|
| ![]() |
|
||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
cGMP-dependent changes in phototaxis: a possible role for the foraging gene in honey bee division of labor
1 Department of Entomology, University of Illinois at Urbana-Champaign, 320
Morrill Hall, 505 S. Goodwin Avenue, Urbana, IL 61801, USA
2 Neuroscience Program, University of Illinois at Urbana-Champaign, 320
Morrill Hall, 505 S. Goodwin Avenue, Urbana, IL 61801, USA
3 Department of Biological Sciences, Purdue University, West Lafayette, IN
47907, USA
4 Department of Zoology, Mississauga Campus, University of Toronto, 3359
Mississauga Road, Mississauga, ON L5L1C6, Canada
* Author for correspondence at present address: Howard Hughes Medical Institute, University of Iowa, College of Medicine, 500 EMRB, Iowa City, IA 52242, USA (e-mail: yehuda-ben-shahar{at}uiowa.edu)
Accepted 7 April 2003
| Summary |
|---|
|
|
|---|
Key words: honey bee, Apis mellifera, foraging gene (Amfor), cGMP-dependent protein kinase, PKG, phototaxis, division of labor, behavioral development
| Introduction |
|---|
|
|
|---|
The onset of foraging in honey bees is the culmination of the process of
behavioral development that underlies colony division of labor
(Robinson, 1992
). A worker bee
begins her adult life by progressing through a series of tasks in the beehive
and then typically begins to forage at about 3 weeks of age. The timing of a
bee's shift from hive to foraging duties is flexible, and depends on the needs
of the colony. It is also associated with changes in metabolism, exocrine
gland activity, hormone levels, brain structure, brain chemistry and gene
expression in the brain (Robinson,
2002
).
PKG has numerous roles in a nervous system
(Ruth, 1999
;
Wang and Robinson, 1997
), but
how it influences the shift from working in the hive to foraging in honey bees
is not known. Ben-Shahar et al.
(2002
) suggested that perhaps
the upregulation of PKG activity affects honey bee behavioral development
via effects on the visual system, because they found strong
expression of Amfor in the optic lobe lamina and in a subset of
intrinsic cells of the mushroom bodies known to receive visual input
(Ehmer and Gronenberg, 2002
;
Gronenberg, 2001
). In
addition, cGMP has been shown to have an important role in the development of
the visual system in Drosophila
(Gibbs et al., 2001
). Flies
carrying a mutation in a subunit of soluble guanylate cyclase (the enzyme that
makes cGMP) show reduced photoreceptor response to light stimuli and altered
phototactic behavior (Gibbs et al.,
2001
). Honey bee division of labor is known to involve
maturational changes in responsive to olfactory task-related stimuli (e.g.
Robinson, 1987a
), but the role
of vision in the control of honey bee behavioral development has not been
studied.
Bees are extremely visual animals, with a large portion of their brain
dedicated to visual processing
(Gronenberg, 2001
). Foragers
perform well in different laboratory-based visual learning paradigms, no doubt
because they rely considerably on visual abilities when foraging in the field
(Zhang et al., 1999
). Foragers
use optic flow to measure distance (Esch
et al., 2001
), discriminate easily between different shapes
(Horridge, 2000
) and have
well-developed color vision (Werner et
al., 1988
).
We tested the hypothesis that the effects of Amfor on honey bee
behavioral development are due, at least in part, to an increase in positive
phototaxis. We focused on this aspect of the visual system because honey bees
experience a major change in exposure to light when they shift from working in
the dark hive to foraging outside. Menzel and Greggers
(1985
) have shown that
foragers are positively phototactic, but it is not known whether this behavior
is developmentally regulated. Young bees do emerge from the hive to take brief
defecation and orientation flights prior to the beginning of their foraging
phase (Capaldi et al., 2000
),
but these are transient events. Perhaps more chronic increases in positive
phototaxis occur in older pre-foraging bees, which then positions them closer
to the hive entrance. There they may be induced to forage by exposure to
olfactory and mechanical stimuli, such as communication by successful foragers
via the dance language (Frisch,
1967
). A behaviorally related change in phototaxis has recently
been reported for queen harvester ants (Messor pergandei); queens are
positively phototactic as virgins but became negatively phototactic after
mating (Julian and Gronenberg,
2002
).
We tested the hypothesis that the effects of Amfor on honey bee
behavioral development are due, at least in part, to an increase in positive
phototaxis by addressing three issues. First, we determined whether the
previously reported increase in Amfor brain expression in foragers is
also detectable in the brains of bees that are not foraging, but are
nevertheless engaged in a task that requires leaving the hive. This was
accomplished by comparing two groups of middle-aged bees: food handlers and
corpse removers (undertakers). Although a majority of bees that are found
outside the hive are foragers, other tasks such as undertaking occur outside
as well. Undertakers are a subset group of bees that pick up corpses in the
hive and then fly out to remove them
(Visscher, 1983
). Undertakers
are younger than foragers, but they have high, forager-like titers of juvenile
hormone (JH), which influences the pace of honey bee behavioral development
(Huang et al., 1994
). Second,
we asked whether there is an ontogeny of phototaxis behavior in association
with honey bee behavioral development, and if so, whether it can be
accelerated by treatment that activates PKG. Third, we studied whether the
observed treatment effects of cGMP on phototaxis are due to changes in overall
levels of locomotor activity, the timing of the onset of locomotor circadian
rhythmicity (Bloch and Robinson,
2001
; Moore et al.,
1998
; Toma et al.,
2000
), or general photoreceptor sensitivity.
In addition, we explored whether the cAMP/PKA pathway may also be playing a
role similar to the cGMP/PKG pathway in the honey bee. These pathways are
known to interact in other behavioral systems including in honey bees
(Muller and Hildebrandt,
2002
). We determined the effects of cAMP treatment on phototaxis
and measured the expression of genes encoding the regulatory and catalytic
subunits of PKA in the brains of bees performing different behaviors.
| Materials and methods |
|---|
|
|
|---|
Bees for mRNA expression analysis were collected from triple-cohort
colonies (Ben-Shahar and Robinson,
2001
), which were established by sequentially introducing three
cohorts of 8001000 1-day-old bees to a small hive at 1-week intervals.
Each colony was also given two frames of honeycomb for food storage and egg
laying and an unrelated, naturally mated, queen. The following behavioral
groups were collected (Robinson,
1987b
): nurses, identified as 1-week-old bees that repeatedly
inserted their heads into honeycomb cells containing larvae; food handlers,
2-week-old bees that were found on a honeycomb frame containing honey;
undertakers, 2-week-old bees that removed corpses from the hive; and foragers,
bees older than 3 weeks of age returning to the hive with either clearly
visible pollen loads on their hind legs or distended abdomens (bearing either
nectar or water). To induce undertaking behavior, freshly killed bees
(50100) were put in the hive prior to sampling
(Visscher, 1983
). All bees
were collected directly into liquid nitrogen and stored at -80°C until
brain dissection (N=89 per group). Bees were sampled from
three, unrelated colonies.
mRNA expression analysis
We measured Amfor mRNA levels for each brain individually using
real-time quantitative reverse transcription-polymerase chain reaction
(qRT-PCR) with TaqMan® technology (ABI, Foster City, CA, USA). Analysis
was as described (Ben-Shahar et al.,
2002
). Brains were dissected frozen
(Schulz and Robinson, 1999
)
and RNA extracted with the mini-RNeasy kit according to the manufacturer's
instructions with on-column DNase I treatment (Qiagen, Valencia, CA, USA). The
RT reaction was performed with random hexamers on 200 ng total RNA according
to the TaqMan® RT-PCR kit protocol. The PCR reaction was performed with
gene-specific primers and dual-labeled TaqMan® probes. Primers and probe
for Amfor were as described
(Ben-Shahar et al., 2002
). PCR
conditions were the default settings of the ABI TaqMan® 9700 SDS machine
(ABI). We determined the cycle threshold (Ct) during the geometric phase of
the PCR amplification plots, as recommended by the manufacturer. Relative
differences in Amfor transcripts were quantified using the
Ct
method (Bloch and Robinson,
2001
) with the A. mellifera ortholog of rp49
(GenBank AF441189) mRNA as a `housekeeping' gene loading control
(Ben-Shahar et al., 2002
).
rp49 is widely used in this way in Drosophila and other
organisms (Daborn et al.,
2002
; Thellin et al.,
1999
). For graphical presentation we used the
2-
Ct transformation according to ABI
user bulletin 20 (see also Bloch and
Robinson, 2001
). All data were normalized relative to values for
nurse bees.
Brains from the first trial were also used to measure mRNA levels for the genes encoding the regulatory and catalytic subunits of protein kinase A (PKAr and PKAc, respectively). Primers and probes for these genes were as follows. PKAr: probe, FAM6-AGCCGAAGCAGCGCGAGGTTTA-TAMRA, forward primer, TTTACTTCGCCCACAGCGT, reverse primer, CGAATTGGCGCTAGTGACAC; PKAc: probe, FAM6-CAAAAGAAAATCGAGGCCCCGTTCA-TAMRA, forward primer, ACCGATTGGATAGCCGTCTT, reverse primer, CCTGGCCCTTTACATTTTGG.
Treatments
We paint-marked groups of 50 1-day-old bees a distinctive color and placed
each group in a 6 cmx12 cmx18 cm wooden cage in an incubator
(33°C, 95% relative humidity) for 4 days. Bees were treated orally with a
50% sucrose solution containing either 8-Br-cGMP (500 µmol l-1,
Sigma-Aldrich, St Louis, MO, USA) or 8-Br-cAMP (1000 µmol l-1;
Sigma-Aldrich) while control bees received sucrose alone. These compounds (and
doses) were shown to increase PKG and PKA activity, respectively, without
significant `cross reactivity'; cGMP treatment did not cause an increase in
PKA activity and cAMP treatment did not cause an increase in PKG activity
(Ben-Shahar et al., 2002
).
Freshly mixed solutions were given daily to each cage of bees. On day 5, all
surviving bees from each cage were counted (80100% survival for each
cage) and used in the following experiments.
Positive phototaxis assay
We first compared the performance of nurses (710 days old) and
foragers (older than 21 days old). Each bee was removed from its colony in a
small glass vial and anesthetized on ice. Once immobile, it was introduced to
a small wooden cage as above. We placed 10 nurses and 10 foragers together in
each cage. Bees were allowed to recover for 2 h at room temperature in the
dark, and then were tested as follows. The cage was attached to a wooden
tunnel a little taller than a bee (10 mm) covered with Plexiglass
(Fig. 1). A narrow light beam
from a 150 W quartz white light illuminator (Fisher Scientific, USA) was aimed
through the tunnel towards the bottom part of the cage. All bees that moved
through the tunnel from the cage towards the light in a period of 3 min were
scored as positively phototactic. All bees were counted once at the end of the
testing period to prevent repeat counts of the same bees. Comparisons of
nurses and foragers were also made in the same experimental apparatus with the
light off, to be able to distinguish differences in positive phototaxis from
differences in general locomotor activity. Nurses and foragers from two
unrelated colonies were compared in two trials of this experiment (under both
light and dark conditions). Effects of cGMP, cAMP and a sucrose control were
compared in nine trials. Each trial used bees from a different, unrelated,
colony.
|
Electroretinogram analysis
An electroretinogram (ERG) assay was used to test for differences between
nurses and foragers in photoreceptor sensitivity, and for effects of cGMP
treatment. We looked for differences in both the amplitude and shape of the
ERG response. Nurses and foragers and treated bees were obtained as described
above.
ERGs were recorded using techniques described for Drosophila
(Larrivee et al., 1981
). Bees
were immobilized with wax with their right side down on a glass coverslip, and
their left compound eye facing upward. The wax also ensured that the bee could
not move any of its legs or antennae. The reference electrode was inserted
into the head while the recording electrode was inserted into the compound eye
through the cornea. White light produced by a xenon arc lamp (Bausch &
Lomb, Rochester, NY, USA) was used with Wratten (Kodak, Rochester, NY, USA)
neutral density filtration to achieve the desired light intensity. The
unfiltered light intensity (I0) was 4 mW cm-2
at the level of the bee. Recordings were made over a 4-log unit range of
stimulus intensities (logI/I0). The bees were
dark-adapted for 1 min before a 3 s light stimulus was given. All recordings
were made at 25°C. Voltage signals were recorded and amplified with a
high-impedance microprobe amplifier (W-P instruments, Longmount, CO, USA). The
signals were then digitized at 2kHz with an analog-to-digital converter
(Digi-Data 1200A, Columbia, MD, USA) and the data acquired and analyzed in a
computer with Axoscope (Axon Instruments, Foster City, CA, USA). We did not
vary either the positioning of electrodes or their depth of penetration into
the cornea. Under our recording conditions, we detected no variation in
waveforms either within or between behavioral or treatment groups of bees
(data not shown). Variation in ERG amplitude was also minor, as indicated by
the small standard deviations (Fig.
4).
|
Measurement of locomotor activity and the ontogeny of circadian
rhyhmicity
We studied the effects of cGMP and cAMP on locomotor activity and on the
ontogeny of locomotor circadian rhythmicity using a well-established
laboratory assay of individual bee behavior
(Bloch and Robinson, 2001
;
Toma et al., 2000
). Bees were
treated in groups as described above and then transferred on day 5 to
individual cages in an environmental chamber (33°C; either 12 h:12 h
light:dark `LD' or 24 h dark `DD'). Locomotor behavior was monitored with
automatic infrared motion sensors (DataCol 3.0 acquisition system; Mini-Mitter
Co., OR, USA; Toma et al.,
2000
); events (crossing infrared beam) were analyzed in 10 min
bins to determine overall activity levels.
2
periodogram analysis [P<0.01
(Bloch et al., 2001
); Tau
program, Mini-Mitter Co., OR, USA] was used to determine onset of rhythmicity,
and the percentage of bees that showed clear circadian rhythm at each age
calculated. We also calculated tau (the period of rhythmicity). Data
were collected for 4 days. We performed two trials of this experiment, one in
each light regime.
Statistical analysis
mRNA data were analyzed using two-way analysis of variance (ANOVA) with
trial and task as factors. Pair-wise LSD post hoc tests were used to
compare the different behavioral groups in each trial. Effects of cGMP and
cAMP on phototaxis were analyzed by calculating the proportion of bees in each
group showing positive phototaxis in each trial (N=9), followed by
the improved FreemanTukey arcsine square-root transformation
(Freemen and Tukey, 1954
), and
one-way ANOVA with pair-wise LSD post-hoc tests. Differences in the
proportion of foragers and nurses showing positive phototaxis were analyzed by
2x2
2 analysis (Fisher's exact test was used
when necessary). Effects of cGMP on locomotor activity and tau were
analyzed by one-way ANOVA and on % rhythmicity by 2x3
2 analysis. ERG data were analyzed with a repeated
measure one-way ANOVA. All statistical tests were performed with the SYSTAT
8.0 statistical package (Systat Software Inc., Richmond, CA, USA).
| Results |
|---|
|
|
|---|
|
Effect of cGMP treatment on phototaxis
A significantly greater proportion of foragers showed positive phototaxis
relative to nurse bees (Fig.
3A; trial 1,
213.3,1,
P<0.01; trial 2,
27.2,1,
P<0.01). There were no significant differences between the two
behavioral groups under dark conditions (trial 1,
20,1, P>0.05; trial 2,
20,1 P>0.05). This result
indicates that the differences in phototaxis were not due to differences in
locomotor behavior.
|
A significantly greater proportion of cGMP-treated bees showed positive phototaxis relative to cAMP-treated or untreated bees (Fig. 3B; N=9 cages per treatment; one-way ANOVA; P<0.001). There were no significant differences between the groups under dark conditions (P>0.05). The proportion of cGMP-treated bees showing positive phototaxis was not as high as for foragers, but the treatment effect was substantial, especially given that these were young bees reared as adults in laboratory cages.
Effect of cGMP treatment on electroretinogram measurements
Repeated-measures ANOVA revealed a highly significant increase in ERG
response amplitude with increasing light intensity (P<0.001), but
no differences between nurses and foragers
(Fig. 4). We expected that if
cGMP treatment had a direct effect on photoreceptor sensitivity, then treated
bees would show an increase in ERG response amplitude relative to control
bees, especially at the lower light intensities. However, cGMP treatment did
not have a significant effect on ERG amplitude
(Fig. 4). These results
indicate that the cGMP-treatment effects on positive phototaxis reported above
are not due to changes in primary photoreceptor activity.
Effect of cGMP treatment on circadian locomotor activity
The cGMP-treatment effects on positive phototaxis reported above are not
due to a general increase in locomotor activity or to changes in circadian
rhythms of locomotion. There was no effect of cGMP treatment on activity,
under either D:L or D:D light regimes (Fig.
5; ANOVA: D:L, P>0.05; D:D, P>0.05). Under
the DD regime there were also no effects of treatment on tau (ANOVA:
P>0.05; Fig. 5) or
the percentage of bees developing a circadian rhythm for locomotor behavior by
day 7 (
20.120,2.000, P=0.057;
Fig. 5). The possibility of
some linkage between age at onset of foraging in the field and the age at
onset of circadian rhythmicity in the laboratory was suggested by earlier
findings (Moore et al., 1998
).
The results reported here suggest that there is no obligate connection between
these two aspects of behavioral development, at least with respect to the
involvement of the cGMP pathway.
|
PKAc and PKAr expression as a function of task
Expression analysis of genes in the cAMP/PKA pathway revealed no strong
association with honey bee division of labor
(Fig. 6). Although brain PKAr
mRNA levels were significantly (P<0.01) lower in nurses relative
to food handlers, undertakers and foragers, there were no differences among
the four groups for brain PKAc mRNA levels (P=0.966). These results
are consistent with findings showing no effect of cAMP treatments on either
foraging behavior (Ben-Shahar et al.,
2002
) or positive phototaxis.
|
| Discussion |
|---|
|
|
|---|
Amfor upregulation was previously associated with foraging in
honey bees, based on comparisons of nurses and foragers only
(Ben-Shahar et al., 2002
). Our
results indicate that this upregulation is more generally associated with
working outside the hive. Undertakers had high, forager-like, brain levels of
Amfor transcript, despite the fact that they were the same age as
food handlers, while food handlers, working inside the hive, had low,
nurse-like, levels. It is not known whether the upregulation of Amfor
occurs as a consequence of exposure to light because both undertakers and
foragers could have been out before they were sampled. However, both nurse
bees and food handlers probably took orientation flights, which are typical of
all younger bees (Capaldi et al.,
2000
), suggesting that light exposure is not sufficient to trigger
the upregulation of this gene. In addition, it appears that exposure to light
does not cause a rapid change in Amfor expression, because
undertakers had high transcript levels even though they were collected just as
they were exiting the hive. This suggests that more short-term changes in
phototaxis, such as presumably occur when a young bee leaves for orientation
flights, are not associated with a short-term increase in Amfor
expression.
Foragers were known to be strongly positively phototactic
(Menzel and Greggers, 1985
)
and our findings indicate that they are much more so than nurses. This is
intriguing in the context of a prominent theory that explains division of
labor on the basis of the classical stimulusresponse model
(Beshers and Fewell, 2001
;
Beshers et al., 2001
,
1999
;
Manning, 1967
;
Roeder, 1967
). According to
the stimulusresponse model of division of labor, differences in task
performances between individuals occur because of differences both in
probability of exposure to certain task-specific stimuli and differences in
responsiveness to these stimuli (Beshers
and Fewell, 2001
; Beshers et al.,
2001
,
1999
). Age-related changes in
behavior are thought to be a consequence of developmental changes in these two
factors (which are influenced by JH, octopamine, Amfor, and no doubt
many other agents that influence neural plasticity; see
Robinson, 2002
). Given that
the Apis mellifera mostly nests in dark, enclosed cavities, light can
serve as a reliable indicator of the location of the nest entrance, which is
where much foraging-related activity occurs
(Frisch, 1967
). A
developmental increase in positive phototaxis may thus position bees closer to
the hive entrance where they may be induced to forage by exposure to olfactory
and mechanical stimuli, such as successful foragers communicating by means of
the dance language (Frisch,
1967
).
Alternatively, the increased positive phototaxis observed in foragers may
relate to a general increased responsiveness to a variety of stimuli
associated with the switch from in-hive tasks to foraging. Age-related
increases in responsiveness to alarm pheromones
(Robinson, 1987a
) and sucrose
(Pankiw and Page, 1999
;
Pankiw et al., 2001
) have been
reported, and octopamine increases responsiveness to brood pheromone
(Barron et al., 2002
), a
multi-functional pheromone that serves as a stimulus for foraging
(Pankiw and Page, 2001
).
Electroretinogram analysis indicates that the cGMP-induced increase in
positive phototaxis was not based on effects of sensitivity to light per
se. This is in agreement with Menzel and Greggers
(1985
), who concluded that
positive phototaxis in foragers was probably mediated by neural activity in
the optic lobe lamina, suggesting regulation by second-order interneurons
rather than by the photoreceptor cells themselves. Ben-Shahar et al.
(2002
) reported strong
expression of Amfor in the lamina and in a subset of intrinsic cells
of the mushroom bodies known to receive visual input
(Ehmer and Gronenberg, 2002
;
Gronenberg, 2001
). This is
also consistent with findings from Menzel and Greggers
(1985
), who showed that
positive phototaxis in returning foragers is probably due to activity of cells
in the eye lamina. Our results are also in agreement with findings from
Drosophila suggesting that, contrary to vertebrates, insects do not
use cGMP signaling as the main phototransduction second messenger
(Bloomquist et al., 1988
).
Perhaps PKG is involved in modifying the function of neuronal circuits in the
lamina and/or mushroom bodies via phosphorylation of some component
molecules, which is similar to the affect of PKG on olfaction in mammals
(Kroner et al., 1996
).
cGMP/PKG-dependent influences on honey bee behavioral development are not
due to effects on locomotor activity or the ontogeny of a circadian locomotor
rhythm. Previous work has shown an intriguing association between the onset of
circadian behavioral rhythmicity and behavioral development in honey bees
(Moore et al., 1998
), as well
as a major role for PKG signaling in mammalian clock function
(Ferreyra and Golombek, 2001
;
Gillette and Tischkau, 1999
).
Whether PKG signaling affects other aspects of circadian clock function in
bees and other insects awaits further experimentation.
PKG influences phototaxis in honey bees, but our experiments do not rule
out effects on other sensory systems as well. As in Drosophila
(Osborne et al., 1997
) and the
honey bee (Ben-Shahar et al.,
2002
), cGMP signaling is involved in the regulation of feeding
behavior in molluscs (Della-Fera et al.,
1981
; Elphick et al.,
1995
), hydra (Colasanti et
al., 1997
), and C. elegans
(Stansberry et al., 2001
;
Fujiwara et al., 2002
;
L'Etoile et al., 2002
). In
most of these cases the influences on feeding are mediated by effects on
chemosensation. In Drosophila, allelic variation in pkg
(for) causes variation in both spontaneous and evoked neuronal
activity (Renger et al.,
1999
), as well as in habituation of the giant fiber escape circuit
(Engel et al., 2000
). It is
not known whether these effects in flies are related to feeding behavior, but
the results demonstrate that PKG can modulate neuronal activity.
There are interactions between the PKA and PKG signaling pathways in other
behavioral systems (Centonze et al.,
2001
; Kroner et al.,
1996
), and recently it was shown in bees that habituation of the
proboscis extension reflex can be affected by cGMP-mediated PKA activation
(Muller and Hildebrandt,
2002
). We failed to detect evidence for such interactions in the
context of phototaxis, which is consistent with earlier findings on the
regulation of age at onset of foraging. cAMP analog treatment increased PKA
activity in the bee brain but did not cause precocious foraging
(Ben-Shahar et al., 2002
), and
in the present study did not cause precocious phototaxis. In addition, only
one of two cAMP-related genes showed consistent changes in association with
honey bee behavioral maturation. These results are difficult to interpret
because PKA functions as a holoenzyme comprising two regulatory and two
catalytic subunits (Johnson et al.,
2001
), so perhaps increases in mRNA abundance for both are not
necessary to increase PKA activity. Nevertheless, our results suggest that
upregulation of cGMP signaling is involved in regulating phototaxis and age at
the onset of foraging in honey bees, independent of cAMP levels.
We have discovered a role for cGMP signaling in modulating an important sensory process in the honey bee, vision. This process controls a behavioral response positive phototaxis that contributes to a complex behavioral transition, the onset of foraging. The transition from working in the hive to foraging plays a major role in colony social organization. Dissection of a complex social trait into behavioral components and identifying underlying mechanisms at the molecular and neural systems levels are the first steps towards understanding how genes influence behavioral plasticity.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Barron, A. B., Schulz, D. J. and Robinson, G. E. (2002). Octopamine modulates responsiveness to foraging-related stimuli in honey bees (Apis mellifera). J. Comp. Physiol. A 188,603 -610.
Ben-Shahar, Y., Robichon, A., Sokolowski, M. B. and Robinson, G. E. (2002). Behavior influenced by gene action across different time scales. Science 296,742 -744.
Ben-Shahar, Y. and Robinson, G. E. (2001). Satiation differentially affects performance in a learning assay by nurse and forager honey bees. J. Comp. Physiol. A 187,891 -899.[CrossRef][Medline]
Beshers, S. N. and Fewell, J. H. (2001). Models of division of labor in social insects. Annu. Rev. Entomol. 46,413 -440.[CrossRef][Medline]
Beshers, S. N., Huang, Z. Y., Oono, Y. and Robinson, G. E. (2001). Social inhibition and the regulation of temporal polyethism in honey bees. J. Theor. Biol. 213,461 -479.[CrossRef][Medline]
Beshers, S. N., Robinson, G. E. and Mittenthal, J. E. (1999). Response thresholds and division of labor in insect colonies. In Information Processing in Social Insects (ed. J. M. Pasteels), pp. 115-139. Berlin: Birkhauser Verlag.
Bloch, G. and Robinson, G. E. (2001). Reversal of honeybee behavioural rhythms. Nature 410, 1048.[CrossRef][Medline]
Bloch, G., Toma, D. P. and Robinson, G. E. (2001). Behavioral rhythmicity, age, division of labor and period expression in the honey bee brain. J. Biol. Rhyth. 16,444 -456.
Bloomquist, B. T., Shortridge, R. D., Schneuwly, S., Perdew, M., Montell, C., Steller, H., Rubin, G. and Pak, W. L. (1988). Isolation of a putative phospholipase C gene of Drosophila, norpA, and its role in phototransduction. Cell 54,723 -733.[CrossRef][Medline]
Capaldi, E. A., Smith, A. D., Osborne, J. L., Fahrbach, S. E., Farris, S. M., Reynolds, D. R., Edwards, A. S., Martin, A., Robinson, G. E., Poppy, G. M. et al. (2000). Ontogeny of orientation flight in the honeybee revealed by harmonic radar. Nature 403,537 -540.[CrossRef][Medline]
Centonze, D., Picconi, B., Gubellini, P., Bernardi, G. and Calabresi, P. (2001). Dopaminergic control of synaptic plasticity in the dorsal striatum. Eur. J. Neurosci. 13,1071 -1077.[CrossRef][Medline]
Colasanti, M., Venturini, G., Merante, A., Musci, G. and Lauro,
G. M. (1997). Nitric oxide involvement in Hydra
vulgaris very primitive olfactory-like system. J.
Neurosci. 17,493
-499.
Daborn, P. J., Yen, J. L., Bogwitz, M. R., Le Goff, G., Feil,
E., Jeffers, S., Tijet, N., Perry, T., Heckel, D., Batterham, P. et
al. (2002). A single p450 allele associated with insecticide
resistance in Drosophila. Science
297,2253
-2256.
Della-Fera, M. A., Baile, C. A. and Peikin, S. R. (1981). Feeding elicited by injection of the cholecystokinin antagonist dibutyryl cyclic GMP into the cerebral ventricles of sheep. Physiol. Behav. 26,799 -801.[CrossRef][Medline]
Ehmer, B. and Gronenberg, W. (2002). Segregation of visual input to the mushroom bodies in the honeybee (Apis mellifera). J. Comp. Neurol. 451,362 -373.[CrossRef][Medline]
Elphick, M. R., Kemenes, G., Staras, K. and O'Shea, M. (1995). Behavioral role for nitric oxide in chemosensory activation of feeding in a mollusc. J. Neurosci. 15,7653 -7664.[Abstract]
Engel, J. E., Xie, X. J., Sokolowski, M. B. and Wu, C. F.
(2000). A cGMP-dependent protein kinase gene, foraging,
modifies habituation-like response decrement of the giant fiber escape circuit
in Drosophila. Learn. Mem.
7, 341-352.
Esch, H. E., Zhang, S., Srinivasan, M. V. and Tautz, J. (2001). Honeybee dances communicate distances measured by optic flow. Nature 411,581 -583.[CrossRef][Medline]
Ferreyra, G. A. and Golombek, D. A. (2001).
Rhythmicity of the cGMP-related signal transduction pathway in the mammalian
circadian system. Am. J. Physiol. Regul. Integr. Comp.
Physiol. 280,R1348
-R1355.
Freemen, M. F. and Tukey, J. W. (1954). Transformations related to the angular and the square root. Ann. Math. Stat. 21,607 -611.
Frisch, K. v. (1967). The Dance Language and Orientation of Bees. Cambridge, MA: Belknap Press of Harvard University Press.
Fujiwara, M., Sengupta, P. and McIntire, S. L. (2002). Regulation of body size and behavioral state of C. elegans by sensory perception and the EGL-4 cGMP-dependent protein kinase. Neuron 36,1091 -1102.[CrossRef][Medline]
Gibbs, S. M., Becker, A., Hardy, R. W. and Truman, J. W.
(2001). Soluble guanylate cyclase is required during development
for visual system function in Drosophila. J.
Neurosci. 21,7705
-7714.
Gillette, M. U. and Tischkau, S. A. (1999). Suprachiasmatic nucleus: the brain's circadian clock. Recent Prog. Horm. Res. 54,33 -58.
Gronenberg, W. (2001). Subdivisions of hymenopteran mushroom body calyces by their afferent supply. J. Comp. Neurol. 435,474 -489.[CrossRef][Medline]
Horridge, A. (2000). Seven experiments on pattern vision of the honeybee, with a model. Vision Res. 40,2589 -2603.[CrossRef][Medline]
Huang, Z. Y., Robinson, G. E. and Borst, D. W. (1994). Physiological correlates of division of labor among similarly aged honey bees. J. Comp. Physiol. A 174,731 -739.[Medline]
Johnson, D. A., Akamine, P., Radzio-Andzelm, E., Madhusudan, M. and Taylor, S. S. (2001). Dynamics of cAMP-dependent protein kinase. Chem. Rev. 101,2243 -2270.[CrossRef][Medline]
Julian, G. E. and Gronenberg, W. (2002). Reduction of brain volume correlates with behavioral changes in queen ants. Brain Behav. Evol. 60,152 -164.[CrossRef][Medline]
Kroner, C., Boekhoff, I., Lohmann, S. M., Genieser, H. G. and Breer, H. (1996). Regulation of olfactory signalling via cGMP-dependent protein kinase. Eur. J. Biochem. 236,632 -637.[Medline]
Larrivee, D. C., Conrad, S. K., Stephenson, R. S. and Pak, W.
L. (1981). Mutation that selectively affects rhodopsin
concentration in the peripheral photoreceptors of Drosophila
melanogaster. J. Gen. Physiol.
78,521
-545.
L'Etoile, N. D., Coburn, C. M., Eastham, J., Kistler, A., Gallegos, G. and Bagmann, C. I. (2002). The cyclic GMP-dependent protein kinase EGL-4 regulates olfactory adaptation in C. elegans. Neuron 36,1079 -1089.[CrossRef][Medline]
Manning, A. (1967). An Introduction to Animal Behavior. Massachusetts: Addison-Wesley.
Menzel, C. R. and Greggers, U. (1985). Natural phototaxis and its relationship to color vision in honey bees. J. Comp. Physiol. A 157,311 -322.[CrossRef]
Moore, D., Angel, J. E., Cheesman, I. M., Fahrbach, S. E. and Robinson, G. E. (1998). Timekeeping in the honey bee colony: integration of circadian rhythms and division of labor. Behav. Ecol. Sociobiol. 43,147 -160.[CrossRef]
Muller, U. and Hildebrandt, H. (2002). Nitric
oxide/cGMP-mediated protein kinase A activation in the antennal lobes plays an
important role in appetitive reflex habituation in the honeybee. J.
Neurosci. 22,8739
-8747.
Osborne, K. A., Robichon, A., Burgess, E., Butland, S., Shaw, R.
A., Coulthard, A., Pereira, H. S., Greenspan, R. J. and Sokolowski, M.
B. (1997). Natural behavior polymorphism due to a
cGMP-dependent protein kinase of Drosophila.
Science 277,834
-836.
Pankiw, T. and Page, R. E., Jr (1999). The effect of genotype, age, sex, and caste on response thresholds to sucrose and foraging behavior of honey bees (Apis mellifera L.). J. Comp. Physiol. A 185,207 -213.[CrossRef][Medline]
Pankiw, T. and Page, R. E., Jr (2001). Brood pheromone modulates honeybee (Apis mellifera L.) sucrose response thresholds. Behav. Ecol. Sociobiol. 49,206 -213.[CrossRef]
Pankiw, T., Waddington, K. D. and Page, R. E., Jr (2001). Modulation of sucrose response thresholds in honey bees (Apis mellifera L.): influence of genotype, feeding, and foraging experience. J. Comp. Physiol. A 187,293 -301.[CrossRef][Medline]
Renger, J. J., Yao, W. D., Sokolowski, M. B. and Wu, C. F. (1999). Neuronal polymorphism among natural alleles of a cGMP-dependent kinase gene, foraging, in Drosophila. J. Neurosci. 19,RC28 .
Robinson, G. E. (1987a). Modulation of alarm pheromone perception in the honey bee: Evidence for division of labor based on hormonally regulated response thresholds. J. Comp. Physiol. A 160,613 -620.[CrossRef]
Robinson, G. E. (1987b). Regulation of honey bee age polyethism by juvenile hormone. Behav. Ecol. Sociobiol. 20,329 -338.[CrossRef]
Robinson, G. E. (1992). Regulation of division of labor in insect societies. Annu. Rev. Entomol. 37,637 -665.[CrossRef][Medline]
Robinson, G. E. (2002). Genomics and integrative analyses of division of labor in honey bee colonies. Am. Nat. 60,5160 -5172.
Roeder, K. D. (1967). Nerve Cells and Insect Behavior. Cambridge, MA: Harvard University Press.
Ruth, P. (1999). Cyclic GMP-dependent protein kinases: understanding in vivo functions by gene targeting. Pharm. Ther. 82,355 -372.[CrossRef][Medline]
Scheiner, R., Erber, J. and Page, R. E., Jr (1999). Tactile learning and the individual evaluation of the reward in honey bees (Apis mellifera L.). J. Comp. Physiol. A 185,1 -10.[CrossRef][Medline]
Scheiner, R., Page, R. E., Jr and Erber, J. (2001). Responsiveness to sucrose affects tactile and olfactory learning in preforaging honey bees of two genetic strains. Behav. Brain Res. 120,67 -73.[CrossRef][Medline]
Schulz, D. J. and Robinson, G. E. (1999). Biogenic amines and division of labor in honey bee colonies: behaviorally related changes in the antennal lobes and age-related changes in the mushroom bodies. J. Comp. Physiol. A 184,481 -488.[CrossRef][Medline]
Stansberry, J., Baude, E. J., Taylor, M. K., Chen, P.-J., Jin, S.-W., Ellis, R. E. and Uhler, M. D. (2001). A cGMP-dependent protein kinase is implicated in wild-type motility in C. elegans. J. Neurochem. 76,1177 -1187.[CrossRef][Medline]
Thellin, O., Zorzi, W., Lakaye, B., De Borman, B., Coumans, B., Hennen, G., Grisar, T., Igout, A. and Heinen, E. (1999). Housekeeping genes as internal standards: use and limits. J. Biotechnol. 75,291 -295.[CrossRef][Medline]
Toma, D. P., Bloch, G., Moore, D. and Robinson, G. E.
(2000). Changes in period mRNA levels in the brain and
division of labor in honey bee colonies. Proc. Natl. Acad. Sci.
USA 97,6914
-6919.
Visscher, P. K. (1983). The honey bee way of death: Necrophoric behavior in Apis mellifera colonies. Anim. Behav. 31,1070 -1076.[CrossRef]
Wang, X. and Robinson, P. J. (1997). Cyclic GMP-dependent protein kinase and cellular signaling in the nervous system. J. Neurochem. 68,443 -456.[Medline]
Werner, A., Menzel, R. and Wehrhahn, C. (1988). Color constancy in the honeybee. J. Neurosci. 8, 156-159.[Abstract]
Zhang, S. W., Lehrer, M. and Srinivasan, M. V. (1999). Honeybee memory: navigation by associative grouping and recall of visual stimuli. Neurobiol. Learn. Mem. 72,180 -201.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
A.L. Toth and G.E. Robinson Evo-Devo and the Evolution of Social Behavior: Brain Gene Expression Analyses in Social Insects Cold Spring Harb Symp Quant Biol, October 22, 2009; (2009) sqb.2009.74.026v1. [Abstract] [PDF] |
||||
![]() |
C. W. Whitfield, Y. Ben-Shahar, C. Brillet, I. Leoncini, D. Crauser, Y. LeConte, S. Rodriguez-Zas, and G. E. Robinson Inaugural Article: Genomic dissection of behavioral maturation in the honey bee PNAS, October 31, 2006; 103(44): 16068 - 16075. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yerushalmi, S. Bodenhaimer, and G. Bloch Developmentally determined attenuation in circadian rhythms links chronobiology to social organization in bees J. Exp. Biol., March 15, 2006; 209(6): 1044 - 1051. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Roberts and M. M. Elekonich Muscle biochemistry and the ontogeny of flight capacity during behavioral development in the honey bee, Apis mellifera J. Exp. Biol., November 15, 2005; 208(22): 4193 - 4198. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. G. Kamita, K. Nagasaka, J. W. Chua, T. Shimada, K. Mita, M. Kobayashi, S. Maeda, and B. D. Hammock A baculovirus-encoded protein tyrosine phosphatase gene induces enhanced locomotory activity in a lepidopteran host PNAS, February 15, 2005; 102(7): 2584 - 2589. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Leoncini, Y. Le Conte, G. Costagliola, E. Plettner, A. L. Toth, M. Wang, Z. Huang, J.-M. Becard, D. Crauser, K. N. Slessor, et al. From the Cover: Regulation of behavioral maturation by a primer pheromone produced by adult worker honey bees PNAS, December 14, 2004; 101(50): 17559 - 17564. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Ruppell, T. Pankiw, and R. E. Page Jr. Pleiotropy, Epistasis and New QTL: The Genetic Architecture of Honey Bee Foraging Behavior J. Hered., November 1, 2004; 95(6): 481 - 491. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. MacPherson, S. M. Lohmann, and S.-A. Davies Analysis of Drosophila cGMP-dependent Protein Kinases and Assessment of Their in Vivo Roles by Targeted Expression in a Renal Transporting Epithelium J. Biol. Chem., September 17, 2004; 279(38): 40026 - 40034. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Fitzpatrick and M. B. Sokolowski In Search of Food: Exploring the Evolutionary Link Between cGMP-Dependent Protein Kinase (PKG) and Behaviour Integr. Comp. Biol., February 1, 2004; 44(1): 28 - 36. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||