|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
Evolution of thermotolerance and the heat-shock response: evidence from inter/intraspecific comparison and interspecific hybridization in the virilis species group of Drosophila. I. Thermal phenotype
1 Engelhardt Institute of Molecular Biology, Russian Academy of Sciences,
Vavilov str. 32, 117984 Moscow, Russia
2 Institute of Cell Biophysics, Puschino, Russia
3 Department of Organismal Biology & Anatomy
4 The Committee on Evolutionary Biology, The University of Chicago, 1027 E.
57th Street, Chicago, IL 60637, USA
* Author for correspondence (e-mail: m-feder{at}uchicago.edu)
Accepted 3 April 2003
| Summary |
|---|
|
|
|---|
Key words: Drosophila, evolutionary physiology, heat-shock protein, Hsp70, molecular chaperone, countergradient variation
| Introduction |
|---|
|
|
|---|
The virilis group is divisible into two phylads: virilis
and montana (Patterson and Stone,
1952
). In the virilis phylad, two species, D.
virilis and D. lummei, populate opposite ends of a
climatic/geographic spectrum but overlap in its center. According to many
investigators (Evgenev et al.,
1982
; Nurminsky et al.,
1996
; Patterson and Stone,
1952
; Spicer,
1991
,
1992
;
Throckmorton, 1982
), D.
virilis is the most primitive species of the virilis phylad and
is probably ancestral to it if not to the entire virilis group. Its
distribution, which extends across Eurasia, is primarily below 40° N
latitude. D. lummei, considered the closest relative of D.
virilis, occurs from just above 40° to just above 65° N latitude
and from Sweden east to the Pacific coast of Asia. In the New World, D.
novamexicana and D. texana are a similar but less widely
distributed species pair from the virilis phylad. D.
novamexicana occurs in hot, arid environments in New Mexico, Arizona,
Colorado, Utah (Hsu, 1952
) and
elsewhere, whereas D. texana inhabits more mesic environments in
central Texas.
If the microclimates that these species experience differ in the same ways
as their climatic ranges, then data for many other species suggest that their
thermal phenotypes (Feder,
1996
) should differ correspondingly. Specifically, for organisms
in general (Cossins and Bowler,
1987
), and Drosophila in particular
(David et al., 1983
;
Feder and Krebs, 1998
;
Hoffmann et al., 2003
;
Stratman and Markow, 1998
),
tolerance of high temperatures and its underlying mechanisms are correlated
with the typical thermal environments of species (i.e. countergradient
variation). From this prior work, we focus on several discrete aspects: basal
thermotolerance (tolerance of acute exposure to hyperthermia in naive
organisms or cells), inducible thermotolerance [the change in thermotolerance
when mild hyperthermia (= pre-treatment; PT) precedes exposure to more-severe
hyperthermia] and the heat-shock response. The heat-shock response comprises
the PT-inducible expression of heat-shock proteins (Hsps), molecular
chaperones and other proteins that contribute to inducible thermotolerance
(Feder and Hofmann, 1999
;
Ulmasov et al., 1992
;
Zatsepina et al., 2001
). The
most important of these in other Drosophila species is Hsp70, a
member of the DnaK-Hsp70 superfamily
(Feder and Krebs, 1998
;
Zatsepina et al., 2001
). Prior
work on these aspects in the virilis group, however, is limited.
D. virilis exceeds D. lummei in basal thermotolerance
(Garbuz et al., 2002
;
Mitrofanov and Blanter, 1975
),
as expected. In the cold, D. lummei is far more tolerant than D.
virilis, as expected, and also undergoes a diapause absent in all other
D. virilis group species (Lumme,
1982
). Heat-inducible loci have been localized cytogenetically in
D. virilis (Evgenev et al., 1970;
Peters et al., 1980
). Although
Sinibaldi and Storti (1982
)
reported that the two species do not differ in Hsps induced by heat shock,
Garbuz et al. (2002
) have
recently shown that both the D. virilisD. lummei and
D. novamexicanaD. texana species pairs differ in Hsp
induction. In both cases, the former member of each pair synthesizes greater
amounts of Hsps after heat shock. The present study extends the work of Garbuz
et al. (2002
) by comparing
additional strains of D. virilis and D. lummei, focusing on
more-intense heat shock and examining hsp mRNA expression and its
regulation. Heat-inducible loci have been localized cytogenetically in D.
virilis (Evgenev et al.,
1978
; Peters et al.,
1980
).
Ordinarily, understanding the evolution of such interspecific variation
would be amenable only to comparative inference and inaccessible to genetic
experimentation. In the 1970s, however, Evgenev and colleagues were able to
cross D. lummei with a D. virilis strain (160) bearing
recessive markers on all autosomes and subsequently developed strains in which
a single lummei chromosome or portion thereof was integrated into a
uniform D. virilis background
(Evgenev and Sidorova, 1976
).
In the present study, we combine comparative inference and interspecific
genetics to elucidate the molecular basis for interspecific variation in
thermotolerance. We demonstrate (1) replicated countergradient variation of
basal thermotolerance in two geographically distinct sets of virilis
phylad species; (2) countergradient variation in inducible thermotolerance and
the heat-shock response in D. virilis and D. lummei; and (3)
the applicability of interspecific genetics to inducible thermotolerance (and
prospectively other aspects of the thermal phenotype) in the virilis
species group of Drosophila.
| Materials and methods |
|---|
|
|
|---|
|
|
Protein labeling, gel electrophoresis and immunoblotting
These procedures were identical to those of Garbuz et al.
(2002
). 10 salivary glands
from third-instar larvae were labeled in 20 µl of Schneider's insect medium
without methionine (Sigma, St Louis, MO, USA) after the addition of 1 µl
(1.85 MBq) of [35S]L-methionine (Amersham Biosciences
Corp., Piscataway, NJ, USA) for 1 h at 25°C after various treatments.
Two-dimensional gel electrophoresis and other procedures applied were as
described (O'Farrell et al.,
1977
; Ulmasov et al.,
1992
). The position of major Hsps and actin was determined by both
autoradiography and subsequent staining of gels with silver
(Creighton, 1990
).
For immunoblotting, after sodium dodecyl sulfatepolyacrylamide gel
electrophoresis (SDSPAGE) of larval lysate prepared as above, the
proteins were transferred to nitrocellulose membrane (Hybond ECL; Amersham)
according to the manufacturer's protocol and reacted with monoclonal
antibodies specific to the entire Drosophila Hsp70 family (7.10.3)
and only Hsp70 (7FB) as previously described
(Zatsepina et al., 2001
).
Immune complexes were detected via chemiluminescence (ECL kit;
Amersham) and diaminobenzidine (DAB) (Sigma) with appropriate
peroxidase-conjugated anti-rat secondary antibodies.
Preparation of RNA and northern hybridization
RNA was prepared by the standard method with 4 mol l-1 guanidine
isothiocyanate (Chomczynski and Sacchi,
1987
), separated by agarose gel electrophoresis and transferred to
a membrane for hybridization (Sambrook and
Fritsch, 1989
) with a ClaIBamHI fragment
containing the Drosophila melanogaster hsp70 gene cloned into the
BamHI site of pUC13 (McGarry and
Lindquist, 1985
). Hybridization was overnight at 42°C in 50%
formamide, followed by two 20 min washes in 2xSSC, 0.2% SDS at 42°C,
two 20 min washes in 1xSSC, 0.2% SDS at 42°C, and one 20 min wash in
0.2xSSC, 0.2% SDS at 68°C.
Gel mobility-shift assay
Flies were frozen and pulverized in liquid nitrogen, and the powder was
suspended (1:5) in a buffer containing 20 mmol l-1 Hepes, pH 7.9,
25% (v/v) glycerol, 0.42 mol l-1 NaCl, 1.5 mmol l-1
MgCl2, 0.2 mmol l-1 EDTA, 0.5 mmol l-1
phenylmethylsulfonyl fluoride (PMSF) and 0.5 mmol l-1
dithiothreitol, which was centrifuged at 100 000 g for 20 min.
The supernatants were frozen in liquid nitrogen and stored at -70°C. The
protein concentration of the extracts was estimated with a modified Lowry
method (Ulmasov et al.,
1992
).
Consensus HSE probe (Wu et al.,
1988
) was prepared by annealing partially complementary
oligonucleotides (ATCCGAGCGCGCCTCGAATGTTCTAGAA and
CTCGCGCGGAGCTTACAAGATCTTTTCCA) in 10 mmol l-1 potassium phosphate
buffer, pH 8.2, in the presence of 0.1 mmol l-1 NaCl.
Single-stranded termini were filled with Klenow polymerase and
[32P]ATP (Sambrook and Fritsch,
1989
). For the gel mobility-shift assay, extracts containing 50
µg of protein were mixed with 0.5 ng of [32P] heat shock element
(HSE) in binding buffer as described
(Mosser et al., 1993
).
Binding-reaction mixture was incubated at room temperature (20°C) for 20
min. Free probe was separated from HSEHSF complexes by electrophoresis
in 5% polyacrylamide gels (Mosser et al.,
1993
). The gels were dried and exposed to X-ray film (Kodak
X-Omat) at -70°C.
| Results |
|---|
|
|
|---|
Within D. virilis and D. lummei, we failed to detect differences as large as those among species. This minor intraspecific variation in basal thermotolerance, moreover, was not inversely correlated with latitude. With the exception of strain 160, the LT50 for D. virilis strains ranging from 32° to 53° N were within 0.2°C of one another and, with the exception of strain 1102, the LT50 for D. lummei strains ranging from 45° to 60° N were within 0.1°C of one another. Strain 160 is a marker strain with at least one known recessive mutation on each autosome (broken bk in ch. II; gapped gp in ch. III; cardinal cd in ch. IV; peach pe in ch.V; and glossy gl in ch. VI); all other strains are wild-type.
Reciprocal hybrids of D. virilis and D. lummei had basal thermotolerances intermediate to those of the two parental species (Fig. 2A). The direction of the cross did not affect basal thermotolerance appreciably.
|
In D. virilis strain 9, pre-treatment improved thermotolerance (Fig. 2B), and the change in thermotolerance (i.e. LT50 after PT minus LT50 without PT) was correlated with the PT temperature. The impact of PT on thermotolerance in D. virilis strain 160 was nearly identical to that in strain 9, although the absolute values of LT50s differed in these two strains (Fig. 1; data after PT not shown for strain 9). By contrast, pre-treatment reduced thermotolerance in D. lummei, and the change in thermotolerance was inversely correlated with the PT temperature (Fig. 2B). PT at 36°C and 37°C reduced survival of 4040.5°C heat shock to 0%.
A D. virilis parent, regardless of sex, was sufficient for positive inducible thermotolerance in D. virilisD. lummei hybrids (Fig. 2B). Although results differed slightly according to the direction of the cross, PT temperature and the interval between PT and heat shock, PT increased the LT50 of D. virilisD. lummei hybrids by 0.250.5°C, to where it was slightly less than the basal thermotolerance of pure D. virilis. Although this PT was modest, it clearly differs from the decreased thermotolerance after PT in D. lummei. In the hybrids, the effect of increasing PT temperature was intermediate to that in the parental species; it neither increased nor decreased inducible thermotolerance.
Protein synthesis and levels
As Garbuz et al. (2002
;
figs 5,
6) have previously reported,
under normal physiological conditions (25°C), D. virilis strain 9
and D. lummei strains 200 and 1102 did not differ in total protein
synthesis, as indicated by [35S]L-methionine
incorporation. At 1 h after mild heat shock (37.5°C), these D.
lummei strains synthesized no less protein than did D. virilis
strain 9. By contrast, at 1 h after more-intense heat shock (40°C), these
D. lummei strains clearly synthesized less protein than did D.
virilis strain 9. These differences are manifest in all major classes of
heat-shock proteins that are typically distinguishable in one-dimensional
electrophoresis of synthesized proteins. Additional determinations of protein
synthesis via [35S]L-methionine incorporation
(Figs 3,
4) corroborate and extend these
conclusions. First, as inclusion of two additional D. virilis strains
(160 and 1433) demonstrates, these are true interspecific differences rather
than a feature unique to D. virilis strain 9. Second, these
interspecific differences are even greater after more-intense heat shock
(40.5°C and 41°C), although both species are capable of some protein
synthesis at all temperatures studied. After these intense heat shocks, Hsp40
and small Hsps are especially reduced in D. lummei relative to D.
virilis. Third, interspecific hybrids (D. lummei strain 200
x D. virilis strain 9) exhibit the D. virilis pattern
of protein synthesis. The same is true of the reciprocal cross (data not
shown). Finally, the species pair D. novamexicana and D.
texana, which correspond in thermotolerance to D. virilis and
D. lummei, respectively, exhibit parallel differences in protein
synthesis (Fig. 4).
Interestingly, D. virilis strain 160, which both has numerous
mutations and is the most thermosensitive of the D. virilis strains
(see above), is not obviously defective in terms of protein synthesis after
heat shock. Also, both D. lummei and D. virilis exhibit
expression of a high-molecular-mass heat-shock protein under some conditions
(Fig. 3).
|
|
|
|
According to both Garbuz et al.
(2002
) and the present study
(Figs 3,
4), Hsp70 is quantitatively the
major heat-shock protein in the species and strains examined. To examine the
conclusions of the previous paragraph in detail for this specific Hsp, we have
replotted the data from Fig. 2A
of Garbuz et al. (2002
) and
included data for additional strains and conditions
(Fig. 5). Indeed, Hsp70 levels
for D. lummei strains are within the range for the various D.
virilis strains 3 h after a 37.5°C heat shock. After more-severe heat
shock, Hsp70 levels in the D. lummei strains are below the range for
D. virilis strains, corresponding to their differing thermotolerances
(Figs 1,
2). Data for the
more-thermotolerant D. novamexicana and less-thermotolerant D.
texana recapitulate this pattern (Fig.
5B). Immunoblots of Hsp70 levels
(Fig. 5C) clearly emphasize the
differing Hsp70 levels in these species after intense heat shock. Detailed
examination of the Hsp70 family reveals that the differences between Hsp70s of
D. virilis and D. lummei are qualitative as well as
quantitative (Fig. 6; see also
Garbuz et al., 2002
). D.
virilis exhibits three isoforms recognizable by antibody 7FB, which in
D. melanogaster reacts only with Hsp70; D. lummei exhibits
only two of these three isoforms. D. virilis also exhibits two
inducible isoforms not recognized by 7FB but recognizable by antibody 7.10.3,
which reacts with all Hsp70 family members in most species examined; D.
lummei exhibits only one of these two isoforms. Interspecific hybrids
(D. lummei strain 200 x D. virilis strain 9) exhibit
the D. virilis pattern (Fig.
6), as does the reciprocal cross (data not shown).
Transcriptional regulation
The thermal sensitivity of hsp70 mRNA transcription in general
resembled that for Hsp70 protein. Thus, D. lummei synthesized no
detectable hsp70 mRNA during heat shock at 4041°C, whereas
D. virilis strain 9 did so in abundance
(Fig. 7). These results for
D. virilis strain 9 exemplify those obtained for other D.
virilis strains. Despite its low thermotolerance
(Fig. 1) and unexceptional
Hsp70 protein levels (Fig. 3),
D. virilis strain 160 typically synthesized more hsp70 mRNA
than did other D. virilis strains
(Fig. 7; and other data not
shown).
|
As indicated by electrophoretic mobility-shift assays (Fig. 8), D. virilis underwent HSF trimerization at temperatures of >32°C, whereas D. lummei exhibited activation at temperatures of >31°C. This difference, although small, is again consistent with the environmental regimes of these species.
|
| Discussion |
|---|
|
|
|---|
Within D. virilis and D. lummei, by contrast, little such
countergradient variation is evident. We speculate that extensive gene flow
among populations swamps incipient adaptation to local conditions, a situation
that may not be universal in Drosophila species
(Michalak et al., 2001
). As in
D. melanogaster (Krebs et al.,
2001
), adaptation to laboratory conditions does not seem to
contribute to this intraspecific similarity, as the two strains from Tashkent,
Uzbekistan (T53 and T61) exhibit virtually identical patterns of
thermotolerance and Hsp induction despite the fact that T61 was captured
recently and the T53 more than 30 years ago. The only conspicuous departure
from this pattern is for D. virilis strain 160, a marker strain with
at least one known recessive mutation on each autosome. The basal
thermotolerance for this strain is considerably lower than for all other
D. virilis strains studied, suggesting that the mutations it bears
interfere with this form of thermotolerance. Its expression of heat-shock
proteins, which underlies inducible rather than basal thermotolerance, is as
in other D. virilis strains, however.
The absence of inducible thermotolerance in the high-latitude species D. lummei is indeed distinctive. We know of no other Drosophila species that shares this absence. Remarkably, this species expresses a full complement of heat-shock proteins after heat pre-treatment (although in lesser magnitude than in D. virilis), suggesting that these proteins are not sufficient for inducible thermotolerance and that some unknown component is deficient.
An unusual feature of the virilis species group is its capacity
for interspecific introgression of genetic material in the laboratory. Here,
we demonstrate corresponding patterns in basal and inducible thermotolerance
(Fig. 2), overall protein
synthesis after heat shock (Figs
3,
4) and Hsp70 electromorphs
(Fig. 6). For thermotolerance,
the pattern for hybrids is intermediate to that for the two parental species
and independent of the direction of the cross. For quantitative and
qualitative variation in Hsp expression, the D. virilis pattern
behaves as a dominant trait. For example, D. virilis exhibits three
Hsp70-family protein isoforms recognizable by both antibody 7.10.3 and 7FB,
D. lummei exhibits only two isoforms, and hybrids exhibit three
isoforms (Fig. 6). Similarly,
D. virilis exhibits two inducible Hsp70-family protein isoforms
recognizable by antibody 7.10.3, D. lummei exhibits only one isoform,
and hybrids exhibit two isoforms (Fig.
6). The Drosophila virilis group has great potential to
elucidate the genetic basis for interspecific differences in thermal phenotype
for two reasons. First, the group is far more diverse than the four species
examined here; in essence, an independent but related phylad (the
montana phylad) replicates the patterns of latitudinal and geographic
replacement seen in the virilis phylad. Species within each phylad
can be crossed with one another to produce partially fertile progeny;
moreover, some species belonging to different phylads can also be crossed
(Evgenev et al., 1982
;
Patterson and Stone, 1952
).
Second, markers present on each chromosome make possible the introgression of
a single chromosome or even a portion of a chromosome bearing, for example,
the hsp70 gene cluster, whose location is known
(Evgenev et al., 1978
). This
potential is an unexploited and exciting opportunity for evolutionary
physiology.
Finally, Garbuz et al.
(2002
) interpreted restriction
fragment length polymorphism for hsp70 genes to suggest that the
D. virilisD. lummei and D.
novamexicanaD. texana species pairs exhibit corresponding
differences in hsp70 gene family copy number. Although less likely
than differences in copy number, these data are also consistent with
nucleotide polymorphisms in restriction sites and a constant number of gene
copies. Part II of this series of research papers will show that the D.
virilisD. lummei species pair indeed differ in gene copy number,
with the high-latitude D. lummei having lost some hsp70
genes present in the low-latitude D. virilis. Thus, the mRNA, protein
and thermotolerance differences reported in the present manuscript have at
least part of their basis in the copy number of their encoding genes.
In Moscow, the research was supported by Russian Grants for Basic Science 0004-48-285 and 0004-32-243. In Chicago, research was supported by an International Supplement to NSF grant IBN99-86158. We thank A. Helin and D. Lerman for technical assistance.
| References |
|---|
|
|
|---|
Chomczynski, P. and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162,156 -159.[Medline]
Cossins, A. R. and Bowler, K. (1987). Temperature Biology of Animals. London: Chapman and Hall.
Creighton, T. E. (1990). Protein Structure: A Practical Approach. Oxford, England, New York: IRL Press.
David, J. R., Allemand, R., Van Herrewege, J. and Cohet, Y. (1983). Ecophysiology: abiotic factors. In The Genetics and Biology of Drosophila, vol.3d (ed. M. Ashburner, H. L. Carson and J. N. Thompson), pp. 105-170. London: Academic Press.
Evgenev, M. B., Kolchinski, A., Levin, A., Preobrazhenskaya, A. L. and Sarkisova, E. (1978). Heat-shock DNA homology in distantly related species of Drosophila. Chromosoma 68,357 -365.[CrossRef]
Evgenev, M. B. and Sidorova, N. V. (1976). Genetic regulation of chromosome behavior in interspecific hybrids of Drosophila. Theor. Appl. Genet. 48, 55-61.[CrossRef]
Evgenev, M. B., Yenikolopov, G. N., Peunova, N. I. and Ilyin, Y. V. (1982). Transposition of mobile genetic elements in interspecific hybrids of Drosophila. Chromosoma 85,375 -386.[CrossRef][Medline]
Feder, M. E. (1996). Ecological and evolutionary physiology of stress proteins and the stress response: the Drosophila melanogaster model. In Animals and Temperature: Phenotypic and Evolutionary Adaptation (ed. I. A. Johnston and A. F. Bennett), pp. 79-102. Cambridge: Cambridge University Press.
Feder, M. E., Bennett, A. F. and Huey, R. B. (2000). Evolutionary physiology. Annu. Rev. Ecol. Syst. 31,315 -341.[CrossRef]
Feder, M. E. and Hofmann, G. E. (1999). Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61,243 -282.[CrossRef][Medline]
Feder, M. E. and Krebs, R. A. (1998). Natural and genetic engineering of thermotolerance in Drosophila melanogaster. Am. Zool. 38,503 -517.
Garbuz, D. G., Molodtsov, V. B., Velikodvorskaia, V. V., Evgenev, M. B. and Zatsepina, O. G. (2002). Evolution of the response to heat shock in genus Drosophila. Russian J. Genet. 38,925 -936.[CrossRef]
Hoffmann, A. A., Sørensen, J. G. and Loeschcke, V. (2003). Adaptation of Drosophila to temperature extremes: bringing together quantitative and molecular approaches. J. Therm. Biol. 28,175 -216.[CrossRef]
Hsu, T. C. (1952). Chromosomal variation and evolution in the virilis group of Drosophila. Univ. Texas Publ. 5204,35 -72.
Krebs, R. A., Roberts, S. P., Bettencourt, B. R. and Feder, M. E. (2001). Changes in thermotolerance and Hsp70 expression with domestication in Drosophila melanogaster. J. Evol. Biol. 14,75 -82.
Lumme, J. (1982). The genetic basis of the photoperiodic timing of the onset of winter dormancy in Drosophila littoralis. Acta Univ. Ouluensis 129, 1-42.
McGarry, T. J. and Lindquist, S. (1985). The preferential translation of Drosophila hsp70 mRNA requires sequences in the untranslated leader. Cell 42,903 -911.[CrossRef][Medline]
Michalak, P., Minkov, I., Helin, A., Lerman, D. N., Bettencourt,
B. R., Feder, M. E., Korol, A. B. and Nevo, E. (2001).
Genetic evidence for adaptation-driven incipient speciation of Drosophila
melanogaster along a microclimatic contrast in "Evolution
Canyon", Israel. Proc. Natl. Acad. Sci. USA
98,13195
-13200.
Mitrofanov, V. G. and Blanter, T. V. (1975). A study of temperature-sensitive mutations in the virilis group of Drosophila. Ontogenesis 6, 386-391.
Mosser, D. D., Duchaine, J. and Massie, B.
(1993). Saccharomyces cerevisiae HSP70 heat shock
elements are functionally distinct. Mol. Cell. Biol.
13,5637
-5646.
Nurminsky, D. I., Moriyama, E. N., Lozovskaya, E. R. and Hartl, D. L. (1996). Molecular phylogeny and genome evolution in the Drosophila virilis species group: duplications of the alcohol dehydrogenase gene. Mol. Biol. Evol. 13,132 -149.[Abstract]
O'Farrell, P. Z., Goodman, H. M. and O'Farrell, P. H. (1977). High resolution two-dimensional electrophoresis of basic as well as acidic proteins. Cell 12,1133 -1142.[CrossRef][Medline]
Patterson, J. T. and Stone, W. S. (1952). Evolution In The Genus Drosophila. New York: Macmillan.
Peters, F. P., Lubsen, N. H. and Sondermeijer, P. J. (1980). Rapid sequence divergence in a heat shock locus of Drosophila. Chromosoma 81,271 -280.[CrossRef][Medline]
Sambrook, J. and Fritsch, E. F. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Sinibaldi, R. M. and Storti, R. V. (1982). One- and two-dimensional polyacrylamide gel analysis of the heat shock proteins of the virilis group of Drosophila. Biochem. Genet. 20,791 -807.[CrossRef][Medline]
Spicer, G. S. (1991). Molecular evolution and phylogeny of the Drosophila virilis species group as inferred by 2-dimensional electrophoresis. J. Mol. Evol. 33,379 -394.[CrossRef][Medline]
Spicer, G. S. (1992). Reevaluation of the phylogeny of the Drosophila virilis species group (Diptera, Drosophilidae). Ann. Entomol. Soc. Am. 85, 11-25.
Stratman, R. and Markow, T. A. (1998). Resistance to thermal stress in desert Drosophila. Funct. Ecol. 12,965 -970.[CrossRef]
Throckmorton, L. H. (1982). The virilis species group. In The Genetics and Biology of Drosophila, vol. 3b (ed. M. Ashburner, H. L. Carson and J. N. Thompson), pp. 227-296. London: Academic Press.
Ulmasov, K. A., Shammakov, S., Karaev, K. and Evgenev, M. B.
(1992). Heat shock proteins and thermoresistance in lizards.
Proc. Natl. Acad. Sci. USA
89,1666
-1670.
Wu, C., Tsai, C. and Wilson, S. (1988). Affinity chromatography of sequence-specific DNA-binding proteins. In Genetic Engineering, vol. 10 (ed. J. K. Setlow), pp. 67-74. New York: Plenum Publishing Corporation.
Zatsepina, O. G., Velikodvorskaia, V. V., Molodtsov, V. B.,
Garbuz, D., Lerman, D. N., Bettencourt, B. R., Feder, M. E. and Evgenev, M.
B. (2001). A Drosophila melanogaster strain from
sub-equatorial Africa has exceptional thermotolerance but decreased Hsp70
expression. J. Exp. Biol.
204,1869
-1881.
This article has been cited by other articles:
![]() |
M. T. Levine and D. J. Begun Evidence of Spatially Varying Selection Acting on Four Chromatin-Remodeling Loci in Drosophila melanogaster Genetics, May 1, 2008; 179(1): 475 - 485. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Y. Shilova, D. G. Garbuz, E. N. Myasyankina, B. Chen, M. B. Evgen'ev, M. E. Feder, and O. G. Zatsepina Remarkable Site Specificity of Local Transposition Into the Hsp70 Promoter of Drosophila melanogaster Genetics, June 1, 2006; 173(2): 809 - 820. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Tomanek Two-dimensional gel analysis of the heat-shock response in marine snails (genus Tegula): interspecific variation in protein expression and acclimation ability J. Exp. Biol., August 15, 2005; 208(16): 3133 - 3143. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lupu, A. Pechkovskaya, E. Rashkovetsky, E. Nevo, and A. Korol DNA repair efficiency and thermotolerance in Drosophila melanogaster from 'Evolution Canyon' Mutagenesis, September 1, 2004; 19(5): 383 - 390. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||