spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garbuz, D.
Right arrow Articles by Zatsepina, O. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garbuz, D.
Right arrow Articles by Zatsepina, O. G.
The Journal of Experimental Biology 206, 2399-2408 (2003)
Copyright © 2003 The Company of Biologists Limited
doi: 10.1242/jeb.00429

Evolution of thermotolerance and the heat-shock response: evidence from inter/intraspecific comparison and interspecific hybridization in the virilis species group of Drosophila. I. Thermal phenotype

David Garbuz1, Michael B. Evgenev1,2, Martin E. Feder3,4,* and Olga G. Zatsepina1

1 Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Vavilov str. 32, 117984 Moscow, Russia
2 Institute of Cell Biophysics, Puschino, Russia
3 Department of Organismal Biology & Anatomy
4 The Committee on Evolutionary Biology, The University of Chicago, 1027 E. 57th Street, Chicago, IL 60637, USA

* Author for correspondence (e-mail: m-feder{at}uchicago.edu)

Accepted 3 April 2003


    Summary
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Species in the virilis group of Drosophila (fruit flies), which overlap or replace one another along climatic gradients, exhibit corresponding differences in basal thermotolerance, inducible thermotolerance and the heat-shock response. The low-latitude species D. virilis exceeds the high-latitude species D. lummei in these measures of thermotolerance, the temperature threshold for heat-shock factor (HSF) activation and the ability to express hsp70 mRNA and diverse heat-shock proteins (e.g. Hsp70, Hsp83 and small Hsps) after intense heat shock (e.g. 40–41°C). The xeric species D. novamexicana differs from the mesic species D. texana in much the same way for many of these traits. By contrast, intraspecific variation in these traits is small. Because D. virilis and D. lummei can readily be crossed to yield partially fertile progeny, genetic analysis of interspecific differences is possible. Interspecific hybrids are intermediate to the parental species in basal thermotolerance and inducible thermotolerance and resemble D. virilis in Hsp concentrations after intense heat shock and Hsp70 protein electromorphs.

Key words: Drosophila, evolutionary physiology, heat-shock protein, Hsp70, molecular chaperone, countergradient variation


    Introduction
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Investigations in evolutionary physiology normally fall into two separate realms. The first concerns the large differences in phenomes among species or higher taxa, whereas the second concerns the often lesser variation within species (Feder et al., 2000Go). These realms are ordinarily distinct because of reproductive isolation among species. Thus, because species and higher taxa usually cannot be interbred experimentally, investigation of their physiological differences often must proceed in the absence of experimental manipulative genetics. Genetic studies within species, however, often must forego the larger physiological variation that interspecific studies offer. Here, we report on variation in thermotolerance and the heat-shock response in a remarkable instance in which these two normally separate realms of investigation coalesce. The virilis group of Drosophila comprises 12 species living in greatly differing habitats but amenable to interbreeding in the laboratory (Patterson and Stone, 1952Go; Throckmorton, 1982Go). We have exploited these attributes to investigate the genetic basis of interspecific differences in physiology in combination with comparative inference.

The virilis group is divisible into two phylads: virilis and montana (Patterson and Stone, 1952Go). In the virilis phylad, two species, D. virilis and D. lummei, populate opposite ends of a climatic/geographic spectrum but overlap in its center. According to many investigators (Evgenev et al., 1982Go; Nurminsky et al., 1996Go; Patterson and Stone, 1952Go; Spicer, 1991Go, 1992Go; Throckmorton, 1982Go), D. virilis is the most primitive species of the virilis phylad and is probably ancestral to it if not to the entire virilis group. Its distribution, which extends across Eurasia, is primarily below 40° N latitude. D. lummei, considered the closest relative of D. virilis, occurs from just above 40° to just above 65° N latitude and from Sweden east to the Pacific coast of Asia. In the New World, D. novamexicana and D. texana are a similar but less widely distributed species pair from the virilis phylad. D. novamexicana occurs in hot, arid environments in New Mexico, Arizona, Colorado, Utah (Hsu, 1952Go) and elsewhere, whereas D. texana inhabits more mesic environments in central Texas.

If the microclimates that these species experience differ in the same ways as their climatic ranges, then data for many other species suggest that their thermal phenotypes (Feder, 1996Go) should differ correspondingly. Specifically, for organisms in general (Cossins and Bowler, 1987Go), and Drosophila in particular (David et al., 1983Go; Feder and Krebs, 1998Go; Hoffmann et al., 2003Go; Stratman and Markow, 1998Go), tolerance of high temperatures and its underlying mechanisms are correlated with the typical thermal environments of species (i.e. countergradient variation). From this prior work, we focus on several discrete aspects: basal thermotolerance (tolerance of acute exposure to hyperthermia in naive organisms or cells), inducible thermotolerance [the change in thermotolerance when mild hyperthermia (= pre-treatment; PT) precedes exposure to more-severe hyperthermia] and the heat-shock response. The heat-shock response comprises the PT-inducible expression of heat-shock proteins (Hsps), molecular chaperones and other proteins that contribute to inducible thermotolerance (Feder and Hofmann, 1999Go; Ulmasov et al., 1992Go; Zatsepina et al., 2001Go). The most important of these in other Drosophila species is Hsp70, a member of the DnaK-Hsp70 superfamily (Feder and Krebs, 1998Go; Zatsepina et al., 2001Go). Prior work on these aspects in the virilis group, however, is limited. D. virilis exceeds D. lummei in basal thermotolerance (Garbuz et al., 2002Go; Mitrofanov and Blanter, 1975Go), as expected. In the cold, D. lummei is far more tolerant than D. virilis, as expected, and also undergoes a diapause absent in all other D. virilis group species (Lumme, 1982Go). Heat-inducible loci have been localized cytogenetically in D. virilis (Evgenev et al., 1970; Peters et al., 1980Go). Although Sinibaldi and Storti (1982Go) reported that the two species do not differ in Hsps induced by heat shock, Garbuz et al. (2002Go) have recently shown that both the D. virilisD. lummei and D. novamexicanaD. texana species pairs differ in Hsp induction. In both cases, the former member of each pair synthesizes greater amounts of Hsps after heat shock. The present study extends the work of Garbuz et al. (2002Go) by comparing additional strains of D. virilis and D. lummei, focusing on more-intense heat shock and examining hsp mRNA expression and its regulation. Heat-inducible loci have been localized cytogenetically in D. virilis (Evgenev et al., 1978Go; Peters et al., 1980Go).

Ordinarily, understanding the evolution of such interspecific variation would be amenable only to comparative inference and inaccessible to genetic experimentation. In the 1970s, however, Evgenev and colleagues were able to cross D. lummei with a D. virilis strain (160) bearing recessive markers on all autosomes and subsequently developed strains in which a single lummei chromosome or portion thereof was integrated into a uniform D. virilis background (Evgenev and Sidorova, 1976Go). In the present study, we combine comparative inference and interspecific genetics to elucidate the molecular basis for interspecific variation in thermotolerance. We demonstrate (1) replicated countergradient variation of basal thermotolerance in two geographically distinct sets of virilis phylad species; (2) countergradient variation in inducible thermotolerance and the heat-shock response in D. virilis and D. lummei; and (3) the applicability of interspecific genetics to inducible thermotolerance (and prospectively other aspects of the thermal phenotype) in the virilis species group of Drosophila.


    Materials and methods
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Drosophila strains and maintenance
We compared laboratory strains of four species from the virilis phylad and one reference strain of Drosophila melanogaster (Table 1). All strains were maintained at 25°C on a yeast, molasses and agar medium for many generations before analysis. Hybrids of D. virilis strain 9 and D. lummei strain 200 were created by mass mating of heterospecific parents of the opposite sex.


View this table:
[in this window]
[in a new window]
 
Table 1. Drosophila strains examined in the present study

 



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 1. Inter- and intraspecific variation of basal thermotolerance in D. virilis group species. Strain 160, although D. virilis, is a marker strain with at least one known recessive mutation on each chromosome; all other strains are wild-type. See Table 1 for additional descriptions of all strains. Data for D. lummei strain 200 and D. virilis strains 9, 160 and 1433 are replotted from Garbuz et al. (2002Go), in which D. virilis strain 1433 is mistakenly labeled strain 1590.

 
Thermotolerance
These procedures were identical to those of Garbuz et al. (2002Go). Eclosing individuals were sequestered daily and, when 4 days old, were transferred by aspiration to a preheated polypropylene vial (Nalge Nunc International, Rochester, NY, USA), which was immersed in a thermostatted water bath for 30 min. Each vial usually contained 35–50 animals but occasionally as few as 20. To determine basal thermotolerance, vials were placed at one of a series of heat-shock temperatures ranging from 38.5°C to 43°C. To determine inducible thermotolerance, similar determinations ensued after flies first underwent pre-treatment at one of a series of temperatures from 35°C to 38°C for 30 min and 25°C for 1 h or 3 h. Tolerance was assessed as the proportion of flies in a vial that could walk 48 h after heat shock.

Protein labeling, gel electrophoresis and immunoblotting
These procedures were identical to those of Garbuz et al. (2002Go). 10 salivary glands from third-instar larvae were labeled in 20 µl of Schneider's insect medium without methionine (Sigma, St Louis, MO, USA) after the addition of 1 µl (1.85 MBq) of [35S]L-methionine (Amersham Biosciences Corp., Piscataway, NJ, USA) for 1 h at 25°C after various treatments. Two-dimensional gel electrophoresis and other procedures applied were as described (O'Farrell et al., 1977Go; Ulmasov et al., 1992Go). The position of major Hsps and actin was determined by both autoradiography and subsequent staining of gels with silver (Creighton, 1990Go).

For immunoblotting, after sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) of larval lysate prepared as above, the proteins were transferred to nitrocellulose membrane (Hybond ECL; Amersham) according to the manufacturer's protocol and reacted with monoclonal antibodies specific to the entire Drosophila Hsp70 family (7.10.3) and only Hsp70 (7FB) as previously described (Zatsepina et al., 2001Go). Immune complexes were detected via chemiluminescence (ECL kit; Amersham) and diaminobenzidine (DAB) (Sigma) with appropriate peroxidase-conjugated anti-rat secondary antibodies.

Preparation of RNA and northern hybridization
RNA was prepared by the standard method with 4 mol l-1 guanidine isothiocyanate (Chomczynski and Sacchi, 1987Go), separated by agarose gel electrophoresis and transferred to a membrane for hybridization (Sambrook and Fritsch, 1989Go) with a ClaI–BamHI fragment containing the Drosophila melanogaster hsp70 gene cloned into the BamHI site of pUC13 (McGarry and Lindquist, 1985Go). Hybridization was overnight at 42°C in 50% formamide, followed by two 20 min washes in 2xSSC, 0.2% SDS at 42°C, two 20 min washes in 1xSSC, 0.2% SDS at 42°C, and one 20 min wash in 0.2xSSC, 0.2% SDS at 68°C.

Gel mobility-shift assay
Flies were frozen and pulverized in liquid nitrogen, and the powder was suspended (1:5) in a buffer containing 20 mmol l-1 Hepes, pH 7.9, 25% (v/v) glycerol, 0.42 mol l-1 NaCl, 1.5 mmol l-1 MgCl2, 0.2 mmol l-1 EDTA, 0.5 mmol l-1 phenylmethylsulfonyl fluoride (PMSF) and 0.5 mmol l-1 dithiothreitol, which was centrifuged at 100 000 g for 20 min. The supernatants were frozen in liquid nitrogen and stored at -70°C. The protein concentration of the extracts was estimated with a modified Lowry method (Ulmasov et al., 1992Go).

Consensus HSE probe (Wu et al., 1988Go) was prepared by annealing partially complementary oligonucleotides (ATCCGAGCGCGCCTCGAATGTTCTAGAA and CTCGCGCGGAGCTTACAAGATCTTTTCCA) in 10 mmol l-1 potassium phosphate buffer, pH 8.2, in the presence of 0.1 mmol l-1 NaCl. Single-stranded termini were filled with Klenow polymerase and [32P]ATP (Sambrook and Fritsch, 1989Go). For the gel mobility-shift assay, extracts containing 50 µg of protein were mixed with 0.5 ng of [32P] heat shock element (HSE) in binding buffer as described (Mosser et al., 1993Go). Binding-reaction mixture was incubated at room temperature (20°C) for 20 min. Free probe was separated from HSE–HSF complexes by electrophoresis in 5% polyacrylamide gels (Mosser et al., 1993Go). The gels were dried and exposed to X-ray film (Kodak X-Omat) at -70°C.


    Results
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Thermotolerance
The basal thermotolerance of adult flies of all D. virilis strains used in the study exceeded that for its sister species D. lummei (Fig. 1; Table 1). The LT50s for a 30-min heat shock are generally 1.3°C greater for D. virilis strains than for D. lummei and are inversely related to their latitude of origin. Similarly, basal thermotolerance for D. novamexicana exceeded that for its related species D. texana. Although both are from similar latitudes, D. novamexicana is from a more arid and warmer climate than D. texana (Table 1).

Within D. virilis and D. lummei, we failed to detect differences as large as those among species. This minor intraspecific variation in basal thermotolerance, moreover, was not inversely correlated with latitude. With the exception of strain 160, the LT50 for D. virilis strains ranging from 32° to 53° N were within 0.2°C of one another and, with the exception of strain 1102, the LT50 for D. lummei strains ranging from 45° to 60° N were within 0.1°C of one another. Strain 160 is a marker strain with at least one known recessive mutation on each autosome (broken bk in ch. II; gapped gp in ch. III; cardinal cd in ch. IV; peach pe in ch.V; and glossy gl in ch. VI); all other strains are wild-type.

Reciprocal hybrids of D. virilis and D. lummei had basal thermotolerances intermediate to those of the two parental species (Fig. 2A). The direction of the cross did not affect basal thermotolerance appreciably.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 2. Effect of species, parental genotype and pre-treatment (PT) on (A) basal and (B) inducible thermotolerance. Data for D. lummei strain 200 and D. virilis strain 9 are replotted from Garbuz et al. (2002Go). In B, two-headed arrows represent the change in thermotolerance from basal levels (broken lines) to tolerance after PT (solid lines). In pretreated D. virilis strain 9 (solid red), PT was 30 min at 35°C, 36°C or 37°C. In pretreated D. lummei strain 200 (solid blue), PT was 30 min at 35°C (as shown), 36°C (not shown) or 37°C (not shown). No D. lummei pre-treated at 36°C or 37°C survived the ensuing heat shock. The inset indicates color coding for reciprocal hybrids of D. lummei strain 200 and D. virilis strain 9 and the species identity of female (F) and male (M) parent. Broken and solid lines indicate thermotolerance with and without pretreatment, respectively, after 35°C PT for 30 min. Hybrids also underwent PT at 36°C for 30 min with heat shock either following immediately (triangles) or 3 h later (squares); these symbols signify the LT50s.

 

In D. virilis strain 9, pre-treatment improved thermotolerance (Fig. 2B), and the change in thermotolerance (i.e. LT50 after PT minus LT50 without PT) was correlated with the PT temperature. The impact of PT on thermotolerance in D. virilis strain 160 was nearly identical to that in strain 9, although the absolute values of LT50s differed in these two strains (Fig. 1; data after PT not shown for strain 9). By contrast, pre-treatment reduced thermotolerance in D. lummei, and the change in thermotolerance was inversely correlated with the PT temperature (Fig. 2B). PT at 36°C and 37°C reduced survival of 40–40.5°C heat shock to 0%.

A D. virilis parent, regardless of sex, was sufficient for positive inducible thermotolerance in D. virilisD. lummei hybrids (Fig. 2B). Although results differed slightly according to the direction of the cross, PT temperature and the interval between PT and heat shock, PT increased the LT50 of D. virilisD. lummei hybrids by 0.25–0.5°C, to where it was slightly less than the basal thermotolerance of pure D. virilis. Although this PT was modest, it clearly differs from the decreased thermotolerance after PT in D. lummei. In the hybrids, the effect of increasing PT temperature was intermediate to that in the parental species; it neither increased nor decreased inducible thermotolerance.

Protein synthesis and levels
As Garbuz et al. (2002Go; figs 5, 6) have previously reported, under normal physiological conditions (25°C), D. virilis strain 9 and D. lummei strains 200 and 1102 did not differ in total protein synthesis, as indicated by [35S]L-methionine incorporation. At 1 h after mild heat shock (37.5°C), these D. lummei strains synthesized no less protein than did D. virilis strain 9. By contrast, at 1 h after more-intense heat shock (40°C), these D. lummei strains clearly synthesized less protein than did D. virilis strain 9. These differences are manifest in all major classes of heat-shock proteins that are typically distinguishable in one-dimensional electrophoresis of synthesized proteins. Additional determinations of protein synthesis via [35S]L-methionine incorporation (Figs 3, 4) corroborate and extend these conclusions. First, as inclusion of two additional D. virilis strains (160 and 1433) demonstrates, these are true interspecific differences rather than a feature unique to D. virilis strain 9. Second, these interspecific differences are even greater after more-intense heat shock (40.5°C and 41°C), although both species are capable of some protein synthesis at all temperatures studied. After these intense heat shocks, Hsp40 and small Hsps are especially reduced in D. lummei relative to D. virilis. Third, interspecific hybrids (D. lummei strain 200 x D. virilis strain 9) exhibit the D. virilis pattern of protein synthesis. The same is true of the reciprocal cross (data not shown). Finally, the species pair D. novamexicana and D. texana, which correspond in thermotolerance to D. virilis and D. lummei, respectively, exhibit parallel differences in protein synthesis (Fig. 4). Interestingly, D. virilis strain 160, which both has numerous mutations and is the most thermosensitive of the D. virilis strains (see above), is not obviously defective in terms of protein synthesis after heat shock. Also, both D. lummei and D. virilis exhibit expression of a high-molecular-mass heat-shock protein under some conditions (Fig. 3).



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 5. Variation in Hsp70 concentration in salivary glands due to species, strain and heat-shock conditions. All determinations are for equivalent amounts of total protein extracted 3 h after a 30-min heat shock and are from immunoblots with 7FB, an antibody recognizing only the 70-kDa inducible Hsp70 family member in D. melanogaster (see Materials and methods). (A) Effect of heat-shock temperature on Hsp70 levels in D. virilis strains (solid lines) and D. lummei strains (broken lines). Symbols represent the mean densitometric signal ± 1 S.E.M. from at least five independent immunoblots. All data are normalized to the densitometric signal for equivalent amounts of protein extracted from D. melanogaster salivary glands 1 h after a 30-min heat shock at 37.5°C. (B) Effect of heat-shock temperature on Hsp70 levels in D. novamexicana (solid line) and D. texana (broken line). Data are standardized and plotted as for A. (C) 7FB-immunoblots of Hsp70 for various species and strains. Each pair of lanes corresponds to 40°C and 41°C heat shock. See fig. 2 in Garbuz et al. (2002Go) for additional determinations of Hsp70 levels.

 


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 6. Immunoblots of Hsp70 and Hsp70 family members in D. virilis strain 9, D. lummei strain 200 and their hybrid. In Fig. 4, the box in the Hsp70 region for D. lummei strain 1109 represents the region of the present figure. Data for the parental strains are repeated from Garbuz et al. (2002Go) and are included to facilitate comparison with data for hybrids. Primary antibody 7FB recognizes only the 70-kDa inducible Hsp70 family member in D. melanogaster; primary antibody 7.10.3 recognizes all Hsp70 family members (see Materials and methods). Heat shock was 38°C for 30 min, with 3 h recovery at 25°C before lysis. In the right-hand column, blue represents constitutively present proteins recognized by 7.10.3 only, red represents inducible (i.e. undetectable in glands not undergoing heat shock) proteins recognized by both 7.10.3 and 7FB, and green represents inducible proteins recognized by 7.10.3 only.

 


View larger version (84K):
[in this window]
[in a new window]
 
Fig. 3. One-dimensional electrophoretic separation of 35S-labeled proteins after 30-min heat shock. vir refers to D. virilis, and lum refers to D. lummei; numbers represent strains. Size markers refer to expected molecular masses of Drosophila heat-shock proteins.

 


View larger version (66K):
[in this window]
[in a new window]
 
Fig. 4. Two-dimensional electrophoretic separation of 35S-labeled proteins after 30-min heat shock at 40.5°C and 3 h of recovery at 25°C. Species and strains are noted. Labels refer to molecular masses of Drosophila heat-shock proteins; 70c represents constitutively expressed Hsp70 family members. The box in the Hsp70 region for D. lummei strain 1109 represents the region detailed in Fig. 6. See Garbuz et al. (2002Go) for additional results after less-severe heat shock.

 

According to both Garbuz et al. (2002Go) and the present study (Figs 3, 4), Hsp70 is quantitatively the major heat-shock protein in the species and strains examined. To examine the conclusions of the previous paragraph in detail for this specific Hsp, we have replotted the data from Fig. 2A of Garbuz et al. (2002Go) and included data for additional strains and conditions (Fig. 5). Indeed, Hsp70 levels for D. lummei strains are within the range for the various D. virilis strains 3 h after a 37.5°C heat shock. After more-severe heat shock, Hsp70 levels in the D. lummei strains are below the range for D. virilis strains, corresponding to their differing thermotolerances (Figs 1, 2). Data for the more-thermotolerant D. novamexicana and less-thermotolerant D. texana recapitulate this pattern (Fig. 5B). Immunoblots of Hsp70 levels (Fig. 5C) clearly emphasize the differing Hsp70 levels in these species after intense heat shock. Detailed examination of the Hsp70 family reveals that the differences between Hsp70s of D. virilis and D. lummei are qualitative as well as quantitative (Fig. 6; see also Garbuz et al., 2002Go). D. virilis exhibits three isoforms recognizable by antibody 7FB, which in D. melanogaster reacts only with Hsp70; D. lummei exhibits only two of these three isoforms. D. virilis also exhibits two inducible isoforms not recognized by 7FB but recognizable by antibody 7.10.3, which reacts with all Hsp70 family members in most species examined; D. lummei exhibits only one of these two isoforms. Interspecific hybrids (D. lummei strain 200 x D. virilis strain 9) exhibit the D. virilis pattern (Fig. 6), as does the reciprocal cross (data not shown).

Transcriptional regulation
The thermal sensitivity of hsp70 mRNA transcription in general resembled that for Hsp70 protein. Thus, D. lummei synthesized no detectable hsp70 mRNA during heat shock at 40–41°C, whereas D. virilis strain 9 did so in abundance (Fig. 7). These results for D. virilis strain 9 exemplify those obtained for other D. virilis strains. Despite its low thermotolerance (Fig. 1) and unexceptional Hsp70 protein levels (Fig. 3), D. virilis strain 160 typically synthesized more hsp70 mRNA than did other D. virilis strains (Fig. 7; and other data not shown).



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 7. Effect of species, strain and thermal regime on hsp70 (above) and actin (below) mRNA levels.

 

As indicated by electrophoretic mobility-shift assays (Fig. 8), D. virilis underwent HSF trimerization at temperatures of >32°C, whereas D. lummei exhibited activation at temperatures of >31°C. This difference, although small, is again consistent with the environmental regimes of these species.



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 8. Electrophoretic mobility-shift assay for HSF (heat-shock factor) activation at various temperatures in D. virilis strain 9 and D. lummei strain 200. Appearance of a high-molecular-mass HSF complex indicates HSF activation.

 


    Discussion
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Many aspects of the thermal phenotypes of the species under study exhibit countergradient variation similar to that in other taxa (Feder and Hofmann, 1999Go; Ulmasov et al., 1992Go; Zatsepina et al., 2001Go); i.e. the magnitude and threshold for traits correspond to the thermal environments in which the species occur. Thus, the lower-latitude species D. virilis exceeds the higher-latitude species D. lummei in basal thermotolerance (see also Garbuz et al., 2002Go), inducible thermotolerance and temperature threshold for HSF activation. Similarly, the more xeric D. novamexicana exceeds the more mesic D. texana in the former two traits. As also shown previously for protein (Garbuz et al., 2002Go), D. virilis and D. lummei express similar amounts of heat-shock mRNA and protein at low to moderate heat-shock temperatures. Intense heat shock (e.g. 40–41°C) almost abolishes heat-shock mRNA and protein expression in D. lummei, whereas considerable expression persists after such heat shock in D. virilis. For example, Hsp70 concentration is similar in D. virilis and D. lummei after 37.5°C heat shock but is markedly greater in D. virilis than in D. lummei after more-intense heat shocks (Fig. 5A); a similar pattern is evident for D. novamexicana and D. texana (Fig. 5B). In D. lummei, moreover, the reduction in protein level after severe heat shock is even greater for the small Hsps and Hsp40 than for Hsp70 (Figs 3, 4).

Within D. virilis and D. lummei, by contrast, little such countergradient variation is evident. We speculate that extensive gene flow among populations swamps incipient adaptation to local conditions, a situation that may not be universal in Drosophila species (Michalak et al., 2001Go). As in D. melanogaster (Krebs et al., 2001Go), adaptation to laboratory conditions does not seem to contribute to this intraspecific similarity, as the two strains from Tashkent, Uzbekistan (T53 and T61) exhibit virtually identical patterns of thermotolerance and Hsp induction despite the fact that T61 was captured recently and the T53 more than 30 years ago. The only conspicuous departure from this pattern is for D. virilis strain 160, a marker strain with at least one known recessive mutation on each autosome. The basal thermotolerance for this strain is considerably lower than for all other D. virilis strains studied, suggesting that the mutations it bears interfere with this form of thermotolerance. Its expression of heat-shock proteins, which underlies inducible rather than basal thermotolerance, is as in other D. virilis strains, however.

The absence of inducible thermotolerance in the high-latitude species D. lummei is indeed distinctive. We know of no other Drosophila species that shares this absence. Remarkably, this species expresses a full complement of heat-shock proteins after heat pre-treatment (although in lesser magnitude than in D. virilis), suggesting that these proteins are not sufficient for inducible thermotolerance and that some unknown component is deficient.

An unusual feature of the virilis species group is its capacity for interspecific introgression of genetic material in the laboratory. Here, we demonstrate corresponding patterns in basal and inducible thermotolerance (Fig. 2), overall protein synthesis after heat shock (Figs 3, 4) and Hsp70 electromorphs (Fig. 6). For thermotolerance, the pattern for hybrids is intermediate to that for the two parental species and independent of the direction of the cross. For quantitative and qualitative variation in Hsp expression, the D. virilis pattern behaves as a dominant trait. For example, D. virilis exhibits three Hsp70-family protein isoforms recognizable by both antibody 7.10.3 and 7FB, D. lummei exhibits only two isoforms, and hybrids exhibit three isoforms (Fig. 6). Similarly, D. virilis exhibits two inducible Hsp70-family protein isoforms recognizable by antibody 7.10.3, D. lummei exhibits only one isoform, and hybrids exhibit two isoforms (Fig. 6). The Drosophila virilis group has great potential to elucidate the genetic basis for interspecific differences in thermal phenotype for two reasons. First, the group is far more diverse than the four species examined here; in essence, an independent but related phylad (the montana phylad) replicates the patterns of latitudinal and geographic replacement seen in the virilis phylad. Species within each phylad can be crossed with one another to produce partially fertile progeny; moreover, some species belonging to different phylads can also be crossed (Evgenev et al., 1982Go; Patterson and Stone, 1952Go). Second, markers present on each chromosome make possible the introgression of a single chromosome or even a portion of a chromosome bearing, for example, the hsp70 gene cluster, whose location is known (Evgenev et al., 1978Go). This potential is an unexploited and exciting opportunity for evolutionary physiology.

Finally, Garbuz et al. (2002Go) interpreted restriction fragment length polymorphism for hsp70 genes to suggest that the D. virilisD. lummei and D. novamexicanaD. texana species pairs exhibit corresponding differences in hsp70 gene family copy number. Although less likely than differences in copy number, these data are also consistent with nucleotide polymorphisms in restriction sites and a constant number of gene copies. Part II of this series of research papers will show that the D. virilis–D. lummei species pair indeed differ in gene copy number, with the high-latitude D. lummei having lost some hsp70 genes present in the low-latitude D. virilis. Thus, the mRNA, protein and thermotolerance differences reported in the present manuscript have at least part of their basis in the copy number of their encoding genes.

In Moscow, the research was supported by Russian Grants for Basic Science 0004-48-285 and 0004-32-243. In Chicago, research was supported by an International Supplement to NSF grant IBN99-86158. We thank A. Helin and D. Lerman for technical assistance.


    References
 TOP
 Summary
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

Chomczynski, P. and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162,156 -159.[Medline]

Cossins, A. R. and Bowler, K. (1987). Temperature Biology of Animals. London: Chapman and Hall.

Creighton, T. E. (1990). Protein Structure: A Practical Approach. Oxford, England, New York: IRL Press.

David, J. R., Allemand, R., Van Herrewege, J. and Cohet, Y. (1983). Ecophysiology: abiotic factors. In The Genetics and Biology of Drosophila, vol.3d (ed. M. Ashburner, H. L. Carson and J. N. Thompson), pp. 105-170. London: Academic Press.

Evgenev, M. B., Kolchinski, A., Levin, A., Preobrazhenskaya, A. L. and Sarkisova, E. (1978). Heat-shock DNA homology in distantly related species of Drosophila. Chromosoma 68,357 -365.[CrossRef]

Evgenev, M. B. and Sidorova, N. V. (1976). Genetic regulation of chromosome behavior in interspecific hybrids of Drosophila. Theor. Appl. Genet. 48, 55-61.[CrossRef]

Evgenev, M. B., Yenikolopov, G. N., Peunova, N. I. and Ilyin, Y. V. (1982). Transposition of mobile genetic elements in interspecific hybrids of Drosophila. Chromosoma 85,375 -386.[CrossRef][Medline]

Feder, M. E. (1996). Ecological and evolutionary physiology of stress proteins and the stress response: the Drosophila melanogaster model. In Animals and Temperature: Phenotypic and Evolutionary Adaptation (ed. I. A. Johnston and A. F. Bennett), pp. 79-102. Cambridge: Cambridge University Press.

Feder, M. E., Bennett, A. F. and Huey, R. B. (2000). Evolutionary physiology. Annu. Rev. Ecol. Syst. 31,315 -341.[CrossRef]

Feder, M. E. and Hofmann, G. E. (1999). Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61,243 -282.[CrossRef][Medline]

Feder, M. E. and Krebs, R. A. (1998). Natural and genetic engineering of thermotolerance in Drosophila melanogaster. Am. Zool. 38,503 -517.

Garbuz, D. G., Molodtsov, V. B., Velikodvorskaia, V. V., Evgenev, M. B. and Zatsepina, O. G. (2002). Evolution of the response to heat shock in genus Drosophila. Russian J. Genet. 38,925 -936.[CrossRef]

Hoffmann, A. A., Sørensen, J. G. and Loeschcke, V. (2003). Adaptation of Drosophila to temperature extremes: bringing together quantitative and molecular approaches. J. Therm. Biol. 28,175 -216.[CrossRef]

Hsu, T. C. (1952). Chromosomal variation and evolution in the virilis group of Drosophila. Univ. Texas Publ. 5204,35 -72.

Krebs, R. A., Roberts, S. P., Bettencourt, B. R. and Feder, M. E. (2001). Changes in thermotolerance and Hsp70 expression with domestication in Drosophila melanogaster. J. Evol. Biol. 14,75 -82.

Lumme, J. (1982). The genetic basis of the photoperiodic timing of the onset of winter dormancy in Drosophila littoralis. Acta Univ. Ouluensis 129, 1-42.

McGarry, T. J. and Lindquist, S. (1985). The preferential translation of Drosophila hsp70 mRNA requires sequences in the untranslated leader. Cell 42,903 -911.[CrossRef][Medline]

Michalak, P., Minkov, I., Helin, A., Lerman, D. N., Bettencourt, B. R., Feder, M. E., Korol, A. B. and Nevo, E. (2001). Genetic evidence for adaptation-driven incipient speciation of Drosophila melanogaster along a microclimatic contrast in "Evolution Canyon", Israel. Proc. Natl. Acad. Sci. USA 98,13195 -13200.[Abstract/Free Full Text]

Mitrofanov, V. G. and Blanter, T. V. (1975). A study of temperature-sensitive mutations in the virilis group of Drosophila. Ontogenesis 6, 386-391.

Mosser, D. D., Duchaine, J. and Massie, B. (1993). Saccharomyces cerevisiae HSP70 heat shock elements are functionally distinct. Mol. Cell. Biol. 13,5637 -5646.[Abstract/Free Full Text]

Nurminsky, D. I., Moriyama, E. N., Lozovskaya, E. R. and Hartl, D. L. (1996). Molecular phylogeny and genome evolution in the Drosophila virilis species group: duplications of the alcohol dehydrogenase gene. Mol. Biol. Evol. 13,132 -149.[Abstract]

O'Farrell, P. Z., Goodman, H. M. and O'Farrell, P. H. (1977). High resolution two-dimensional electrophoresis of basic as well as acidic proteins. Cell 12,1133 -1142.[CrossRef][Medline]

Patterson, J. T. and Stone, W. S. (1952). Evolution In The Genus Drosophila. New York: Macmillan.

Peters, F. P., Lubsen, N. H. and Sondermeijer, P. J. (1980). Rapid sequence divergence in a heat shock locus of Drosophila. Chromosoma 81,271 -280.[CrossRef][Medline]

Sambrook, J. and Fritsch, E. F. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.

Sinibaldi, R. M. and Storti, R. V. (1982). One- and two-dimensional polyacrylamide gel analysis of the heat shock proteins of the virilis group of Drosophila. Biochem. Genet. 20,791 -807.[CrossRef][Medline]

Spicer, G. S. (1991). Molecular evolution and phylogeny of the Drosophila virilis species group as inferred by 2-dimensional electrophoresis. J. Mol. Evol. 33,379 -394.[CrossRef][Medline]

Spicer, G. S. (1992). Reevaluation of the phylogeny of the Drosophila virilis species group (Diptera, Drosophilidae). Ann. Entomol. Soc. Am. 85, 11-25.

Stratman, R. and Markow, T. A. (1998). Resistance to thermal stress in desert Drosophila. Funct. Ecol. 12,965 -970.[CrossRef]

Throckmorton, L. H. (1982). The virilis species group. In The Genetics and Biology of Drosophila, vol. 3b (ed. M. Ashburner, H. L. Carson and J. N. Thompson), pp. 227-296. London: Academic Press.

Ulmasov, K. A., Shammakov, S., Karaev, K. and Evgenev, M. B. (1992). Heat shock proteins and thermoresistance in lizards. Proc. Natl. Acad. Sci. USA 89,1666 -1670.[Abstract/Free Full Text]

Wu, C., Tsai, C. and Wilson, S. (1988). Affinity chromatography of sequence-specific DNA-binding proteins. In Genetic Engineering, vol. 10 (ed. J. K. Setlow), pp. 67-74. New York: Plenum Publishing Corporation.

Zatsepina, O. G., Velikodvorskaia, V. V., Molodtsov, V. B., Garbuz, D., Lerman, D. N., Bettencourt, B. R., Feder, M. E. and Evgenev, M. B. (2001). A Drosophila melanogaster strain from sub-equatorial Africa has exceptional thermotolerance but decreased Hsp70 expression. J. Exp. Biol. 204,1869 -1881.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
GeneticsHome page
M. T. Levine and D. J. Begun
Evidence of Spatially Varying Selection Acting on Four Chromatin-Remodeling Loci in Drosophila melanogaster
Genetics, May 1, 2008; 179(1): 475 - 485.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
V. Y. Shilova, D. G. Garbuz, E. N. Myasyankina, B. Chen, M. B. Evgen'ev, M. E. Feder, and O. G. Zatsepina
Remarkable Site Specificity of Local Transposition Into the Hsp70 Promoter of Drosophila melanogaster
Genetics, June 1, 2006; 173(2): 809 - 820.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
L. Tomanek
Two-dimensional gel analysis of the heat-shock response in marine snails (genus Tegula): interspecific variation in protein expression and acclimation ability
J. Exp. Biol., August 15, 2005; 208(16): 3133 - 3143.
[Abstract] [Full Text] [PDF]


Home page
MutagenesisHome page
A. Lupu, A. Pechkovskaya, E. Rashkovetsky, E. Nevo, and A. Korol
DNA repair efficiency and thermotolerance in Drosophila melanogaster from 'Evolution Canyon'
Mutagenesis, September 1, 2004; 19(5): 383 - 390.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garbuz, D.
Right arrow Articles by Zatsepina, O. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garbuz, D.
Right arrow Articles by Zatsepina, O. G.