|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
Molecular cloning and function of ecdysis-triggering hormones in the silkworm Bombyx mori
an
it
an1,*
1
it
anová1,5
1 Institute of Zoology, Slovak Academy of Sciences, Dúbravská
cesta 9, 84206 Bratislava, Slovakia
2 Department of Entomology, 5429 Boyce Hall, University of California,
Riverside, CA 92521, USA
3 Department of Cell Biology and Neuroscience, 5429 Boyce Hall, University
of California, Riverside, CA 92521, USA
4 Department of Zoology, Comenius University, Mlynská dolina B2,
84215 Bratislava, Slovakia
5 Institute of Medical Chemistry and Biochemistry, School of Medicine,
Comenius University, Sasinkova 2, 81108 Bratislava, Slovakia
* Author for correspondence (e-mail: dusan.zitnan{at}savba.sk)
Accepted 8 August 2002
| Summary |
|---|
|
|
|---|
Key words: Inka cells, pre-ecdysis-triggering hormone, ecdysis-triggering hormone, cGMP, behaviour, Bombyx mori
| Introduction |
|---|
|
|
|---|
it
an et
al., 1996
it
an,
1997
The eth gene in M. sexta encodes one copy each of
pre-ecdysis-triggering hormone (PETH), ETH and ETH-associated peptide (ETH-AP)
and also contains several putative steroid-response elements in the promoter
region (
it
an et al.,
1999
). In M. sexta pharate larvae and pupae, high steroid
levels in the haemolymph induce synthesis of Inka cell peptides
(
it
anová et al.,
2001
), while decreasing steroid levels permit the release of
active peptide hormones from Inka cells
(
it
an et al.,
1999
; Kingan and Adams,
2000
). Release of Inka cell peptides into the haemolymph is
promoted by the brain neuropeptide, eclosion hormone (EH)
(Kingan et al., 1997
).
Circulating PETH and ETH then act directly on the central nervous system (CNS)
to activate each phase of the ecdysis behavioural sequence
(
it
an et al.,
1999
;
it
an and
Adams, 2000
). In D. melanogaster, selective deletion of
eth results in disruption of the first larval ecdysis and lethality.
Injection of synthetic ETH into these mutant larvae rescues ecdysis deficits,
permitting normal shedding of the old cuticle
(Park et al., 2002
). Thus,
epitracheal glands and products of the eth gene participate in the
control of essential function during insect development.
In the present study, we show that B. mori endocrine Inka cells release their ETH-immunoreactive content at each larval, pupal and adult ecdysis. We isolated and identified three active peptides (PETH, ETH and ETH-AP) and found that they are encoded by the same cDNA precursor. Physiological experiments in vivo and in vitro showed that these peptides activate larval, pupal and adult ecdysis behavioural sequences, which are, in several respects, different from those described in the related moth, M. sexta. For example, isolated abdomens of B. mori show normal ecdysis behaviour associated with the elevation of cyclic 3',5'-guanosine monophosphate (cGMP) in the ventral nerve cord without release of EH. The B. mori model introduced here provides excellent opportunities for elucidating the cascade of complex physiological and developmental processes (e.g. regulation of peptide hormone expression and release, and activation of neural circuits), leading to a precisely defined behavioural sequence.
| Materials and methods |
|---|
|
|
|---|
esk Budejovice, Czech Republic) and H. Akai (University of
Agriculture, Tokyo, Japan). Larvae were reared on fresh leaves of mulberry,
Morus bombycis and Morus rubra, or standard artifical diet
(Nippon Nosan Co. Ltd, Yokohama, Japan) at 25°C and a 16 h:8 h L:D
photoperiod. We used pharate 5th instar larvae, pharate pupae or pharate
adults 1-2 days before ecdysis for experiments. The following markers proved
useful for determination of the developmental stages of these animals. Pharate
5th instar larvae develop a new cuticle and slip their head capsule
approximately 28 h before expected ecdysis (-28 h). The edges of new,
light-yellow spiracles show grey pigmentation 15-16 h before natural ecdysis
(-15 h to -16 h) and turn black 3-4 h later (-12 h). The remaining lighter
areas of spiracles then progressively darken to a brownblack colour
approximately 5 h before ecdysis (-5 h). Pharate pupae stop spinning the
cocoon approximately 24 h before pupation (-24 h) and start to shrink the old
larval cuticle between all thoracic and abdominal segments approximately 4 h
before ecdysis (-4 h). Dark pigmentation of scales on the wings of pharate
adults is visible 1-2 days before eclosion. Adults emerge on the morning of
day 12 (some males eclose in the morning of day 11) and live for 5-8 days.
Immunohistochemistry
To describe the morphology and developmental changes of epitracheal glands,
we used wholemount immunofluorescence with fluorescein isothiocyanate
(FITC)-labelled goat antiserum to horseradish peroxidase (HRP/FITC;
Jan and Jan, 1982
) and nuclear
staining with 4',6'-diamidino-2-phenylindole (DAPI; Sigma, St
Louis, MO, USA) as described by
it
an et al.
(1996
). Briefly, epitracheal
glands of `white' pharate 5th instar larvae, pharate pupae and pharate adults
were dissected under saline (140 mmol l-1 NaCl; 5 mmol
l-1 KCl; 5 mmol l-1 CaCl2; 1 mmol
l-1 MgCl2; 4 mmol l-1 NaHCO3; 5
mmol l-1 Hepes; pH 7.2), fixed in Bouin's fixative (Slavus,
Bratislavia, Slovakia) for 1-2 h, washed in phosphate-buffered saline with
0.5% Triton X-100 (PBST), incubated in HRP/FITC antibody (diluted 1:100) for
approximately 4 h, washed in PBST and mounted in glycerin containing DAPI (1-2
mg ml-1). Mounted tissue was observed under a Nikon fluorescent
microscope (Eclipse 600) using a triple-band-pass filter (DFR
for DAPI and FITC labelling) and an ultraviolet filter (UV-2A for DAPI only).
Wholemount preparations of white pharate larval, pupal and adult Inka cells
were also stained with antisera to tetrapeptide Phe-Met-Arg-Phe-amide
(FMRFamide), PETH and ETH. Reactions of these rabbit antisera were detected
with an alkaline phosphatase-conjugated goat anti-rabbit immunoglobulin G
(Jackson Immunoresearch Lab Inc., West Grove, PA, USA) and stained with
naphthol-AS-MX-phosphate and Fast Blue BB salt (Sigma) as described by
it
an et al.
(1995
).
The release of PETH, ETH and ETH-AP from Inka cells was monitored using
rabbit antisera to these peptides in pharate 5th instar larvae, pupae and
adults 4-12 h before ecdysis and during ecdysis as described by
it
an et al.,
1999
. The release of EH and the elevation of cGMP levels 10-15 min
after the onset of ecdysis behaviour was detected in wholemounts of the CNS
and proctodeal nerves attached to the hindgut. These tissues were dissected
under saline, fixed in 4% paraformaldehyde and stained with rabbit antisera to
EH and cGMP (both diluted 1:1000) as described by
it
an and
Adams (2000
).
Peptide isolation, identification and synthesis
For identification of Inka cell peptides, epitracheal glands were dissected
from white pharate pupae under saline as described above. Glands were heated
at 90°C for 5 min, homogenized in 50 µl or 100 µl of saline and
centrifuged for 10 min at 10 000 g. Supernatants were
fractionated by reversephase liquid chromatography (RPLC; Rainin Instruments,
Woburn, MA, USA) using a Microsorb C4 wide-pore analytical column
(4.6 mmx250 mm; 5 µm) with a linearly increasing gradient of
acetonitrile (3-50% in 90 min) and constant 0.1% trifluoroacetic acid in
water. For bioassay, each RPLC fraction from an extract of 30 glands was dried
and resuspended in 100 µl of water, and 10 µl samples were injected into
pharate 5th instar larvae. Pre-ecdysis and ecdysis contractions were observed
under a dissection microscope. Fractions from an extract of 70 glands were
used for identification of active peptides by electrospray mass spectrometry
and Edman sequencing, as described by Adams and
it
an
(1997
) and
it
an
et al. (1999
). Synthetic
B. mori PETH and ETH were prepared according to standard solid-phase
peptide synthesis methods by Research Genetics (Birmingham, AL, USA), and
M. sexta ETH-AP was synthesized using the fMoc method by Dr W. Gray
(University of Utah, USA).
Molecular biology
For isolation of total RNA, approximately 50 epitracheal glands were
dissected from four pharate pupae, immediately placed in an eppendorf tube on
dry ice and stored in liquid nitrogen. Glands were lysed in 100 µl of lysis
buffer (100 mmoll-1 Tris-HCl; 500 mmoll-1 LiCl; 10
mmoll-1 EDTA; 1% SDS; 5 mmoll-1 dithiothreitol; pH 8.0),
centrifuged, and mRNA was isolated using 10 µl of oligo(dT) Dynabeads
(Dynal, Lake Success, NY, USA). This mRNA and degenerate nucleotide primers
designed from the amino acid sequence of ETH
(Adams and
it
an,
1997
) were used for 3' rapid amplification of cDNA ends
(3'-RACE;
it
an et
al., 1999
). Briefly, beads with immobilized mRNA were washed,
resuspended in reverse transcriptase buffer (20 mmoll-1 Tris-HCl;
50 mmoll-1 KCl; pH 8.4) and heated to 70°C for 10 min.
Superscript reverse transcriptase (1 unit; GIBCO-BRL Life Technologies,
Gaithersburg, MD, USA) was used to synthesize the first strand cDNA at
42°C for 50 min followed by enzyme inactivation at 70°C for 15 min.
For amplification of the cDNA encoding ETH by PCR (5 min at 94°C, 3 min at
50°C and 5 min at 72°C), we used the following primers: E83,
AACGAGGCNTT(CT)GA(CT)GA(AG)GA(CT)GTNATGGG (sense primer at bp 157-185); E84,
TCGGGIAA(CT)CA(CT)-TT(CT)GA(CT)-AT(CTA)CCNAA(AG)GT (sense primer at bp
241-269). 5'-RACE was performed as described by
it
an et
al. (1999
) using primers 190
[TTATTTGATTTGATCACGTATCCC (antisense primer at bp 183-206)] and 191
[AATCATAATTTCTTCTACCCATACG (antisense primer at bp 217-241)]. The PCR products
were cloned into the pCRTMII vector (Invitrogen, San Diego, CA, USA) and
at least three cDNA clones were sequenced.
Physiological procedures
To identify specific functions of Inka cell peptides, we compared the
effects of injected epitracheal-gland extracts and synthetic peptide hormones
(50-100 pmol PETH, ETH or ETH-AP) in yellow pharate larvae, pupae and adults.
Extracts were prepared from epitracheal glands of pharate pupae as described
above. To identify specific roles of Inka cell peptides in activation of
different behavioural phases, pharate larvae were sequentially injected with
PETH and then with ETH. To determine target ganglia required for activation of
individual behavioural phases, we ligated pharate larvae and pupae between
abdominal segments 1 and 2 (A1-2) and cut off the thorax, with head. Another
set of pharate larvae was ligated between abdominal segments 5 and 6 or
abdominal segments 6 and 7 (A5-6, A6-7), and posterior segments were removed.
We also transected the connectives between abdominal ganglia 4 and 5 (AG4-5)
in CO2-anesthetized pharate larvae, as described by
it
an and Adams
(2000
). To determine target
ganglia for activation of eclosion behaviour, we extirpated the brain 2-4 days
after pupation (8-10 days before eclosion) or removed the entire head 5-7 days
or 1-2 days prior to eclosion. In sham-operated pharate adults, we removed
cuticle covering the head. We observed the onset and patterns of natural or
peptide-induced ecdysis or eclosion behavioural sequences under dissection
microscope and compared them with intact or sham-operated control larvae. The
CNS and hindgut of these larvae were dissected 10-15 min after the initiation
of ecdysis behaviour and stained with antisera to EH and cGMP. Latencies from
injection to the onset of behaviour and the length of each behavioural phase
were measured using a stopwatch. Values are presented as means ±
S.D.
Electrophysiology
The CNS of pharate 5th instar larvae or pharate pupae was isolated 4-5 h
prior to ecdysis onset or 10-20 min after the initiation of natural
pre-ecdysis. The entire CNS or a chain of abdominal ganglia 1-8 (AG1-8) was
dissected and transferred to a small dish containing 300 µl of saline (see
above). Natural or ETH-induced pre-ecdysis and ecdysis bursts in the CNS were
recorded using polyethylene suction electrodes attached to dorsal or ventral
nerves, as described by
it
an and Adams
(2000
). In some preparations,
we transected connectives between each abdominal ganglion 5-10 min after the
initiation of PETH- or ETH-induced pre-ecdysis to detect burst patterns in
individual ganglia.
| Results |
|---|
|
|
|---|
|
Wholemount immunohistochemical staining with antisera to FMRF amide (Fig. 1I), PETH or ETH (not shown) showed that Inka cells project narrow cytoplasmic processes to the surface of adjacent, small gland cells of the epitracheal gland. These processes are especially prominent in pharate adults. The function of these cytoplasmic processes is unknown at the present time.
In a previous study, we characterized an antiserum that recognizes a unique
amino-terminal amino acid sequence of ETH and shows no crossreactivity with
other known peptides (
it
an
et al., 1999
). Using this antiserum, we stained sections of entire
pharate 3rd or 4th instar larvae and found that ETH-immunoreactivity is
confined to Inka cells (not shown). We also monitored loss of
immunohistochemical staining with antisera to PETH, ETH and ETH-AP as a
measure of peptide release from Inka cells during larval, pupal and adult
ecdyses. Inka cells showed strong staining with all three antisera 4-12 h
prior to initiation of ecdysis behaviour, while ecdysis onset was associated
with depletion or reduction of staining and decrease of Inka cell size.
Fig. 2 shows examples of PETH
and ETH release from Inka cells during pupal ecdysis and adult eclosion.
|
Isolation and identification of Inka cell peptide hormones
Injection of epitracheal-gland extracts from pharate larval, pupal or adult
stages into pharate 5th instar larvae induced strong pre-ecdysis and ecdysis
behaviours (N=25). To identify the source(s) of this biological
activity, an extract of 30 Inka cells from pharate pupae was fractionated by
RPLC. We traced biological activity to the first three major peaks
(Fig. 3); all other fractions
were inactive. Chemical identification of these active compounds was
accomplished using an extract prepared from an additional set of 70 Inka cells
from five pharate pupae. A single RPLC fractionation resulted in siolation of
the three substances, with molecular masses of 1265, 2656 and 5142, as
determined by electrospray mass spectrometry
(Fig. 3). Their amino acid
sequences were identified by Edman microsequencing
(Fig. 4).
|
|
These three peptides show moderate to high sequence similarity to Inka cell
peptides isolated from M. sexta and D. melanogaster
(
it
an et al.,
1999
; Park et al.,
1999
). B. mori PETH was identical to M. sexta
PETH, while B. mori ETH was highly similar to M. sexta ETH
(73% sequence identity; Fig.
4). These peptides also show remarkable similarity at their
carboxyl termini to ETHs isolated from Drosophila
(Fig. 4). The third B.
mori peptide, ETH-AP, showed similarity to the amino terminus of M.
sexta ETH-AP (38% sequence identity). As in M. sexta, B.
mori ETH-AP is not amidated and has an amino acid sequence that is
completely unrelated to PETH or ETH.
Identification of the cDNA precursor encoding PETH, ETH and
ETH-AP
We utilized RACE-PCR to isolate the cDNA encoding PETH, ETH and ETH-AP. In
a first round of PCR, we used degenerate nucleotide primers designed from the
ETH sequence (Adams and
it
an, 1997
) and mRNA from epitracheal-gland
extracts to produce a cDNA fragment containing a partial nucleotide sequence
of ETH and the complete sequence of ETH-AP
(Fig. 5). In a second round of
PCR, we generated the 5' fragment encoding the signal sequence, PETH and
the amino terminus of ETH. The entire transcript (468 bp) contains an open
reading frame (324 bp) starting with ATG at bp 49. This cDNA encodes a 107
amino acid pre-propeptide composed of a 22 amino acid signal peptide followed
by a single copy each of PETH, ETH and ETH-AP
(Fig. 5). Deduced sequences of
PETH and ETH are separated by GR and GRR, amidation sites
and processing sites at their carboxy termini, respectively
(Fig. 5). The ETH-AP sequence
is followed by a putative processing site (KK) and lacks an amidation
site (Fig. 5).
|
Natural and peptide-induced behaviour in pharate larvae
To determine the roles of Inka cell peptides during ecdysis, we compared
the natural ecdysis behavioural sequence of pharate 5th instar larvae with the
effects of epitracheal-gland extracts and synthetic peptides
(Fig. 6AF). Natural
pre-ecdysis behaviour of pharate larvae (N=12) was initiated by weak
and occasional dorso-ventral contractions of all abdominal and thoracic
segments during the first 15-20 min. Pre-ecdysis then progressively developed
into a strong, pronounced behaviour composed of rhythmic, asynchronous
dorso-ventral, ventral and posterio-lateral body wall contractions together
with leg and proleg contractions. This behavioural phase lasted for
approximately 1 h (Fig. 6A).
Larvae then abruptly switched to ecdysis behaviour, characterized by
anteriorly directed peristaltic movements. This behaviour was usually
initiated in the thoracic and first abdominal segments, but, after it was
fully established, peristaltic contractions moved from the most posterior
abdominal segment forward. Contraction of the next anterior segment was
delayed for approximately 1-2 s. Each moving segment showed apparent
dorso-ventral contraction and retraction of prolegs (if present), with the
entire segment being pulled anteriorly. This resulted in rupture of the old
cuticle along the dorsal midline behind the head. Consecutive movements of
each abdominal and thoracic segment towards the head shifted the old cuticle
posteriorly until it was completely shed in 10-12 min
(Fig. 6A).
|
Premature pre-ecdysis and ecdysis behaviours were induced by injection of epitracheal-gland extracts. Injection of yellow pharate 5th instar larvae 10-15 h prior to natural ecdysis (-10 h to -15 h) with extracts from pharate larvae or pharate pupae (15 or 5 gland equivalents, respectively) induced strong pre-ecdysis in 4-5 min, followed by ecdysis contractions in all animals in 30-35 min (N=16; Fig. 6A). Under these conditions, the time from the initiation of pre-ecdysis to ecdysis was much shorter when compared with natural behaviour. As extract-injected larvae were not able to shed their old cuticle at this time, ecdysis contractions persisted for up to 30 min.
Injection of yellow pharate larvae at -10 h to -15 h with synthetic ETH (50
pmol) induced pre-ecdysis contractions in 4-5 min (N=14), followed by
ecdysis behaviour in 30-40 min in 13 animals. Thus, the effects of synthetic
ETH and gland extracts that contained all active peptides appeared to be
similar (Fig. 6A), as reported
previously in white pharate larvae (Adams
and
it
an, 1997
). We examined whether PETH and ETH
produce different behavioural effects when injected alone, as previously found
in larvae of M. sexta
(
it
an et al.,
1999
). We injected separate groups of larvae at different times
prior to ecdysis (-20 h to -24 h or -10 h to -15 h) first with PETH and then
with ETH (Fig. 6B). Injection
of PETH (50-100 pmol) into pharate larvae at -20 h to -24 h (N=12)
induced only dorso-ventral contractions of thoracic and abdominal segments
indicative of pre-ecdysis I in 4-5 min
(Fig. 6B,D). These contractions
were asynchronous and could occur on the right or left side of any of these
segments (Fig. 6D). After 30-40
min, this behaviour ceased and animals did not progress to the subsequent
behavioural phases described above. Subsequent injection of ETH (50-100 pmol)
induced asynchronous ventral posterio-lateral and proleg contractions
corresponding to pre-ecdysis II, which occurred independently in each segment,
in 6-8 min (Fig. 6B,E). After
25-30 min, 9 out of 12 larvae switched to peristaltic ecdysis movements
lasting for 10-30 min (Fig.
6B,F). Ecdysis onset in these animals was accelerated when
compared with larvae injected with ETH alone
(Fig. 6A,B). ETH-induced
ecdysis behaviour was indistinguishable from the natural ecdysis movements
described above. Each abdominal and thoracic segment showed dorsoventral
contractions and proleg retractions (if present) during anteriorly directed
peristaltic movements (Fig.
6F).
Surprisingly, injection of PETH (50 pmol) into pharate larvae closer to the initiation of natural ecdysis, at -10 h to -15 h, induced the entire ecdysis behavioural sequence. PETH-injected larvae initiated pre-ecdysis I and pre-ecdysis II contractions simultaneously in 4-5 min (N=11), with 9 larvae showing ecdysis behaviour 56-83 min later (mean ± S.D., 70±9 min). After 5-14 min of ecdysis behaviour, movements ceased (Fig. 6B). These animals failed to shed their old cuticle because it was not sufficiently digested at that time. Subsequent ETH injection had either no effect or only induced weak proleg and ventral contractions in 8-12 min (pre-ecdysis II), lasting for 20-28 min, followed by weak ecdysis movements, which lasted for 5-10 min.
As ETH-AP is produced by Inka cells and co-released with PETH and ETH at
each ecdysis (
it
an et al.,
1999
), we tested its action on intact, ligated or CNS-transected
pharate larvae at -10 h to -15 h. Injection of native, RPLC-isolated ETH-AP
induced relatively weak and non-synchronized contractions of prolegs and
corresponding ventral regions of other segments in pharate larvae in
approximately 10 min (N=5). These contraction patterns resembled
pre-ecdysis II. We also injected the related synthetic peptide, M.
sexta ETH-AP, into pharate larvae (N=8). This peptide induced
proleg and ventral contractions that were very similar to those described
above. Injection of this peptide into isolated abdomens (N=9) or
CNS-transected larvae (between AG4 and AG5; N=8) induced proleg, leg
and ventral contractions, which were more pronounced than those in intact
larvae, in 8-10 min. These data indicate that ETH-AP may participate in the
activation of pre-ecdysis II.
Targets for PETH and ETH in pharate larvae
Several electrophysiological studies have shown that the terminal abdominal
ganglion (TAG) is required for the synchronous dorso-ventral contractions
(pre-ecdysis I) observed in M. sexta larvae (Novicki and Weeks,
1995
,
1996
;
it
an and Adams,
2000
). As pre-ecdysis I contractions in B. mori were not
synchronized, we wanted to determine if the TAG is necessary for generation of
a pre-ecdysis I motor pattern. For this purpose, abdomens of pharate larvae
20-24 h prior to ecdysis were ligated between A6 and A7, and the last two
segments containing the TAG were removed (N=10). Alternatively, no
ligature was applied and the connectives between AG4 and AG5 were severed
(N=9). PETH injection under these conditions invariably induced
normal non-synchronized dorso-ventral contractions in ligated and
CNS-transected larvae anterior and posterior to the cut in 5-8 min. Therefore,
the TAG is not required for generation of the pre-ecdysis I motor pattern in
B. mori. Subsequent ETH injection of the same CNS-transected larvae
elicited strong proleg, ventral and posterio-lateral contractions observed in
natural pre-ecdysis II anterior and posterior to the cut (N=9).
We also observed that isolated abdomens of pharate larvae ligated at -10 h
to -15 h (N=12) initiate normal pre-ecdysis and ecdysis behaviours at
the expected times (Fig. 6C).
To determine if Inka cell peptides are able to activate all of these
behaviours through actions on abdominal ganglia, we injected ETH (50 pmol)
into isolated abdomens. In all cases (N=10), this treatment induced
the entire behavioural sequence, as observed in intact larvae
(Fig. 6A,B), although latencies
for ecdysis onset were more variable in ligated animals (35-56 min; mean
± S.D., 44±7 min). Interestingly, isolated abdomens initiated
ecdysis contractions in the last abdominal segment, whereas ecdysis movements
of intact larvae are normally first observed in the thoracic and anterior
abdominal segments, as described above. These data suggest that activation of
motor programs for all behavioural phases may occur in abdominal ganglia and
does not require cephalic and thoracic ganglia as described for M.
sexta (
it
an et al.,
1999
). However, mechanisms for activation of ecdysis behaviour may
be different in intact larvae and isolated abdomens.
Natural and peptide-induced behaviour in pharate pupae
Natural pre-ecdysis in pharate pupae was initiated by weak dorso-ventral
contractions lasting for approximately 30 min. As pre-ecdysis progressed,
animals showed stronger dorsoventral, leg and proleg contractions for
approximately 1 h and then switched to robust ecdysis peristaltic movements,
which lasted for 10-12 min (Fig.
7A). During ecdysis contractions (similar to those seen in
larvae), the dorsal part of the larval cuticle on the head and thorax was
ruptured, and the entire old cuticle was moved posteriorly and shed with
attached larval foregut, hindgut and trachei.
|
Injection of PETH (100 pmol) into pharate pupae at -4 h to -6 h (N=14) induced pre-ecdysis in 4-6 min, and 12 of the 14 animals progressed to ecdysis behaviour 30-60 min later (mean ± S.D., 44±9 min; Fig. 7A-C). A different set of pharate pupae at -4 h to -6 h was injected with ETH (100 pmol), which induced pre-ecdysis in 6-8 min. All animals (N=11) switched to ecdysis movements in 25-44 min (mean ± S.D., 33±4 min), which persisted for up to 1 h (Fig. 7A-C). As the old cuticle was not sufficiently digested at the time of peptide treatment, these animals remained trapped in the old larval cuticle. Injection of M. sexta ETH-AP (100 pmol) induced weaker proleg and ventral contractions in 9-12 min; these contractions lasted for approximately 1 h (N=10). Seven of these animals then showed weak and occasional ecdysis movements for up to 1 h. Control pharate larvae and pupae injected with water (N=16) failed to show any of the discernible behavioural patterns described above within 2 h.
As isolated abdomens of pharate pupae ligated at approximately -12 h to -15 h (N=8) showed normal pre-ecdysis and ecdysis at the expected time, we wanted to determine if ETH action on abdominal ganglia induces a complete behavioural sequence. Injection of ETH (100 pmol) into isolated abdomens at -4 h to -6 h induced pre-ecdysis in 5-8 min (N=9) and, after a further 32-48 min (mean ± S.D., 39±3 min), eight animals initiated ecdysis contractions, which lasted for up to 1 h (Fig. 7A). These behaviours were very similar to those observed during natural ecdysis.
Natural and peptide-induced behaviour in pharate adults
The natural eclosion behavioural sequence of pharate adults consists of
three distinct phases: rotations of the abdomen (each rotation lasting for 1-2
s, with quiet intervals of 2-5 s), a quiescent phase (40-50 min) and eclosion
contractions (Fig. 8A).
Eclosion onset was characterized by strong peristaltic movements of the
abdomen, resulting in emergence of the head and thorax from the pupal cuticle
in 3-5 min. To escape from the cocoon, adults then released a salivary
secretion containing cocoonase, which dissolved silk around the head, and
peristaltic abdominal contractions helped the adult to completely emerge from
the pupal cuticle and cocoon in approximately 10 min
(Fig. 8A). Posteclosion
behaviour includes spreading and hardening of the wings.
|
Injection of PETH (100-200 pmol) into pharate adults 1-2 days before eclosion (N=17) induced abdomen rotations in 2-4 min that lasted for approximately 20-35 min (number of rotations varied from 40 to 72; mean ± S.D., 53±9 rotations). Following a quiescent phase of 25-40 min, 11 of the 17 animals initiated eclosion behaviour 44-82 min (mean ± S.D., 59±10 min) after the initiation of rotations (Fig. 8A-C). Pharate adults (N=10) injected with ETH (100-200 pmol) showed abdomen rotations in 5-6 min (number of rotations varied from 34 to 78; mean ± S.D., 57±11 rotations), which lasted for 15-20 min, followed by a quiescent phase for 17-23 min. Within 28-40 min (mean ± S.D., 35±2 min) of initiating abdominal rotations, all animals showed eclosion movements, which persisted for up to 1 h (Fig. 8A-C). Control pharate adults (N=9) injected with water responded with a few erratic rotations of the abdomen but failed to show any of the eclosion behavioural patterns described above. These data show that both PETH and ETH induced the entire behavioural sequences, although latencies for the onset of ecdysis or eclosion movements by PETH were more variable and generally longer than for ETH.
To determine if thoracic and abdominal ganglia are sufficient for generation of the eclosion behaviour, we extirpated the brain 2-4 days after pupation (8-10 days before eclosion; N=8) or removed the entire head 5-7 days before eclosion (N=10). All these animals invariably failed to initiate eclosion behaviour and remained trapped in the pupal cuticle. In another group of pharate adults, we removed heads 1-2 days before eclosion (N=16) and injected these insects with ETH (300 pmol). Only three out of 16 animals initiated weak eclosion peristaltic movements in 62-67 min; these movements lasted for approximately 8-10 min. ETH injection of control, sham-operated pharate adults, from which a dorsal piece of cuticle covering the head had been removed, consistently induced strong eclosion behaviour in 32-34 min, which persisted for 60-80 min (N=8). All control animals also failed to emerge and remained in the pupal cuticle. These data show that the brain and head are required for the eclosion behavioural sequence.
Natural and peptide-induced pre-ecdysis and ecdysis in
vitro
We used extracellular recordings in dorsal and ventral nerves of abdominal
ganglia from pharate larvae (-4 h to -6 h) and pharate pupae (-3 h to -4 h) to
determine if motor burst patterns in isolated nerve cords correspond to
pre-ecdysis and ecdysis contractions in vivo. Exposure of the
isolated entire CNS of pharate larvae (N=9) to ETH (300 nmol
l-1) induced asynchronous bursts in ventral nerves of AG3-8 in 5-10
min (Fig. 9A), which resembled
asynchronous pre-ecdysis II contractions in vivo
(Fig. 6E). Similar asynchronous
burst patterns were recorded in dorsal nerves, but these bursts were much
noisier (not shown). Pre-ecdysis lasted for 36-64 min (mean ± S.D.,
51±5 min) and then most nerve cords (seven out of nine) switched to
regular ecdysis bursts (Fig.
9B). These burst patterns were very similar or indistinguishable
from natural ecdysis bursts (N=6;
Fig. 9C).
|
We showed that ETH injection of isolated larval abdomens induces normal ecdysis behaviour (Fig. 6C). To determine if ETH action on abdominal ganglia in vitro is sufficient to activate ecdysis circuitry, we exposed the isolated chain containing AG1-8 (N=7) to the peptide (300 nmol l-1). All abdominal nerve cords initiated pre-ecdysis bursts in 5-9 min, and five of them switched to ecdysis bursts 40-65 min later (mean ± S.D., 54±6 min; not shown). These ecdysis bursts were very similar to those described above (Fig. 9B,C).
To determine if each abdominal ganglion contains the entire circuitry for pre-ecdysis I and II, the isolated CNS from pharate larvae was treated with PETH (N=5; 300 nmol l-1) or ETH (N=5; 300 nmol l-1). 5-10 min after the initiation of pre-ecdysis, connectives between each abdominal ganglion were transected. Each individually isolated AG3, AG4, AG5 and AG6 continued to show pre-ecdysis bursts in dorsal and ventral nerves that were very similar to those recorded in the intact CNS (not shown).
We also tested the effects of ETH on the isolated CNS of pharate pupae. Exposure of the entire CNS to ETH (300 nmol l-1) evoked strong asynchronous pre-ecdysis bursts in dorsal nerves and noisier bursts in ventral nerves in 5-8 min (N=8; not shown). The onset of ecdysis bursts was recorded 38-46 min later in all nerve cords (not shown). These bursts became progressively stronger and lasted for 40-60 min of each recording session.
Application of ETH (300 nmol l-1) on the isolated chain of pharate pupal abdominal ganglia (AG1-8) induced asynchronous pre-ecdysis bursts for 38-46 min (Fig. 10A), after which all nerve cords (N=7) switched to strong ecdysis bursts, which lasted for up to 1 h (Fig. 10B). Thus, ETH action on abdominal ganglia is sufficient to activate the entire behavioural sequence.
|
Another group of nerve cords from pharate pupae was treated with PETH (300 nmol l-1), and connectives between each abdominal ganglion were transected approximately 10 min after initiation of pre-ecdysis. After transection, each isolated ganglion continued to show pre-ecdysis bursts in dorsal and ventral nerves (Fig. 11 A,B). These experiments provide further evidence that each abdominal ganglion contains the entire circuitry for pre-ecdysis I and pre-ecdysis II.
|
Mechanisms of ecdysis activation
In a previous paper, we showed that ETH action on the intact or debrained
CNS of M. sexta pharate larvae induces cGMP elevation in a network of
neurons 27/704 followed by ecdysis behaviour
(
it
an and Adams,
2000
). Gammie and Truman
(1999
) proposed that ETH action
on the brain ventro-medial (VM) cells causes the central release of EH from
axons running through the entire ventral nerve cord, thereby eliciting cGMP
elevation in neurons 27/704. To determine if cGMP synthesis in the B.
mori CNS requires the central release of EH, we injected intact pharate
larvae or isolated abdomens with ETH (100 pmol) and observed the initiation of
ecdysis behaviour. Within 10-15 min of the onset of ecdysis movements, the CNS
and hindgut were dissected and stained with antisera to EH and cGMP. Reaction
of these antisera in ETH-injected pharate larvae or isolated abdomens was
compared with that in control pharate or freshly ecdysed animals.
All control pharate larvae 10-12 h prior to ecdysis showed strong
EH-immunoreactivity (EH-IR) in four VM cell bodies, their axons and numerous
dendritic arborizations in the posterio-medial and ventro-lateral regions of
the brain (N=12; Fig.
12A). Four strongly stained non-branching axons of VM cells were
observed along the middorsal line of all ventral ganglia, their connectives
and proctodeal nerves (Fig.
12B-E). These axons contained numerous immunoreactive varicosities
in proctodeal nerves on lateral sides of the hindgut surface and in branching
terminals at the hindgut-midgut boundary
(Fig. 12E), which was
identified as the neurohaemal release site for EH
(Truman and Copenhaver,
1989
).
|
Fig. 12FN shows
EH-IR in normal freshly ecdysed larvae or in ETH-injected intact and ligated
pharate larvae 10-15 min after the onset of ecdysis behaviour. Natural or
ETH-induced ecdysis behaviour of intact pharate larvae was, in all cases
(N=18), associated with depletion of EH-IR in ventral ganglia and
proctodeal nerves (Fig. 12J).
To determine whether EH is centrally released during ETH-induced ecdysis
behaviour, pharate larvae were ligated between segments A5 and A6, and
posterior segments A6-8, containing ganglia AG6 and TAG, plus the hindgut with
neurohaemal proctodeal nerves were cut off. The anterior part of these larvae,
containing the brain, suboesophageal ganglion (SG), thoracic ganglia 1-3
(TG1-3) and AG1-5, was then injected with ETH (100 pmol), which induced
ecdysis contractions in 30-40 min. Staining with the antiserum to EH 10-15 min
after the initiation of ecdysis behaviour revealed a strong reaction in the VM
cell bodies and arborizing axons in the brain
(Fig. 12F), but considerable
reduction or depletion of EH-IR was observed in axons running through all
ventral ganglia (Fig. 12G,H)
and their connectives (N=9). The only exception was the accumulation
of EH-IR in the connectives between AG5 and AG6, just anterior to the ligation
site (Fig. 12I). As the only
peripheral release sites for EH (proctodeal nerves) were removed, depletion of
EH-IR suggests its central release within the ventral ganglia at ecdysis as
described in pahrate pupae of M. sexta
(Hewes and Truman, 1991
).
ETH injection into isolated abdomens of pharate larvae induces strong ecdysis behaviour in the absence of VM cell bodies as described above. Interestingly, strong EH-IR was detected in axons of all abdominal ganglia and their connectives, as well as in the terminal and proctodeal nerves even 10-15 min after the initiation of ecdysis movements (N=12; Fig. 12KN). This strong staining was indistinguishable from EH-IR in the CNS of control pharate larvae 10-12 h before expected ecdysis (Fig. 12BE), suggesting that ecdysis behaviour in isolated abdomens is not accompanied by EH release.
In freshly ecdysed animals (N=9) or ETH-injected pharate larvae (N=9), ecdysis behaviour is always associated with cGMP elevation in neurons 27/704 of the SG, TG1-3 and AG1-7 (Fig. 13A-D). However, only a few abdominal ganglia showed strong cGMP staining in both cell types (Fig. 13C); in most cases, cGMP elevation was restricted to the neurosecretory cell 27 (Fig. 13D). ETH-induced ecdysis behaviour in isolated abdomens of pharate larvae (N=10) is associated with a cGMP response in abdominal ganglia (Fig. 12EH) that is very similar to that of intact animals. These data provide further evidence that, in isolated abdomens, ETH induces ecdysis behaviour and cGMP elevation without detectable release of EH.
|
| Discussion |
|---|
|
|
|---|
it
anová et al.,
2001
it
anová et al.,
2001
Inka cells are clearly endocrine in nature, producing peptide hormones that
control the ecdysis behavioural sequence, but functions for the smaller cells
are yet to be determined. At present, we speculate that the exocrine cell
releases its contents through the canal cell into the lumen between old and
new trachei. This secretion may aid in shedding the old trachei and/or coating
the new epicuticle during larval and pupal ecdysis in a similar manner to
secretory products from Verson's glands
(Lane et al., 1986
;
Horwath and Riddiford,
1988
).
Structural and functional similarity of ETH-related peptides and
genes
B. mori PETH, ETH and ETH-AP are identical or similar to peptides
produced by M. sexta Inka cells. The organization of the cDNA
precursors encoding these peptides is also very similar in each species
(
it
an et al.,
1999
). ETH1 and ETH2, derived from the D. melanogaster
eth gene, show apparent homology with their lepidopteran counterparts at
the carboxyl termini, and putative processing sites downstream of ETH1 and
ETH2 indicate that additional peptide(s) analogous to moth ETH-AP may be
processed from the D. melanogaster eth gene
(Park et al., 1999
).
Physiological studies have shown that PETH and ETH elicit pre-ecdysis and
ecdysis in different animals. For example, B. mori and M.
sexta ETHs are equally effective in inducing ecdysis in these related
species. Also, D. melanogaster ETH induces pre-ecdysis in M.
sexta (Park et al., 1999
)
and the entire behavioural sequence in B. mori (D.
it
an, unpublished data). Conversely, M. sexta ETH
elicits the eclosion behavioural sequence in adult D. melanogaster
(McNabb et al., 1997
;
Park et al., 1999
). These data
suggest that Inka cell peptide hormones are capable of binding to specific
receptors in the CNS of different insects, which activates neuronal networks
for the ecdysis sequence.
Comparison of ecdysis behavioural sequences in moths and D.
melanogaster
In the present study, we have shown that behavioural sequences during
larval and pupal ecdysis and adult eclosion of B. mori are pronounced
and well defined. Pre-ecdysis behaviours have not been described in other
silkmoths, but the eclosion behavioural sequence in pharate adults of the
silkmoth Hyalophora cecropia
(Truman and Sokolove, 1972
) is
very similar to that in B. mori. On the other hand, M. sexta
shows strong pre-ecdysis behaviours only in pharate larvae, while pre-ecdysis
of pharate pupae is limited to weak rhythmic movements and pre-eclosion of
pharate adults is reduced to a few abdominal rotations, which could be absent
in some individuals. However, ecdysis or eclosion peristaltic movements, which
are necessary to escape from the old cuticle, are strong and well defined in
all stages in M. sexta
(
it
an et al.,
1996
).
Behavioural patterns during larval ecdysis and adult eclosion of D.
melanogaster are quite complex (Park et al.,
1999
,
2002
) but show some
resemblance to those observed in B. mori. For example, pre-ecdysis
behaviours of D. melanogaster larvae consist of anterio-posterior and
rolling contractions, followed by ecdysis movements
(Park et al., 2002
). Likewise,
the eclosion behaviour of D. melanogaster pharate adults resembles
that of silkmoths, being composed of an active pre-eclosion phase (head
inflation, dorso-ventral contractions of the first abdominal tergum, tracheal
filling and ptilinum extension), a quiescent phase, and an eclosion behaviour
consisting of various contractions of the head and thorax, followed by
peristaltic movements of the abdomen
(McNabb et al., 1997
;
Park et al., 1999
).
Injection of PETH into B. mori pharate larvae a few hours after
head slip (-20 h to -24 h) elicits only pre-ecdysis I, whereas ETH induces
pre-ecdysis I, pre-ecdysis II and ecdysis behaviours as observed in M.
sexta pharate larvae
(
it
an et al.,
1999
). However, injection of either PETH or ETH into B.
mori larvae at -10 h to -12 h induces the entire behavioural sequence,
which indicates that sensitivity of the CNS to these peptides increases as
animals approach the time for natural ecdysis. Likewise, injection of PETH or
ETH alone induces the entire behavioural sequence in pharate pupae and adults.
Although ETH is more effective in inducing ecdysis behaviour in all stages
tested, our data suggest that both PETH and ETH activate the complete
pre-ecdysis and ecdysis circuitry during natural behaviour. This is similar to
D. melanogaster, where ETH1 is more effective and elicits more
complex behaviours than ETH2, but both peptides induce larval ecdysis and
adult eclosion (Park et al.,
1999
,
2002
).
Several studies have shown that M. sexta requires the TAG for
synchronized dorso-ventral contractions during pre-ecdysis I
(Novicki and Weeks, 1996
;
it
an and Adams,
2000
). These synchronized rhythmic contractions are controlled by
a single pair of interneurons 402 in the posterior region of the TAG
(Novicki and Weeks, 1995
). By
contrast, B. mori pre-ecdysis I is not synchronized, and our ligation
and transection experiments in vivo and in vitro show that
the TAG is not necessary for generation of this motor pattern. Therefore,
interneurones 402 are either missing in B. mori or are not activated
during pre-ecdysis I. Likewise, asynchronous pre-ecdysis II contractions have
no fixed phase relationships and do not seem to require connection to distal
ganglia. Each abdominal ganglion of M. sexta also contains entire
circuitry for pre-ecdysis II
(
it
an and Adams,
2000
), but these contractions are more synchronized than in B.
mori.
Ecdysis activation of B. mori and M. sexta is also
different. In M. sexta larvae, activation of the ecdysis motor
program by ETH requires connection of the ventral nerve cord to the brain or
SG (Novicki and Weeks, 1996
;
it
an and Adams,
2000
), but isolated abdomens of B. mori pharate larvae
and pupae show normal ecdysis behaviour. Likewise, ETH induces normal ecdysis
bursts in the isolated abdominal ganglia in vitro without connections
to the cephalic ganglia. These data indicate that, in B. mori, all
behavioural phases can be activated by the action of PETH and ETH on abdominal
ganglia and do not require the brain, SG or TG1-3. Therefore, abdominal
ganglia of pharate larvae and pharate pupae probably contain receptors for
both Inka cell peptides and central pattern generators for all pre-ecdysis and
ecdysis behaviours. However, activation of eclosion behaviour in pharate
adults apparently requires the brain. This suggests that some aspects of
ecdysis and eclosion activation in B. mori are different.
Activation of ecdysis circuits is associated with cGMP elevation in a
conserved network of neurons in the CNS of many insects
(Ewer and Truman, 1996
). This
network produces crustacean cardioactive peptide (CCAP), which controls
performance of the ecdysis motor program
(Gammie and Truman, 1997
). In
M. sexta larvae, ETH from the Inka cells and EH produced by the brain
VM neurons seem to be involved in activation of this network
(Gammie and Truman, 1999
;
it
an and Adams,
2000
). However, our experiments in vitro using isolated
larval CNS of M. sexta have shown that ETH action on the debrained
nerve cord lacking VM cell bodies leads to normal cGMP elevation and ecdysis
bursts similar to those observed in the control intact CNS. Moreover, EH
action on the desheathed SG and TG1-3 causes cGMP elevation in all intact
(non-desheathed) abdominal ganglia, and, conversely, EH treatment of the
desheathed abdominal ganglia results in increased cGMP production in the SG
and TG1-3 (
it
an and Adams,
2000
). These data indicate that EH-induced activation of the cGMP
network in M. sexta is not direct and requires an additional
factor(s). In the present study, we show that in B. mori isolated
abdomens, ETH induces ecdysis behaviour and cGMP elevation in abdominal
ganglia without a detectable release of EH. These results provide more
evidence that ETH may act on additional neuronal targets, which activate the
cGMP/CCAP network and ecdysis motor program in the absence of EH. These
hypothetical target neurons and factors remain to be identified.
In this paper, we have shown that Inka cells release peptide hormones
derived from the same precursor at larval, pupal and adult ecdysis of B.
mori. These peptides are identical or similar to Inka cell hormones
isolated from the related species M. sexta. However, there are
important differences in activation and performance of the ecdysis behavioural
sequence in both species. Therefore, all developmental stages of B.
mori described here represent very suitable experimental model systems
for identification of mechanisms involved in the activation of behavioural
motor programs required for ecdysis. Some aspects of ecdysis regulation are
obviously conserved, and, therefore, results obtained in B. mori
should be applicable to other animals and complement M. sexta, D.
melanogaster and crustacean models
(Ewer et al., 1997
;
it
an et al.,
1999
; Baker et al.,
1999
; Chung et al.,
1999
; Phillipen et al.,
2000
).
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Adams, M. E. and
it
an, D.
(1997). Identification of ecdysis-triggering hormone in the
silkworm Bombyx mori. Biochem. Biophys. Res. Commun.
230,188
-191.[Medline]
Akai, H. (1992). Ultrastructure of epitracheal gland during larval-pupal molt of Bombyx mori.Cytologia 57,195 -201.
Baker, J. D., McNabb S. L. and Truman J. W. (1999). The hormonal coordination of behaviour and physiology at adult ecdysis in Drosophila melanogaster. J. Exp. Biol. 202,3037 -3048.[Abstract]
Chung, J. S., Dircksen, H. and Webster, S. G.
(1999). A remarkable, precisely timed release of hyperglycemic
hormone from endocrine cells in the gut is associated with ecdysis in the crab
Carcinus maenas. Proc. Natl. Acad. Sci. USA
96,13103
-13107.
Ewer, J. and Truman, J. W. (1996). Increases in cyclic 3',5'-guanosine monophosphate (cGMP) occur at ecdysis in an evolutionarily conserved crustacean cardioactive peptide-immunoreactive insect neuronal network. J. Comp. Neurol. 370,330 -341.[Medline]
Ewer, J., Gammie, S. C. and Truman, J. W. (1997). Control of insect ecdysis by a positive-feedback endocrine system: roles of eclosion hormone and ecdysis triggering hormone. J. Exp. Biol. 200,869 -881.[Abstract]
Ewer, J. and Truman, J. W. (1997). Invariant association of ecdysis with increases in cyclic 3',5'-guanosine monophosphate immunoreactivity in a small network of peptidergic neurons in the hornworm, Manduca sexta. J. Comp. Physiol. A 181,319 -330.[Medline]
Gammie, S. C. and Truman, J. W. (1997).
Neuropeptide hierarchies and the activation of sequential motor behaviors in
the hawkmoth, Manduca sexta. J. Neurosci.
17,4389
-4397.
Gammie, S. C. and Truman, J. W. (1999). Eclosion hormone provides a link between ecdysis-triggering hormone and crustacean cardioactive peptide in the neuroendocrine cascade that controls ecdysis behavior. J. Exp. Biol. 202,343 -352.[Abstract]
Hewes, R. S. and Truman, J. W. (1991). The roles of central and peripheral eclosion hormone release in the control of ecdysis behavior in Manduca sexta. J. Comp. Physiol. A 168,697 -707.[Medline]
Horwath, K. L. and Riddiford, L. M. (1988). Stage and segment specificity of the secretory cell of the dermal glands of the tobacco hornworm, Manduca sexta. Dev. Biol. 130,365 -373.[Medline]
Ikeda, E. (1913). Kimon Rimensen. In Experimental Anatomy and Physiology of Bombyx mori (ed. E. Ikeda), pp. 242-243. Tokyo, Japan: Meibundo.
Jan, L. Y. and Jan, Y. N. (1982). Antibodies to
horseradish peroxidase as specific neuronal markers in Drosophila and
in grasshopper embryos. Proc. Natl. Acad. Sci. USA
79,2700
-2704.
Kingan, T. G. and Adams, M. E. (2000). Ecdysteroids regulate secretory competence in Inka cells. J. Exp. Biol. 203,3011 -3018.[Abstract]
Kingan, T. G., Gray, W.,
it
an, D. and Adams, M.
E. (1997). Regulation of ecdysis triggering hormone release
by eclosion hormone. J. Exp. Biol.
200,3245
-3256.[Abstract]
Klein, C., Kallenborn, H. G. and Radlicki, C. (1999). The Inka cell and its associated cells: ultrastructure of the epitracheal glands in the gypsy moth, Lymantria dispar. J. Insect Physiol. 45,65 -73.[Medline]
Lane, S., Riddiford, L. M., Truman, J. W. and Conitz, J. (1986). Development of the prepupal Verson's gland of the tobacco hornworm, Manduca sexta, and its hormonal control. J. Exp. Zool. 240,83 -94.[Medline]
McNabb, S. L., Baker, J. D., Agapite, J., Steller, H., Riddiford, L. M. and Truman, J. W. (1997). Disruption of a behavioral sequence by targeted death of peptidergic neurons in Drosophila. Neuron 19,813 -823.[Medline]
Novicki, A. and Weeks, J. C. (1995). A single pair of interneurons controls motor neuron activity during pre-ecdysis compression behavior in larval Manduca sexta. J. Comp. Physiol. A 176,45 -54.[Medline]
Novicki, A. and Weeks, J. C. (1996). The initiation of pre-ecdysis and ecdysis behaviors in larval Manduca sexta: the roles of the brain, terminal ganglion and eclosion hormone. J. Exp. Biol. 199,1757 -1769.[Abstract]
Park, Y.,
it
an, D., Gill, S. and Adams, M.
E. (1999). Molecular cloning and biological activity of
ecdysis-triggering hormones in Drosophila melanogaster. FEBS
Lett. 463,133
-138.[Medline]
Park, Y., Filipov, V., Gill, S. S. and Adams, M. E.
(2002). Deletion of the ecdysis-triggering hormone leads to
lethal ecdysis deficiency. Development
129,493
-503.
Phillipen, M. K., Webster, S. G., Chung, J. S. and Dircksen, H. (2000). Ecdysis of decapod crustaceans is associated with a dramatic release of crustacean cardioactive peptide into the haemolymph. J. Exp. Biol. 203,521 -536.[Abstract]
Truman, J. W. and Sokolove, P. G. (1972). Silkmoth eclosion: hormonal triggering of a centrally programmed pattern of behaviour. Science 175,1490 -1493.
Truman, J. W. and Copenhaver, P. F. (1989). The
larval eclosion hormone neurones in Manduca sexta: identification of
the brainproctodeal neurosecretory system. J. Exp.
Biol. 147,457
-470.
it
an, D., Kingan, T. G., Hermesman, J. and
Adams, M. E. (1996). Identification of ecdysis-triggering
hormone from an epitracheal endocrine system. Science
271, 88-91.[Abstract]
it
an, D., Kingan, T. G., Kramer, S. J. and
Beckage, N. E. (1995). Accumulation of neuropeptides in the
cerebral neurosecretory system of Manduca sexta larvae parasitized by
the braconid wasp Cotesia congregata. J. Comp. Neurol.
356,83
-100.[Medline]
it
an, D., Ross, L. S.,
it
anová, I., Hermesman, J. L., Gill, S. S. and Adams,
M. E. (1999). Steroid induction of a peptide hormone gene
leads to orchestration of a defined behavioral sequence.
Neuron 23,523
-535.[Medline]
it
an, D. and Adams, M. E.
(2000). Excitatory and inhibitory roles of central ganglia in the
initiation of the insect ecdysis behavioural sequence. J. Exp.
Biol. 203,1329
-1340.[Abstract]
it
anová, I., Adams, M. E. and
it
an, D. (2001). Dual ecdysteroid action on
epitracheal glands and the central nervous system preceding ecdysis of
Manduca sexta. J. Exp. Biol.
204,3483
-3495.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
Y.-J. Kim, D. Zitnan, K.-H. Cho, D. A. Schooley, A. Mizoguchi, and M. E. Adams Central peptidergic ensembles associated with organization of an innate behavior PNAS, September 19, 2006; 103(38): 14211 - 14216. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Zitnan, I. Zitnanova, I. Spalovska, P. Takac, Y. Park, and M. E. Adams Conservation of ecdysis-triggering hormone signalling in insects J. Exp. Biol., April 15, 2003; 206(8): 1275 - 1289. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||