another throughout development
(Fig. 4A). EOM Myom1
mRNA levels were
10-fold less than heart and hindlimb at birth and
reached a peak roughly equivalent to the other muscle classes at P7. EOM
Myom1 then declined to a level
160-fold less than hindlimb and
200-fold less than cardiac muscle by P45. EH-Myom1 mRNA was
initially highest in heart and lowest in EOM
(Fig. 4B). Cardiac muscle
showed a small decline between E18 and P45, while there was a substantial drop
in EH transcripts in hindlimb muscle. EOM EH-Myom1 showed the
opposite pattern, with an
10-fold increase between P0 and P45.
|
Myom2 transcript levels were closest among the three muscle classes in early development (at P0, hindlimb was 3.9-fold greater than heart and 10-fold greater than EOM; Fig. 4C) and diverged thereafter. Hindlimb and cardiac muscle showed increases that correlated with age, peaking by P28 and then slightly declining by P45. At P45, cardiac and hindlimb transcript levels were nearly equivalent (heart 1.4-fold greater than leg), and both were higher (40- to 53-fold) than EOM.
Structural M-lines formed in developing EOM are subsequently
suppressed
Since expression levels of the major structural constituents of the M-line,
myomesin 1 and myomesin 2, decline during postnatal eye muscle development, we
assessed the presence of an M-line in this muscle group by electron
microscopy. M-lines were detected at the center of sarcomeres of all primary
myotubes at the earliest stage examined, E17
(Fig. 5A). M-lines were present
from the earliest stages of myofibril assembly, forming in incomplete
sarcomeres as myofibrillogenesis occurs in the perinuclear region. Both
primary and secondary myotubes exhibited M-lines at P0, but these were noted
less regularly by P7 and were absent from P14
(Fig. 6A) and P56
(Fig. 6C) EOM. Cellular
localization by immunocytochemistry established that myomesin 1 protein was
absent from adult EOM (Fig.
7).
|
|
|
M-lines are not suppressed in EOM organotypic nerve-muscle
co-cultures
To begin to assess how the M-line is regulated in developing EOM, we
characterized M-line appearance in organotypic nerve-muscle co-cultures.
Explant cultures mimic the developmental environment, including innervation by
appropriate motoneuron pools, but lack the postnatal activity patterns from
sensory inputs into higher order oculomotor system structures and the
functional load represented by the globe. M-line appearance during myogenesis
in organotypic co-cultures was identical to that in vivo (compare
Fig. 5A and
Fig. 5B). As actin and myosin
filaments were assembled, M-lines were present in the first sarcomeres formed
adjacent to myonuclei (Fig.
5B). Moreover, distinct M-lines were still detected in myofibers
maturing after 28-35 days in culture (Fig.
5C,D). By these stages, ultrastructural traits of the two major
extraocular myofiber types, singly and multiply innervated, had emerged and
distinctive M-lines were present in both types.
EOM M-line suppression is not prevented by altered visuomotor
development
If animals are deprived of vision during a postnatal critical period,
ocular dominance columns do not properly develop in primary visual cortex (V1)
and there are additional upstream and downstream consequences. Oculomotor
motoneuron output is altered and the EOMs undergo critical period-dependent
changes (Brueckner and Porter,
1998
). Since M-lines are actively suppressed in postnatal EOMs but
retained in organotypic co-cultures, we tested whether the
dark-rearing-mediated alteration of oculomotor output would influence M-line
expression. Rats reared in darkness from birth were evaluated at P14, P28 and
P56 for the presence or absence of M-lines. As in age-matched control rats, an
M-line was absent from extraocular myofibers of P14-P56 dark-reared rats
(Fig. 6B,D). We also evaluated
myomesin transcript levels and found no differences between P45 dark-reared
and normally reared rats (data not shown).
CK isoform expression patterns exhibit muscle class specificity
In addition to its role as a structural component of the sarcomere, the
M-line is a binding site for CK-M homodimers, which, in turn, are responsible
for phosphocreatine metabolism at the site of ATP utilization in muscle
contraction. Absence of an M-line in adult eye muscle probably has profound
consequences for myofiber energetics that may require adaptations at the level
of phosphocreatine metabolism. We determined muscle class- and developmental
age-specific expression patterns for all known CK isoforms by qPCR.
Prenatal CK-M (Ckm) transcript levels were similar for cardiac and skeletal muscle (heart 1.6-fold greater than leg), remained close at birth (leg 2.0-fold greater than heart) but then diverged thereafter as hindlimb levels continued to rise while cardiac transcripts leveled off (Fig. 8A). By P45, skeletal muscle Ckm mRNA content was 80-fold greater than that of heart. EOM Ckm transcripts were, however, 90-fold greater than those of hindlimb muscle at birth and increased only marginally during the developmental stages studied here. In P45 rats, EOM Ckm transcript levels were negligible, as qPCR showed that hindlimb and cardiac muscle were 90-fold and 10-fold higher, respectively, than eye muscle.
|
By contrast, muscle class-specific developmental patterns of the sCK
(Ckmt2) transcript were nearly reversed from those of Ckm
(Fig. 8B). Extraocular and
hindlimb muscles expressed nearly equal levels of Ckmt2 at birth,
when both were
4.5-fold greater than those in heart. From P0 onwards,
both EOM and cardiac muscles showed substantial increases in Ckmt2
mRNA, while hindlimb muscle exhibited only a modest increase (4.2-fold between
P0 and P45). In adult rats, EOM Ckmt2 transcript levels were 432-fold
greater than those in cardiac muscle, and heart levels were 1.4-fold greater
than hindlimb muscle levels.
Expression of the brain-type CK-B isoform (Ckb) was modest in the three muscle classes (Fig. 8C). Transcript levels declined from birth for cardiac and hindlimb muscles, while EOM showed only a modest increase (1.8-fold) between P0 and P45. Likewise, the ubiquitous mitochondrial CK (Ckmt1), the predominant type in smooth muscle, was expressed at low levels in all muscle classes at the earliest stages and declined during development (Fig. 8D).
Assuming equal amplification efficiency by the four primer pairs used in qPCR (primers were designed to have very close Tms, and data were normalized using a ß-globin standard control reaction), the relative abundance of CK transcripts for the three muscle classes was compared and yielded: EOM, Ckmt2>>Ckm>Ckb>>Ckmt1; hindlimb, Ckm>>Ckmt2>>Ckb> Ckmt1; cardiac, Ckm>Ckmt2>Ckb>>Ckmt1 (where >> denotes a difference of more than one order of magnitude).
Total CK activity is low in EOM
To determine the functional impact of differential regulation of CK isoform
transcripts in EOM, we conducted a total CK activity assay for hindlimb and
EOM at P7, P14, P21 and P45. Data show a postnatal increase in CK activity for
both muscle groups, but EOM CK activity is less than that of hindlimb muscle
at all developmental stages except for P7 (P<0.01, N=3;
Fig. 9). In the adult (P45)
rat, EOM total CK activity was approximately one-third that of the hindlimb
(EOM, 503.0±128.0 µmol min-1 mg-1 protein;
leg, 1532.3±143.1 µmol min-1 mg-1 protein;
P<0.001).
|
| Discussion |
|---|
|
|
|---|
Multiple myomesin isoforms are expressed in striated muscle, but their
separate functions are not fully understood. The My1 amino-terminal domain of
myomesin 1 binds the light meromyosin component of myosin, while My4-My6 bind
titin (Obermann et al., 1997
).
Based upon its primary structure, embryonic heart-specific EH-myomesin 1
probably has similar binding capability (the EH insert lies between domains
My6 and My7; Agarkova et al.,
2000
). However, expression of EH-Myom1 alone does not
support the formation of M-lines (Agarkova
et al., 2000
). We show here that EH-Myom1, the major
isoform in prenatal rodent and chicken hearts
(Agarkova et al., 2000
), is not
restricted to embryonic cardiac muscle but is also expressed in adult EOM.
Adult EOM is known to use several other traits of cardiac and embryonic
skeletal muscle in meeting its distinct functional roles
(Cheng and Porter, 2002
;
Jacoby et al., 1990
;
Khanna et al., 2003
;
McLoon and Wirtschafter, 1996
;
Porter et al., 2001a
;
Rushbrook et al., 1994
) and
then may have the phenotypic plasticity and need to express EH-myomesin. Our
data further suggest that EH-Myom1 is not restricted to embryonic
cardiac muscle and EOM but rather is present in adult heart and is detected at
trace levels in adult hindlimb muscle. Finally, qPCR data show that
Myom1 transcripts are present at a relatively low level and
Myom2 is absent, contributing to the absence of myomesin 1 protein
and M-lines in adult EOM.
We sequenced rat Myom1 and EH-Myom1 fragments to validate
qPCR primers, deduce EH-myomesin segment function and extract full-length
Myom1 from existing rat genomic DNA sequence data. We show that, with
the exception of a divergent EH domain, Myom1 is highly conserved in
rat striated muscle. Previous studies have established that myomesin 1 is
principally comprised of rigid immunoglobulin-like and fibronectin III domains
(Agarkova et al., 2000
), a
pattern repeated in the rat. Although the greatest phylogenetic divergence in
the deduced primary amino acid sequence of myomesin 1 is found in the EH
domain (see Fig. 2), the
deduced secondary structures of mouse, rat and human EH are still very similar
and the algorithms used here predict high flexibility for the EH domain in all
three species. Agarkova et al.
(2000
) likewise used the
Karplus-Schultx algorithm to predict elasticity in the EH domain, a finding
they confirmed through its circular dichroism spectrum. Chicken
EH-Myom1 is more divergent; we predict a higher
-helical
component and a lower degree of flexibility. It has been suggested that
flexibility in the EH domain is important during myofibrillogenesis
(Agarkova et al., 2000
), but
such flexibility in myosin alignment or cytoskeletal linkage may be a
liability in the adult. This hypothesis is consistent with the perinatal
replacement of the EH-splice variant by the more rigid myomesin 1 in heart
(Agarkova et al., 2000
). While
myomesin may be an integral component of myofibrils even in the absence of a
structurally visible M-line (Strehler et
al., 1980
), suggesting that EH-based myofilament linkages might be
present in eye muscle, it is not yet clear what adaptive value EH-myomesin 1
may serve in a muscle that lacks the stereotypical structural connections
between adjacent myosin filaments.
Prior studies (Ehler et al.,
1999
; Eppenberger et al.,
1981
; Van der Ven et al.,
1999
; Yang et al.,
2000
) have shown that an M-line appears within H-zones of forming
myofibrils and that myomesin 1 accumulation is coordinated with that of other
myofibrillar proteins. By contrast, myomesin 2 is known to accumulate several
days later and thus may not be essential for initial sarcomeric organization
(Carlsson et al., 1990
; Grove
et al., 1985
,
1987
;
Grove and Thornell, 1988
).
In vivo and in vitro data obtained for rat EOM are
consistent with such a requirement for both myomesin 1 and an M-line in
sarcomere formation. We show here that distinct M-lines form as
myofibrillogenesis proceeds in perinuclear regions of prenatal EOM, yet the
M-line is repressed within 7 days of birth. On the basis of its transient
appearance, we conclude that the M-line is essential to sarcomere formation,
even in this novel situation where it is not vital to postnatal muscle
function.
The morphological absence of an M-line in the adult is supported by prior
electron microscopic studies, one of which reported a faint M-line in only one
of the six recognized EOM fiber types
(Mayr, 1971
). Downregulation
of extraocular myomesin mRNA, as determined here by qPCR, continued well after
an M-line was no longer visible. Only in skeletal slow-twitch muscle is any
similar repression of an adult myomesin isoform observed. Myomesin 2 is
initially present in slow-twitch (type I) myofibers but then is lost during
postnatal maturation (Carlsson et al.,
1990
; Grove et al.,
1985
,
1987
,
1989
;
Grove and Thornell, 1988
).
This observation cannot, however, reconcile the postnatal loss of Myom1,
Myom2 and a structural M-line from EOM, since 80-85% of its myofibers are
fast-twitch (Porter and Baker,
1996
; Porter et al.,
1995
; Spencer and Porter,
1988
), a functional mode generally regarded as dependent upon an
M-line and the associated muscle CK. Moreover, while myomesin 2 is lost from
postnatal slow-twitch fibers, they still retain morphological M-lines
(Thornell et al., 1987
);
myomesin 1 and CK-M may both contribute to the structural M-lines in the
absence of myomesin 2.
Notably, M-line suppression did not occur in our organotypic oculomotor
motoneuron-EOM co-cultures, even after substantial myofiber maturation during
>35 days in culture. Although the normal suppression of myomesin 2 in
slow-twitch muscle fibers can be blocked by neonatal denervation
(Carlsson et al., 1990
), the
absence of M-line suppression in our co-cultures cannot be attributed to the
absence of innervation per se. Neuromuscular junctions form in the
co-culture system, myotube contractile activity becomes synchronized and the
in vitro twitch contractions can be blocked by an acetylcholine
receptor antagonist (Porter and Hauser,
1993
). Thus, we suggest that the functional demands placed upon
postnatal EOM require an operational mode in which the retention of a
structural M-line is not adaptive. To test this notion, we altered oculomotor
motoneuron activity patterns in vivo by raising newborn rats in
complete darkness. The lack of visual experience in this paradigm delays
maturation of ocular dominance columns in primary visual cortex and, in turn,
alters the maturation of visuomotor control systems. In prior studies, we have
shown that the postnatal emergence of the EOM-specific myosin heavy chain
isoform is blocked by dark rearing
(Brueckner et al., 1996
;
Brueckner and Porter, 1998
). If
the active suppression of the M-line and its molecular constituents were
dependent upon the emergence of sophisticated visuomotor behavior, then we
would have expected M-line retention in dark-reared rats. Instead, suppression
of the M-line was not blocked in our studies, suggesting that mechanisms
behind its downregulation lie in more fundamental neuromuscular interactions
and eye movement behaviors that emerge immediately after birth.
The phosphocreatine shuttle serves a vital role in striated muscle,
providing an efficient means to buffer ATP demands during contraction with
high-energy phosphate storage and transport. Skeletal muscle transcribes both
the Ckm and Ckb genes, although the CK-M isoform
predominates. Muscle CK is distributed among sarcoplasmic and M-line bound
compartments, the latter pool functionally coupling ATP regeneration with
local hydrolysis by myofibrillar ATPase. As Ckm mRNA rises in
parallel with the increased energy demands of postnatal skeletal and cardiac
muscle, we noted here that transcript levels remain flat in EOM. Coupled with
the absence of an M-line, these data support the paradoxical notion that
Ckm does not play an important role in the predominately fast-twitch
EOM group. Sarcomeric mitochondrial CK (Ckmt2) is also expressed in
striated muscles and may substitute for Ckm. EOM exhibits a rapid
postnatal increase in, and high adult levels of, Ckmt2 mRNA, a
finding supported by our prior serial analysis of gene expression study
(Cheng and Porter, 2002
).
Ckmt1 appears not to play a role in eye muscle. Ckb
expression levels in EOM are similar to those in heart, suggesting that CK-B
homodimers or CK-B/CK-M heterodimers not localized to the M-line may
participate in energy metabolism in these muscles. However, regardless of
isoform content, total CK enzyme activity in EOM is substantially less than
that of hindlimb, a finding inconsistent with the skeletal muscle prototype.
The eye muscles are, however, atypical in that they are largely fast-twitch,
with most fiber types having high intermyofibrillar mitochondrial and
oxidative enzyme content that confers considerable fatigue resistance. This
constitutive phenotype is very much like the adapted phenotype of mice
deficient in Ckm (de Groof et
al., 2001
; van Deursen et al.,
1993
), in which the short burst mode of fast-twitch glycolytic
fibers is replaced by speed with endurance. We suggest that reliance upon
energy transfer mechanisms other than CK-M then may be a signature of muscles
that combine speed, lower force and fatigue resistance.
The novel divergence of EOM from the striated muscle M-line organizational
pattern, as shown here, serves to reinforce the concept that this muscle group
represents a fundamentally distinct type of skeletal muscle. During eye
movements, there are demands for precision, speed and fatigue resistance that
are experienced by few other skeletal muscles. Consequently, EOM is
phenotypically unlike other skeletal muscles across a wide range of traits,
including basic fiber type classification schemes, gene expression profiles
and disease susceptibility (Cheng and
Porter, 2002
; Fischer et al.,
2002
; Kaminski et al.,
2002
; Porter,
2002
; Porter and Baker,
1996
; Porter et al.,
1995
,
2001a
,b
,
1998
). The absence of the
M-line system is consistent with known cytoskeletal organization differences
between extraocular and other skeletal musculature
(Cheng and Porter, 2002
;
Porter et al., 2001a
) and
suggests that eye muscle may use novel mechanisms to transmit contractile
force to the sarcolemma and tendon. We speculate that such differences in the
myofilament-cytoskeleton-sarcolemma-extracellular matrix linkage may underlie
the established protection of EOM in dystrophin-glycoprotein complex-based
muscular dystrophies (Kaminski et al.,
1992
; Karpati and Carpenter,
1986
; Khurana et al.,
1995
; Porter and Karathanasis,
1998
; Porter et al.,
1998
,
2001b
;
Ragusa et al., 1996
).
In summary, our data establish the absence of an M-line, low or absent expression of Myom1, Myom2 and CK-M, and the presence of EH-Myom1 in EOM. These findings represent a novel operational mode for mammalian striated muscle and further show that EOM represents an alternative paradigm for both sarcomere structure and cellular energetics among striated muscle types. Moreover, our data suggest that postnatal suppression of the M-line and CK-M is dependent upon in vivo maturation of activity patterns and/or load. Since EOMs exhibit diverse roles in voluntary and reflexive eye movements that are accompanied by an isoform diversity of sarcomeric proteins, M-line divergence probably represents a key physiological adaptation for the unique functional roles of this muscle group.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Agarkova, I., Auerbach, D., Ehler, E. and Perriard, J. C.
(2000). A novel marker for vertebrate embryonic heart, the
EH-myomesin isoform. J. Biol. Chem.
275,10256
-10264.
Bantle, S., Keller, S., Haussmann, I., Auerbach, D., Perriard,
E., Muhlebach, S. and Perriard, J. C. (1996).
Tissue-specific isoforms of chicken myomesin are generated by alternative
splicing. J. Biol. Chem.
271,19042
-19052.
Brueckner, J. K., Itkis, O. and Porter, J. D. (1996). Spatial and temporal patterns of myosin heavy chain expression in developing rat extraocular muscle. J. Muscle Res. Cell Motil. 17,297 -312.[Medline]
Brueckner, J. K. and Porter, J. D. (1998).
Visual system maldevelopment disrupts extraocular muscle-specific myosin
expression. J. Appl. Physiol.
85,584
-592.
Carlsson, E., Grove, B. K., Wallimann, T., Eppenberger, H. M. and Thornell, L. E. (1990). Myofibrillar M-band proteins in rat skeletal muscles during development. Histochemistry 95,27 -35.[CrossRef][Medline]
Carlsson, E., Kjorell, U., Thornell, L. E., Lambertsson, A. and Strehler, E. (1982). Differentiation of the myofibrils and the intermediate filament system during postnatal development of the rat heart. Eur. J. Cell Biol. 27, 62-73.[Medline]
Cheng, G. and Porter, J. D. (2002).
Transcriptional profile of rat extraocular muscle by serial analysis of gene
expression. Invest Ophthalmol. Vis. Sci.
43,1048
-1058.
Clark, K. A., McElhinny, A. S., Beckerle, M. C. and Gregorio, C. C. (2002). Striated muscle cytoarchitecture: an intricate web of form and function. Annu. Rev. Cell Dev. Biol. 18,637 -706.[CrossRef][Medline]
Davson, H. (1990). Physiology of the Eye. Elmsfield, NY: Pergamon Press.
de Groof, A. J., Oerlemans, F. T., Jost, C. R. and Wieringa, B. (2001). Changes in glycolytic network and mitochondrial design in creatine kinase-deficient muscles. Muscle Nerve 24,1188 -1196.[CrossRef][Medline]
Ehler, E., Rothen, B. M., Hammerle, S. P., Komiyama, M. and Perriard, J. C. (1999). Myofibrillogenesis in the developing chicken heart: assembly of Z-disk, M-line and the thick filaments. J. Cell Sci. 112,1529 -1539.[Abstract]
Eppenberger, H. M., Perriard, J. C., Rosenberg, U. B. and
Strehler, E. E. (1981). The Mr 165,000 M-protein myomesin: a
specific protein of cross-striated muscle cells. J. Cell
Biol. 89,185
-193.
Fischer, M. D., Gorospe, J. R., Felder, E., Bogdanovich, S.,
Pedrosa- Domellof, F., Ahima, R. S., Rubinstein, N. A., Hoffman, E. P.
and Khurana, T. S. (2002). Expression profiling reveals
metabolic and structural components of extraocular muscles.
Physiol. Genomics 9,71
-84.
Furst, D. O., Obermann, W. M. and van der Ven, P. F. (1999). Structure and assembly of the sarcomeric M band. Rev. Physiol. Biochem. Pharmacol. 138,163 -202.[Medline]
Grove, B. K., Cerny, L., Perriard, J. C. and Eppenberger, H.
M. (1985). Myomesin and M-protein: expression of two M-band
proteins in pectoral muscle and heart during development. J. Cell
Biol. 101,1413
-1421.
Grove, B. K., Cerny, L., Perriard, J. C., Eppenberger, H. M. and Thornell, L. E. (1989). Fiber type-specific distribution of M-band proteins in chicken muscle. J. Histochem. Cytochem. 37,447 -454.[Abstract]
Grove, B. K., Holmbom, B. and Thornell, L. E. (1987). Myomesin and M protein: differential expression in embryonic fibers during pectoral muscle development. Differentiation 34,106 -114.[CrossRef][Medline]
Grove, B. K. and Thornell, L. E. (1988). Noncoordinate expression of M band proteins in slow and fast embryonic chick muscles. Muscle Nerve 11,645 -653.[CrossRef][Medline]
Jacoby, J., Ko, K., Weiss, C. and Rushbrook, J. I. (1990). Systematic variation in myosin expression along extraocular muscle fibres of the adult rat. J. Muscle Res. Cell Motil. 11,25 -40.[CrossRef][Medline]
Kaminski, H. J., al-Hakim, M., Leigh, R. J., Katirji, M. B. and Ruff, R. L. (1992). Extraocular muscles are spared in advanced Duchenne dystrophy. Ann. Neurol. 32,586 -588.[CrossRef][Medline]
Kaminski, H. J., Richmonds, C. R., Kusner, L. L. and Mitsumoto, H. (2002). Differential susceptibility of the ocular motor system to disease. Ann. NY Acad. Sci. 956, 42-54.[Medline]
Karpati, G. and Carpenter, S. (1986). Small-caliber skeletal muscle fibers do not suffer deleterious consequences of dystrophic gene expression. Am. J. Med. Genet. 25,653 -658.[CrossRef][Medline]
Khanna, S., Richmonds, C. R., Kaminski, H. J. and Porter, J.
D. (2003). Molecular organization of the extraocular muscle
neuromuscular junction: partial conservation of and divergence from the
skeletal muscle prototype. Invest. Ophthalmol. Vis.
Sci. 44,1918
-1926.
Khurana, T. S., Prendergast, R. A., Alameddine, H. S., Tome, F.
M., Fardeau, M., Arahata, K., Sugita, H. and Kunkel, L. M.
(1995). Absence of extraocular muscle pathology in Duchenne's
muscular dystrophy: role for calcium homeostasis in extraocular muscle
sparing. J. Exp. Med.
182,467
-475.
Luther, P. and Squire, J. (1978). Three-dimensional structure of the vertebrate muscle M-region. J. Mol. Biol. 125,313 -324.[CrossRef][Medline]
Mayr, R. (1971). Structure and distribution of fibre types in the external eye muscles of the rat. Tissue Cell 3,433 -462.
McLoon, L. K. and Wirtschafter, J. D. (1996).
N-CAM is expressed in mature extraocular muscles in a pattern conserved among
three species. Invest. Ophthalmol. Vis. Sci.
37,318
-327.
Obermann, W. M., Gautel, M., Weber, K. and Furst, D. O. (1997). Molecular structure of the sarcomeric M band: mapping of titin and myosin binding domains in myomesin and the identification of a potential regulatory phosphorylation site in myomesin. EMBO J. 16,211 -220.[CrossRef][Medline]
Porter, J. D. (2002). Extraocular muscle: cellular adaptations for a diverse functional repertoire. Ann. NY Acad. Sci. 956,7 -16.[Medline]
Porter, J. D. and Baker, R. S. (1996). Muscles
of a different `color': the unusual properties of the extraocular muscles may
predispose or protect them in neurogenic and myogenic disease.
Neurology 46,30
-37.
Porter, J. D., Baker, R. S., Ragusa, R. J. and Brueckner, J. K. (1995). Extraocular muscles: basic and clinical aspects of structure and function. Surv. Ophthalmol. 39,451 -484.[Medline]
Porter, J. D. and Hauser, K. F. (1993). Survival of extraocular muscle in long-term organotypic culture: differential influence of appropriate and inappropriate motoneurons. Dev. Biol. 160,39 -50.[CrossRef][Medline]
Porter, J. D. and Karathanasis, P. (1998). Extraocular muscle in merosin-deficient muscular dystrophy: cation homeostasis is maintained but is not mechanistic in muscle sparing. Cell Tissue Res. 292,495 -501.[CrossRef][Medline]
Porter, J. D., Khanna, S., Kaminski, H. J., Rao, J. S., Merriam,
A. P., Richmonds, C. R., Leahy, P., Li, J. and Andrade, F. H.
(2001a). Extraocular muscle is defined by a fundamentally
distinct gene expression profile. Proc. Natl. Acad. Sci.
USA 98,12062
-12067.
Porter, J. D., Merriam, A. P., Hack, A. A., Andrade, F. H. and McNally, E. M. (2001b). Extraocular muscle is spared despite the absence of an intact sarcoglycan complex in gamma- or delta-sarcoglycan-deficient mice. Neuromusc. Disord. 11,197 -207.[CrossRef][Medline]
Porter, J. D., Rafael, J. A., Ragusa, R. J., Brueckner, J. K., Trickett, J. I. and Davies, K. E. (1998). The sparing of extraocular muscle in dystrophinopathy is lost in mice lacking utrophin and dystrophin. J. Cell Sci. 111,1801 -1811.[Abstract]
Ragusa, R. J., Chow, C. K., St Clair, D. K. and Porter, J. D. (1996). Extraocular, limb and diaphragm muscle group-specific antioxidant enzyme activity patterns in control and mdx mice. J. Neurol. Sci. 139,180 -186.[CrossRef][Medline]
Reddy, K. B., Bialkowska, K. and Fox, J. E.
(2001). Dynamic modulation of cytoskeletal proteins linking
integrins to signaling complexes in spreading cells. Role of skelemin in
initial integrin-induced spreading. J. Biol. Chem.
276,28300
-28308.
Reddy, K. B., Gascard, P., Price, M. G., Negrescu, E. V. and
Fox, J. E. (1998). Identification of an interaction between
the m-band protein skelemin and beta-integrin subunits. Colocalization of a
skelemin-like protein with beta1- and beta3-integrins in non-muscle cells.
J. Biol. Chem. 273,35039
-35047.
Roman, B. B., Wieringa, B. and Koretsky, A. P.
(1997). Functional equivalence of creatine kinase isoforms in
mouse skeletal muscle. J. Biol. Chem.
272,17790
-17794.
Rushbrook, J. I., Weiss, C., Ko, K., Feuerman, M. H., Carleton, S., Ing, A. and Jacoby, J. (1994). Identification of alpha-cardiac myosin heavy chain mRNA and protein in extraocular muscle of the adult rabbit. J. Muscle Res. Cell Motil. 15,505 -515.[CrossRef][Medline]
Spencer, R. F. and Porter, J. D. (1988). Structural organization of the extraocular muscles. Rev. Oculomot. Res. 2,33 -79.[Medline]
Steiner, F., Weber, K. and Furst, D. O. (1999). M band proteins myomesin and skelemin are encoded by the same gene: analysis of its organization and expression. Genomics 56, 78-89.[CrossRef][Medline]
Strehler, E. E., Pelloni, G., Heizmann, C. W. and Eppenberger,
H. M. (1980). Biochemical and ultrastructural aspects of Mr
165,000 M-protein in cross-striated chicken muscle. J. Cell
Biol. 86,775
-783.
Thornell, L. E., Carlsson, E., Kugelberg, E. and Grove, B. K. (1987). Myofibrillar M-band structure and composition of physiologically defined rat motor units. Am. J. Physiol. 253,C456 -C468.
Turner, D. C., Wallimann, T. and Eppenberger, H. M.
(1973). A protein that binds specifically to the M-line of
skeletal muscle is identified as the muscle form of creatine kinase.
Proc. Natl. Acad. Sci. USA
70,702
-705.
Van der Ven, P. F., Ehler, E., Perriard, J. C. and Furst, D. O. (1999). Thick filament assembly occurs after the formation of a cytoskeletal scaffold. J. Muscle Res. Cell Motil. 20,569 -579.[CrossRef][Medline]
van Deursen, J., Heerschap, A., Oerlemans, F., Ruitenbeek, W., Jap, P., ter Laak, H. and Wieringa, B. (1993). Skeletal muscles of mice deficient in muscle creatine kinase lack burst activity. Cell 74,621 -631.[CrossRef][Medline]
Ventura-Clapier, R., Kuznetsov, A., Veksler, V., Boehm, E. and Anflous, K. (1998). Functional coupling of creatine kinases in muscles: species and tissue specificity. Mol. Cell Biochem. 184,231 -247.[CrossRef][Medline]
Watchko, J. F., Daood, M. J. and LaBella, J. J. (1996). Creatine kinase activity in rat skeletal muscle relates to myosin phenotype during development. Pediatr. Res. 40, 53-58.[Medline]
Yang, Y. G., Obinata, T. and Shimada, Y. (2000). Developmental relationship of myosin binding proteins (myomesin, connectin and C-protein) to myosin in chicken somites as studied by immunofluorescence microscopy. Cell Struct. Funct. 25,177 -185.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
M. H. J. Wiesen, S. Bogdanovich, I. Agarkova, J.-C. Perriard, and T. S. Khurana Identification and Characterization of Layer-Specific Differences in Extraocular Muscle M-Bands Invest. Ophthalmol. Vis. Sci., March 1, 2007; 48(3): 1119 - 1127. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Porter, S. Israel, B. Gong, A. P. Merriam, J. Feuerman, S. Khanna, and H. J. Kaminski Distinctive morphological and gene/protein expression signatures during myogenesis in novel cell lines from extraocular and hindlimb muscle Physiol Genomics, February 23, 2006; 24(3): 264 - 275. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Cheng, A. P. Merriam, B. Gong, P. Leahy, S. Khanna, and J. D. Porter Conserved and muscle-group-specific gene expression patterns shape postnatal development of the novel extraocular muscle phenotype Physiol Genomics, July 8, 2004; 18(2): 184 - 195. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Porter, A. P. Merriam, P. Leahy, B. Gong, J. Feuerman, G. Cheng, and S. Khanna Temporal gene expression profiling of dystrophin-deficient (mdx) mouse diaphragm identifies conserved and muscle group-specific mechanisms in the pathogenesis of muscular dystrophy Hum. Mol. Genet., February 1, 2004; 13(3): 257 - 269. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||