|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
The superfast extraocular myosin (MYH13) is localized to the innervation zone in both the global and orbital layers of rabbit extraocular muscle
Department of Cell Biology, Duke University Medical Center, Durham, NC 27710, USA
* Author for correspondence (e-mail: m.briggs{at}cellbio.duke.edu)
Accepted 12 July 2002
| Summary |
|---|
|
|
|---|
Key words: myosin, extraocular, EOM, muscle, neuromuscular junction, innervation, rabbit
| Introduction |
|---|
|
|
|---|
In trunk and limb skeletal muscles, distinct fiber types expressing
different myosins are recruited for fast and slow muscular activity. A similar
division of labor does not occur in extraocular muscles, because several
extraocular fiber types can be members of a single motor unit
(Gurahian and Goldberg, 1987
;
Shall and Goldberg, 1995
), and
motor units are recuited on the basis of the amount of work required rather
than the type of movement they execute
(Dean, 1996
;
Scott and Collins, 1973
;
Shall and Goldberg, 1992
).
The specialized physiology of EOM fibers is at least partly determined by
the array of myosin isoforms and the complex pattern of differential myosin
expression in EOM (Brueckner et al.,
1996
; Jacoby et al.,
1990
; Rushbrook et al.,
1994
; Wieczorek et al.,
1985
). In addition to all the isoforms present in skeletal and
cardiac muscles, EOM express a specialized myosin heavy chain, first
identified by Wieczorek et al.
(1985
). The `extraocular
myosin' or MyHC-EO isoform is also expressed in the superfast laryngeal
muscles, and was termed myosin IIL (Briggs
and Schachat, 2000
; DelGaudio
et al., 1995
; Lucas et al.,
1995
; Merati et al.,
1996
). This gene was mapped to the cluster of six fast and
developmental myosin heavy chain genes on chromosome 17
(Weiss et al., 1999
;
Winters et al., 1998
) and
given the genomic designation MYH13. We propose using the designation
MYH13 to simplify the nomenclature and avoid the implication of
muscle-specificity. In addition, this usage is more consistent with its
phylogenetic relationship to the other striated myosin genes
(Briggs and Schachat, 2000
;
Schachat and Briggs,
2002
).
MYH13 cDNA sequences are highly conserved across species
(Briggs and Schachat, 2000
),
but the sequence and gene structure of MYH13 differs radically from
other members of the fast/developmental cluster of MYH genes,
suggesting a considerable period of genomic insulation from the other
MYH genes (Schachat and Briggs,
2002
). In addition, analysis of their phylogenetic relationships
showed that MYH13 was the first specialized myosin to arise in the
fast/developmental cluster after the divergence of the ancestral skeletal and
cardiac myosins (Schachat and Briggs,
2002
). That observation, coupled with the limited tissue-specific
expression of MYH13 in two extraordinarily fast contracting muscles, suggests
that it has evolved to fulfill a highly specialized function.
MYH13 is thought to play a role in the high velocity saccadic contractions
observed in whole EOM. The contractile properties of individual EOM fibers
were compared by measuring the fmin (frequency at which
the dynamic stiffness of a muscle fiber is at a minimum) values, which reflect
the rate of cross-bridge cycling. Li et al.
(2000
) showed that some EOM
fibers exhibit higher values of fmin than any observed in
limb muscles, which express only the fast isoforms of MyHC, IIb, IIx and IIa.
Although the myosin composition of fibers was not analyzed in that study,
their observations suggest that MYH13 contributes to these faster contractile
properties. However, MHY13 makes up only 20-30% of the total myosin in rabbit
EOM (Briggs and Schachat,
2000
), and it is difficult to understand how MYH13 could dominate
certain aspects of contraction in EOM unless it is highly enriched in a
limited region of the muscle that could be differentially activated.
Longitudinal variation in the expression of fast, embryonic and slow MyHCs
has been reported in EOMs (Brueckner et
al., 1996
; Jacoby et al.,
1990
; Kranjc et al.,
2000
; McLoon et al.,
1999
; Rubinstein and Hoh,
2000
; Wasicky et al.,
2000
), with fast-reactive isoforms more prominent in the central
region and developmental isoforms more abundant towards the ends of the
muscle. MYH13 has been localized to the orbital layer fibers in the rat
(Brueckner et al., 1996
), and
more specifically to a relatively broad region spanning the band of motor
endplates in the orbital layer (Rubinstein
and Hoh, 2000
). Other studies with MYH13-specific antibodies and
in situ hybridization have produced a spectrum of results for its
distribution in the orbital and/or the underlying global layer of muscle
fibers (Brueckner et al., 1996
;
Lucas et al., 1995
;
Sartore et al., 1987
). These
differences in distribution may reflect the use of different probes, analysis
of different regions of the muscle or species-specific differences. If it is
the latter, it may provide important insights into the use or recruitment of
fibers in different layers. Such differences may be particularly important in
light of the active pulley hypothesis proposed by Demer and colleagues, which
proposes that global and orbital fibers have distinctive roles in ocular
motility (Demer, 2002
;
Demer et al., 1995
;
Khanna and Porter, 2001
).
Global fibers act directly on the globe to move the eye, whereas orbital layer
fibers insert on a sheath of connective tissue that acts as a pulley to
control the plane of rotation of the eye. Defining the distribution of MYH13
in these layers will have major implications in determining its potential
roles in EOM function.
Here we have used a combination of techniques, including antibodies and SDS-PAGE, providing an independent approach to localizing myosin expression that does not depend on probe specificity, to provide the first quantitative data on the distribution of MYH13 and the other myosin isoforms in different regions of rabbit EOM. This information provides a new basis for assessing the role of MYH13 in the contractile properties of these unique muscles.
| Materials and methods |
|---|
|
|
|---|
Preparation of RNA and reverse transcription-polymerase chain
reaction
RNA was prepared as described previously
(Chomczynski and Sacchi, 1987
)
from three regions of the EOM: the central region containing the orbital
layer's endplate band, and the distal and far distal regions spanning
approximately 4 mm each. These boundaries do not correspond exactly to those
used for protein analysis, but the data obtained is completely consistent.
Semiquantitative reverse transcription-polymerase chain reaction (RT-PCR) was
performed with the Titan One-Tube kit (Roche Molecular Biochemicals), using
only 28 cycles of PCR to ensure that the amplification remained in the linear
range. Equal amounts of RNA (20 ng) were used. Primers were
GGTCCTCCTCAGCCTGGTACGTCAT and AGAAGGCCAARAARGCCAT, which generated a 320 bp
product specific for MYH13.
Preparation of antibodies
Antibodies specific for MYH13 were prepared in chickens (Cocalico, Inc.)
using bacterially expressed peptides. Peptides corresponding to the distal
C-terminal end of the myosin rod (EO-1, amino acids 1827-1938) and the hinge
region (EO-2, amino acids 1210-1382) were selected because they exhibit high
antigenic indices and the greatest sequence divergence with other myosin
isoforms. The cDNA sequences encoding these peptides were amplified from
rabbit MYH13 clones (GenBank accession no. AF212147;
Briggs and Schachat, 2000
) with
PCR primers that introduced the restriction sites NdeI (underlined)
or BamHI (lower case). Primers for EO-1 were
GGAATTCCATATGGTACGTGAGCTGGAAAC and GCTCCTCTCTCCTGCAGGTGT and for
EO-2, GAATTCCATATGCTCGGGGAGCAGATTG and GggatccTATTTGGTCCTCCACT. PCR
was performed for 28 cycles of 94°C for 1 min; 58°C for 1 min;
72°C for 1 min. The PCR products were digested with NdeI and
SacI, which cleaved at an internal site of EO-1 or with NdeI
and BamHI (EO-2). They were then directionally cloned into the pET17
vector, and the accuracy of the nucleotide sequence was confirmed. The
plasmids were transformed into BLR (DE3) bacteria, and protein expression was
induced with 0.2 mmol l-1 isopropylthio-ß-D-galactoside
(IPTG). Bacterial lysis and removal of contaminating proteins by incubation at
100°C was performed essentially as described
(McNally et al., 1991
). EO-1
was purified by anion-exchange chromatography and preparative SDS-PAGE. EO-2
was purified by hydroxyapatite and anion-exchange chromatography. Antisera
were tested by ELISA and western blotting to identify maximal production of
specific antibodies. Immunoglobulins were then purified from egg yolks
(Akita and Nakai, 1993
), and
adsorbed against immobilized fast (IIa, IIb, IIx) and slow myosins to enhance
specificity.
Immunohistochemical analysis
Muscle samples were infiltrated with PBS (10 mmol l-1 sodium
phosphate, 150 mmol l-1 NaCl, pH 7.4)/30% sucrose, embedded, and
frozen in liquid nitrogen. Sections (5 µm thick) were cut and frozen until
use. Staining was performed according to the manufacturer's instructions using
the Vector ABC kit. Sections were blocked with 2% normal goat serum in PBS,
and incubations were performed for 30-60 min, followed by 3x 10 min
washes with PBS. The primary antibody, adsorbed EO-1, was diluted 1:100 (v:v).
The secondary antibody was biotinylated anti-chicken IgG, and the antibody
reaction was visualized with horseradish peroxidase and diamino benzidine
(DAB) as substrate. For localization of neuromuscular junctions, slides were
blocked as above and incubated with Alexa 488-alpha-bungarotoxin (10 µg
ml-1) for 60 min, followed by 3x20 min washes with PBS.
Slides were examined using a Zeiss Axioplan 2 microscope with visible light
and fluorescein filters.
| Results |
|---|
|
|
|---|
|
Additional isoforms, including alpha cardiac, slow tonic and perinatal have
been reported in EOM. With this type of gel, alpha and beta cardiac isoforms
comigrate, and the amount of slow/tonic is too low to be detected. The
perinatal isoform is not well resolved with the conditions optimized to
resolve IIb and MYH13, but it was analyzed using different conditions (see
Materials and methods), in which both perinatal and embryonic isoforms migrate
in the more typical positions above IIa
(d'Albis et al., 1989
;
Janmot and d'Albis, 1994
).
Under those conditions perinatal myosin was not detected in the samples shown
in Fig. 1 (not shown). Trace
amounts were, however, detected in other EOMs, indicating variable expression
at levels less than 1% of the total myosin in rabbit EOM.
These observations demonstrate that EOM fibers express a complex and
varying complement of the fast MyHCs. In addition to the longitudinal
variation in MYH13 expression, MyHC-IIx levels are higher at the proximal
range of MYH13 expression, but the ratio of MyHC-IIb to MYH13 is higher distal
to the endplate region, indicating that they are regulated differently from
MYH13 (Fig. 1Ci). Although the
individual regulatory mechanisms of the isoforms remain to be defined, the
amplification of MYH13 in the endplate region band supports the observations
that innervation plays a critical role in regulating MYH13 expression
(Brueckner and Porter, 1998
;
Kranjc et al., 2001
).
MYH13 mRNA is also localized to the central region of EOM
For independent confirmation that MYH13 varies along the length of EOM, we
examined the mRNA levels for MYH13 as a function of position along the muscle.
Specific primers were developed from the distinctive 3' region of the
rabbit cDNA sequence (Briggs and Schachat,
2000
) and used in semiquantitative RT-PCR of RNA prepared from
different sections of the muscle (Fig.
2). Similar to the results obtained by protein analysis, the
resulting 320 bp product obtained from MYH13 mRNA was abundant in the central
region containing the endplate band, but greatly diminished in the distal and
far distal regions of the muscle.
|
Production of two antibodies specific for MYH13
Antibodies against MYH13 were generated to determine the distribution of
MYH13 among the different fiber types in EOM. Comparison of MyHC sequences
identified two highly divergent regions of MYH13 (EO-1, amino acids 1827-1938,
and EO-2, amino acids 1210-1382). Peptides containing those regions were
bacterially expressed and used to produce antibodies in chickens. After
preadsorption with skeletal myosins, these antibodies both specifically
recognized MYH13 on western blots (Fig.
3). Their specificity provides the first direct evidence that the
distinct myosin heavy chain resolved by SDS-PAGE in EOM is the product of the
MYH13 gene.
|
MYH13 is expressed in both the orbital and global layers of rabbit
EOM
The specificity of EO-1 for MYH13 in situ was established in
frozen muscle sections (Fig.
4A). It does not crossreact with the IIb isoform present in
adductor magnus, ß/I in semitendinosus, the IIa, IIx, ß/I and
`
-like' isoforms in diaphragm
(Hamalainen and Pette, 1997
),
or with the embryonic or perinatal isoforms present in fetal muscles
(gestational day 27).
|
Transverse sections of EOM reveal two distinct layers, a superficial
orbital layer, and the underlying global layer, which are distinguished by the
smaller diameter fibers and the lower number fibers per fascicle present in
the orbital layer. When EO-1 is used to stain slides from the central region
of EOM, nearly all fibers in the orbital surface layer are labeled
(Fig. 4B). Many fast global
fibers also express MYH13, but their staining intensity is heterogeneous and
somewhat less intense than in the orbital layer. The negative fibers in the
global region are labeled by antibodies against slow/cardiac or IIa myosin
isoforms. Previous studies have shown that the slow-reactive fibers in the
global layer also express the
-cardiac and slow/tonic isoforms
(Pierobon-Bormioli et al.,
1979
; Rushbrook et al.,
1994
), and the absence of reaction with those fibers here confirms
that EO-1 recognizes only MYH13. Thus, similar to findings in several other
species (Sartore et al.,
1987
), MYH13 is expressed in both orbital and global layers of
rabbit EOM, and may play a key role in the function of fibers in both
layers.
Localization of the innervation zone
In the orbital layer, the motor endplates of the singly innervated fibers
(SIFs) are arranged in a relatively narrow region in the proximal half of the
muscle (Chiarandini and Davidowitz,
1979
). Approximately 10% of the fibers in EOM are multiply
innervated fibers (MIFs), and some of them have similar en plaque
neuromuscular junctions in that region, as well as multiple sites of en
grappe innervation elsewhere in the muscle
(Jacoby et al., 1989
). To
confirm that the central region of the muscles analyzed by SDS-PAGE, RT-PCR
and immunohistochemistry above (Figs
1,
2 and
4) contained the zone of
innervation, we labeled semiserial sections with EO-1 and fluorescently
labeled alpha-bungarotoxin (Fig.
5). As in Fig. 4,
many of the fibers in this region contain MYH13
(Fig. 5A). In addition,
numerous endplates containing the labeled acetylcholine receptors are present
across the orbital layer (Fig.
5B), confirming the location of the endplate band. Many fibers in
the global layer also contain endplates, but they are not as evenly
distributed. That observation is consistent with the broader range of endplate
distribution along the length of the muscle reported for global fibers
(Davidowitz et al., 1996
).
These observations confirm that the highest levels of MYH13 expression span
the endplate band.
|
In the distal portion of the muscle, expression of MYH13 terminates
in orbital fibers but continues in some global fibers
To further define the distribution of MYH13 relative to the innervation
zone, frozen muscle sections from the endplate band and more distal regions
were stained with EO-1. Fig. 6A
shows a section within the endplate band, where MYH13 is expressed in both
orbital and global layers. In the distal region of the muscle, MYH13 is still
abundant in global fibers, when many orbital fibers are negative
(Fig. 6B). More distally, where
orbital fibers are negative, MYH13 persists at low to moderate levels in some
fibers of the global region (Fig.
6C).
|
SDS-PAGE confirms that MYH13 is expressed in the global layer
To isolate a sample containing only global-layer fibers, the inner global
layer (light gray) was dissected along connective tissue boundaries from a 120
µm frozen section (Fig. 7A).
The remaining portion (dark gray) contained the outer (or intermediate) global
layer and the orbital surface layer. Analysis by SDS-PAGE
(Fig. 7B) shows that MYH13 (EO)
is abundant in both layers. Myosin heterogeneity in this narrow section is
just as complex as in the 2-3 mm sections analyzed in
Fig. 1, indicating that the
overall myosin composition changes relatively gradually across the length of
the muscle.
|
MYH13 is coexpressed with other myosin isoforms in individual global
fibers
One potential explanation of the staining heterogeneity of global fibers
(Fig. 4) is that other isoforms
are also expressed in those fibers. This idea was tested by SDS-PAGE analysis
of individual fibers dissected from the global region
(Fig. 8). No `pure' fibers
containing only MYH13 were observed. Most of the fibers form what appears to
be a continuum of MYH13 expression with other fast myosin isoforms,
particularly IIb, the myosin isoform associated with the fastest-contracting
fibers in skeletal muscles. MYH13 is less abundant in fibers expressing IIa
and/or IIx. A few fibers express only IIa myosin and probably correspond to
red singly innervated fibers (Spencer and
Porter, 1988
). It thus appears that multiple myosin isoforms are
expressed in most fibers in the rabbit global layer.
|
These quantitative molecular studies provide a critical complement to immunolocalization because they provide a means of assessing the relative contributions that each myosin isoform can make to the complex function of EOM. The differential expression of MYH13 in the innervation region of EOMs may allow it to make a critical contribution to the contractile features of saccades.
| Discussion |
|---|
|
|
|---|
The presence of MYH13 and IIb myosin in a majority of the fibers spanning
the innervation zone offers a potential explanation for a puzzling aspect of
EOM physiology: how the many diverse fiber types of EOM can all participate in
the fastest contractile movements of EOM
(Scott and Collins, 1973
;
Shall and Goldberg, 1992
). If
the roles and recruitment order of motor units in EOM were like those of limb
and epaxial muscles, then each extraocular motor unit would be composed of
fibers expressing a single myosin, and it would be differentially recruited
for specific subsets of fast or slow ocular movements. However, this simple
relationship between myosin expression, motor units and function does not
occur in EOM: virtually all EOM motor units despite differences in
morphology and innervation can participate in saccades, tracking and
vergence movements, and recruitment depends on the amount of work required
rather than on the speed of the movement
(Scott and Collins, 1973
).
Moreover, the first motor units recruited in saccades may comprise specialized
`bilayer' motor units that activate both orbital and global layer fibers
(Shall and Goldberg, 1995
).
These observations could be reconciled with the heterogeneity of myosin
isoforms in most EOM fibers if a majority of fibers express kinetically fast
myosin over a narrow region, allowing that region to respond uniformly,
despite expression of kinetically slower isoforms in other regions. The fast
kinetics of MYH13, inferred from its expression in the extremely
fast-contracting laryngeal muscles as well as the higher rate of cross-bridge
cycling observed in EOM fibers (Li et al.,
2000
), suggests that the presence of MYH13 in the majority of both
orbital and global fibers within the innervation zone may allow diverse EOM
fibers to participate in the extremely fast saccades.
If the role of MYH13 in saccades depends on its rapid cycling time and the
majority of fibers can participate in saccades, it is surprising that less
than 35% of the total myosin is composed of MYH13. In other skeletal muscles,
a fast myosin must comprise at least 80% of the total myosin to dominate
contractile kinetics of individual fibers
(Cuda et al., 1997
;
Reiser et al., 1985
). In the
central innervation region, MYH13 and IIb myosin together reach such high
levels (Figs 1,
8), but it is also possible
that in a more localized region, about the neuromuscular junction, MYH13 alone
may reach these levels.
Several functional mechanisms based on this localized concentration of
MYH13 can be envisaged. The absence of MYH13 in rat global fibers, which are
activated in driving saccades, led Rubinstein and Hoh
(2000
) to propose an indirect
role for MYH13 to enable saccades by increasing the rate of relaxation, thus
reducing the tension in the orbital layer opposing the saccade. Thus, for a
lateral saccade, the rapid cycling kinetics of MYH13 in the central region of
the medial rectus orbital fibers would enable that region to relax rapidly,
thereby reducing the tension opposing the contraction of the lateral rectus
muscle when it initiates a saccade. By contrast, the presence of MYH13 in
global as well as orbital fibers in rabbit, coupled with its coexpression with
the fast IIb myosin, would allow MYH13 and global fibers to play a direct role
in moving the eye during saccades. And MYH13 expression in the orbital layer
would enable it to contribute to either or both of the rapid movements in
saccades and the repositioning of the pulley. We propose that the localized
expression of MYH13, in synergy with IIb myosin and increased levels of
sarcoplasmic reticulum, result in a differentially responsive and very fast
contracting region of extraocular muscle. Neither mechanism is exclusive in
the rabbit, and each is consistent with the distribution of MYH13 in these
species. To resolve these issues, further studies correlating the
species-specific differences in MYH13 expression and the pattern of
recruitment of EOM motor units need to be pursued.
With regard to potential species-specific differences in MYH13 expression,
our finding that MYH13 is expressed in both the global and orbital layers is
consistent with the immunolocalization described by Sartore et al.
(1987
) in several species, but
it differs from other studies that describe different orbital or global
localizations (Lucas et al.,
1995
; Brueckner et al.,
1996
). This variation may reflect subtle variation in probe
specificity, antigen accessibility or true species-specific differences. These
uncertainties emphasize the importance of confirming localization results by
an independent technique such as SDS-PAGE. Our SDS-PAGE analysis of the myosin
isoforms present in dissected orbital and global layers of the muscle and in
single fibers from the global layer (Figs
7,
8) confirms the distribution of
MYH13 in rabbit EOM.
Longitudinal changes in the expression of cardiac/slow, developmental and
fast myosin have been detected previously by immunolocalization
(Brueckner et al., 1996
;
Jacoby et al., 1990
;
McLoon et al., 1999
;
Rubinstein and Hoh, 2000
). But
those studies could not distinguish among all the fast subtypes because
specific antibodies for IIb and IIx were unavailable. Here, quantitative
differences in the distribution of all the fast myosins were detected by
SDS-PAGE. Fig. 1 shows that IIb
and MYH13 are expressed in the central region, whereas IIx is distributed
relatively uniformly and IIa is expressed primarily in the proximal and distal
regions of the muscle.
Segmental expression of myosins along the length of muscle could arise in
several ways. In the orbital layer, many fibers extend to the end of the
layer, so the decrease in MYH13 in the distal region of the muscle reported
here, and by Rubinstein and Hoh
(2000
), clearly indicates that
different myosin isoforms are expressed along the length of individual fibers.
By contrast, most previous studies of fast myosin isoforms reported that only
one fast isoform is expressed in each fiber in the global layer. Homogeneity
of myosin isoform expression in single fast global fibers is not supported by
the present results. Some fibers express IIa uniformly, but the majority of
global fibers that express MYH13 also express IIb and varying amounts of IIx
(Fig. 8). These observations,
coupled with the immunolocalization of MYH13
(Fig. 5), suggest either that
MYH13 and IIb are coexpressed in single fibers, or that there is a transition
from high levels of MYH13 expression near the neuromuscular junction to IIb
and then other fast isoforms in more distal regions of the fibers.
Interpreting the changes in myosin distribution along the length of the
muscle is complicated by the fact that many fibers do not extend full length,
and some are present only in the proximal or distal portions of the muscle
(Davidowitz et al., 1977
,
1996
). For MYH13, the broader
distribution in global fibers (Fig.
6) may result from several factors. The endplates in the global
layer are spatially distributed over a two- to threefold wider range than in
the orbital layer (Davidowitz et al.,
1996
), so if MYH13 expression is regulated by proximity to the
endplate, then a broader region of high MYH13 expression would be expected in
the global layer. In addition, two of the global singly innervated fiber
types, the red and intermediate fibers, terminate early, and only 20% of the
third type, the `pale' fibers, continue to the distal region. Another group of
global fibers originates in the distal half of the muscle, and they are
innervated at a secondary zone approximately two-thirds of the way down the
muscle (Davidowitz et al.,
1996
,
2000
). Thus, continued MYH13
expression may result from expression in the relatively few fibers that extend
that far, as well as the influence of a broader innervation zone and the
presence of distally innervated fibers.
Muscle fibers distant from the endplate region may also be heterogeneous.
Quantitative analysis showed that the embryonic and perinatal isoforms are
relatively minor components of distal and proximal regions in rabbit EOM
(Fig. 1). The perinatal isoform
makes up at most 1% of the myosin in the distal section, and the proportion of
embryonic myosin is approximately 5% overall
(Briggs and Schachat, 2000
) and
only 12% in farthest distal section. Similarly, these isoforms were below the
limits of detection by SDS-PAGE analysis of rat EOM
(Kranjc et al., 2000
).
However, immunolocalization studies have reported that these developmental
isoforms are expressed in 50-90% of the fibers in this region of the muscle
(Brueckner et al., 1996
;
McLoon et al., 1999
). If these
isoforms are present in a large percentage of fibers, then they only represent
a small fraction of the total myosin in each fiber perhaps too small
to have a significant effect on physiology. For this reason a combination of
both quantitative data and immunolocalization will be required to fully define
expression patterns and assess the relative functional roles of the different
isoforms.
The complex patterns of myosin expression described in extraocular muscle
have no parallels in other adult vertebrate muscles, but segmental
heterogeneity has been reported in individual fibers during development.
Rosser et al. (2000
) found
that in the innervation-dependent transition from neonatal to adult myosin
isoforms, adult isoforms are first expressed at the neuromuscular junction and
gradually spread down the length of the fiber. In contrast to that dynamic
transition, the segmental heterogeneity in EOM appears to be a stable
situation in which expression of the novel myosin MYH13 is induced by an
innervation-dependent signaling pattern that is attenuated along the length of
the fiber.
The localized expression of MYH13 and its mRNA in the central region of
rabbit EOM, spanning the innervation zone, suggests that MYH13 transcription
is regulated by the activity of the extraocular motor nerves
(Brueckner and Porter, 1998
;
Kranjc et al., 2001
). The
particular dependence of MYH13 on appropriate neural activity was demonstrated
by the loss of MYH13 expression after paralysis of rat EOM with botulinum
toxin, coupled with the failure to recover its expression after the muscle was
reinnervated and the expression of the other myosin isoforms had returned to
near normal (Kranjc et al.,
2001
). The molecular mechanism of this regulation has not been
established. Although MYH13 colocalizes with IIb in EOM, it is clear that they
are independently regulated because the MYH13 gene sequence lacks
many of the upstream regulatory elements in the proximal promoter of IIb that
regulate its expression in fast skeletal muscles
(Briggs and Schachat,
2000
).
Segmental expression of MYH13 and the other myosin isoforms may be the
molecular explanation for how different regions of EOM muscle fibers can have
diverse contractile properties. Expression of EO MyHC in almost all fast
fibers in the EPB region may permit those fibers to perform a common function
such as saccades. However, the extensive coexpression of MYH13 with IIb and
other fast myosins in individual fibers raises the question of whether kinetic
differences of myosin isoforms are the primary determinant of rapid EOM
contractions. The localized high levels of MYH13 and IIb myosin are probably
the key to the initial velocity of shortening in saccades, but the short
contraction times and low tension that characterize saccades more likely
result from other special adaptations. The small fiber and myofibril size and
high density of sarcoplasmic reticulum
(Chiarandini and Davidowitz,
1979
; Spencer and Porter,
1988
), which at the molecular level result in a differential
increase in the proteins associated with calcium reuptake
(Blank and Schachat, 1999
),
would allow the central region of the muscle to have more rapid rates of
tension generation and relaxation. These specializations probably account for
the low tension generated in saccades, as they would reduce the duration and
amplitude of the calcium transient and shorten the contraction time in
exchange for a reduction in twitch tension. Such a trade-off of tension for
more rapid contraction times would be further enhanced by the high levels of
expression of TnT3f observed in EOM (Briggs
et al., 1988
), the fast TnT isoform associated with the most
graded tension increase in response to increases in intracellular calcium
(Schachat et al., 1987
).
Investigations are continuing to define more precisely how the diverse patterns of myosin expression are regulated in EOM fibers and to correlate myosin expression with fiber physiology.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Akita, E. M. and Nakai, S. (1993). Comparison of four purification methods for the production of immunoglobulins from eggs laid by hens immunized with an enterotoxigenic E. coli strain. J. Immunol. Methods 160,207 -214.[Medline]
Barmack, N. H. (1977). Recruitment and
suprathreshold frequency modulation of single extraocular muscle fibers in the
rabbit. J. Neurophysiol.
40,779
-790.
Blank, J. M. and Schachat, F. (1999). Extraocular and laryngeal muscles exhibit differential amplification of proteins involved in calcium homeostasis. Mol. Biol. Cell 10,246a .
Briggs, M. and Schachat, F. (2000). Early specialization of the superfast myosin in extraocular and laryngeal muscles. J. Exp. Biol. 203,2485 -2494.[Abstract]
Briggs, M. M., Jacoby, J., Davidowitz, J. and Schachat, F. H. (1988). Expression of a novel combination of fast and slow troponin T isoforms in rabbit extraocular muscles. J. Mus. Res. Cell Motil. 9,241 -247.[Medline]
Briggs, M. M., Lin, J. J. C. and Schachat, F. H. (1987). The extent of aminoterminal heterogeneity in rabbit fast skeletal muscle troponin T. J. Mus. Res. Cell Motil. 8, 1-12.[Medline]
Briggs, M. M., McGinnis, H. D. and Schachat, F.
(1990). Transitions from fetal to fast troponin T isoforms are
coordinated with changes in tropomyosin and
-actinin isoforms in
developing rabbit skeletal muscle. Dev. Biol.
140,253
-260.[Medline]
Brueckner, J. K., Itkis, O. and Porter, J. D. (1996). Spatial and temporal patterns of myosin heavy chain expression in developing rat extraocular muscle. J. Mus. Res. Cell Motil. 17,297 -312.[Medline]
Brueckner, J. K. and Porter, J. D. (1998).
Visual system maldevelopment disrupts extraocular muscle-specific myosin
expression. J. Appl. Physiol.
85,584
-592.
Cheng, G. and Porter, J. D. (2002).
Transcriptional profile of rat extraocular muscle by serial analysis of gene
expression. Invest. Ophthalmol. Vis. Sci.
43,1048
-1058.
Chiarandini, D. J. and Davidowitz, J. (1979). Structure and function of extraocular muscle fibers. In Current Topics in Eye Research, vol. 1 (ed. J. A. Zadunaisky and H. Davson), pp. 91-142. New York: Academic Press.[Medline]
Chomczynski, P. and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol chloroform extraction. Anal. Biochem. 162,156 -159.[Medline]
Close, R. L. and Luff, A. R. (1974). Dynamic
properties of inferior rectus muscle of the rat. J.
Physiol. 236,259
-270.
Cooper, S. and Eccles, J. (1930). The isometric
responses of mammalian muscles. J. Physiol.
69,377
-385.
Cuda, G., Pate, E., Cooke, R. and Sellers, J. R.
(1997). In vitro actin filament sliding velocities
produced by mixtures of different types of myosin. Biophys.
J. 72,1767
-1779.
d'Albis, A., Couteaux, R., Janmot, C. and Roulet, A. (1989). Specific programs of myosin expression in the postnatal development of rat muscles. Eur. J. Biochem. 183,583 -590.[Medline]
Davidowitz, J., Philips, G. and Breinin, G. M.
(1977). Organization of the orbital surface layer in rabbit
superior rectus. Invest. Ophthalmol. Vis. Sci.
16,711
-729.
Davidowitz, J., Rubinson, K., Jacoby, J. and Onejeme, A. (1996). Myofibril size variation along the length of extraocular muscle in rabbit and rat. II: Global layer. Tissue Cell 28,77 -87.[Medline]
Davidowitz, J., Rubinson, K. and Onejeme, A. (2000). Location along the muscle's length is a determinant of myofibril size. Tissue Cell 32,336 -350.[Medline]
Dean, P. (1996). Motor unit recruitment in a
distributed model of extraocular muscle. J.
Neurophysiol. 76,727
-742.
DelGaudio, J. M., Sciote, J. J., Carroll, W. R. and Escalmado, R. M. (1995). Atypical myosin heavy chain in rat laryngeal muscle. Ann. Otol. Rhinol. Laryngol. 104,237 -245.[Medline]
Demer, J. L. (2002). The orbital pulley system:
a revolution in concepts of orbital anatomy. Ann. NY Acad.
Sci. 956,17
-32.
Demer, J. L., Miller, J. M., Poukens, V., Vinters, H. V. and
Glasgow, B. J. (1995). Evidence for fibromuscular pulleys of
the recti extraocular muscles. Invest. Ophthalmol. Vis.
Sci. 36,1125
-1136.
Fischer, M. D., Gorospe, J. R., Felder, E., Bogdanovich, S.,
Pedrosa-Domellof, F., Ahima, R. S., Rubinstein, N. A., Hoffman, E. P. and
Khurana, T. S. (2002). Expression profiling reveals metabolic
and structural components of extraocular muscles. Physiol.
Genomics 9,71
-84.
Fuchs, A. F., Kaneko, C. R. S. and Scudder, C. A. (1985). Brainstem control of saccadic eye movements. Ann. Rev. Neurosci. 8,307 -337.[Medline]
Gurahian, S. M. and Goldberg, S. J. (1987). Fatigue of lateral rectus and retractor bulbi motor units in cat. Brain Res. 415,281 -292.[Medline]
Hamalainen, N. and Pette, D. (1997). Expression of an alpha-cardiac like myosin heavy chain in diaphragm, chronically stimulated, and denervated fast-twitch muscles of rabbit. J. Mus. Res. Cell Motil. 18,401 -411.[Medline]
Jacoby, J., Chiarandini, D. J. and Stefani, E.
(1989). Electrical properties and innervation of fibers in the
orbital layer of rat extraocular muscles. J.
Neurophysiol. 61,116
-125.
Jacoby, J., Ko, K., Weiss, C. and Rushbrook, J. I. (1990). Systematic variation in myosin expression along extraocular muscle fibers of the adult rat. J. Mus. Res. Cell Motil. 11,25 -40.[Medline]
Janmot, C. and d'Albis, A. (1994). Electrophoretic separation of developmental and adult rabbit skeletal muscle myosin heavy chain isoforms: example of application to muscle denervation study. FEBS Lett. 353,13 -15.[Medline]
Khanna, S. and Porter, J. D. (2001). Evidence
for rectus extraocular muscle pulleys in rodents. Invest.
Ophthalmol. Vis. Sci. 42,1986
-1992.
Kranjc, B. S., Sketelj, J., d'Albis, A., Ambroz, M. and Erzen, I. (2000). Fibre types and myosin heavy chain expression in the ocular medial rectus muscle of the adult rat. J. Mus. Res. Cell Motil. 21,753 -761.[Medline]
Kranjc, B. S., Sketelj, J., d'Albis, A. and Erzen, I.
(2001). Long-term changes in myosin heavy chain composition after
botulinum toxin a injection into rat medial rectus muscle. Invest.
Ophthalmol. Vis. Sci. 42,3158
-3164.
Li, Z. B., Rossmanith, G. H. and Hoh, J. F.
(2000). Cross-bridge kinetics of rabbit single extraocular and
limb muscle fibers. Invest. Ophthalmol. Vis. Sci.
41,3770
-3774.
Lucas, C. A., Rughani, A. and Hoh, J. F. (1995). Expression of extraocular myosin heavy chain in rabbit laryngeal muscle. J. Mus. Res. Cell Motil. 16,368 -378.[Medline]
McKoy, G., Leger, M. E., Bacou, F. and Goldspink, G. (1998). Differential expression of myosin heavy chain mRNA and protein isoforms in four functionally diverse rabbit skeletal muscles during pre- and postnatal development. Dev. Dyn. 211,193 -203.[Medline]
McLoon, L. K., Rios, L. and Wirtschafter, J. D. (1999). Complex three-dimensional patterns of myosin isoform expression: differences between and within specific extraocular muscles. J. Mus. Res. Cell Motil. 20,771 -783.[Medline]
McNally, E., Sohn, R., Frankel, S. and Leinwand, L. (1991). Expression of myosin and actin in Escherichia coli.Methods Enzymol. 196,368 -389.[Medline]
Merati, A. L., Bodine, S. C., Bennett, T., Jung, H. H., Furuta, H. and Ryan, A. F. (1996). Identification of a novel myosin heavy chain gene expressed in the rat larynx. Biochim. Biophys. Acta 1306,153 -159.[Medline]
Pierobon-Bormioli, S., Torresan, P., Sartore, S., Moschini, G.
B. and Schiaffino, S. (1979). Immunohistochemical
identification of slow-tonic fibers in human extrinsic eye muscles.
Invest. Ophthalmol. Vis. Sci.
18,303
-306.
Porter, J. D., Khanna, S., Kaminski, H. J., Rao, J. S., Merriam,
A. P., Richmonds, C. R., Leahy, P., Li, J. and Andrade, F. H.
(2001). Extraocular muscle is defined by a fundamentally distinct
gene expression profile. Proc. Natl. Acad. Sci. USA
98,12062
-12067.
Reiser, P. J., Moss, R. L., Giulian, G. G. and Greaser, M.
L. (1985). Shortening velocity in single fibers from adult
rabbit soleus muscles is correlated with myosin heavy chain composition.
J. Biol. Chem. 260,9077
-9080.
Rosser, B. W., Farrar, C. M., Crellin, N. K., Andersen, L. B. and Bandman, E. (2000). Repression of myosin isoforms in developing and denervated skeletal muscle fibers originates near motor endplates. Dev. Dyn. 217, 50-61.[Medline]
Rubinstein, N. A. and Hoh, J. F. (2000). The
distribution of myosin heavy chain isoforms among rat extraocular muscle fiber
types. Invest. Ophthalmol. Vis. Sci.
41,3391
-3398.
Rushbrook, J. I., Weiss, C., Ko, K., Feurman, M. H., Carleton, S., Ing, A. and Jacoby, J. (1994). Identification of alpha-cardiac myosin heavy chain mRNA and protein in extraocular muscle of the adult rabbit. J. Mus. Res. Cell Motil. 15,505 -515.[Medline]
Sartore, S., Mascarello, F., Rowlerson, A., Gorza, L., Ausoni, S., Vianello, M. and Schiaffino, S. (1987). Fibre types in extraocular muscles: a new myosin isoform in the fast fibres. J. Mus. Res. Cell Motil. 8,161 -172.[Medline]
Schachat, F. and Briggs, M. (2002).
Phylogenetic implications of the superfast myosin in extraocular muscles.
J. Exp. Biol. 205,2189
-2201.
Schachat, F., Williams, R. S. and Schnurr, C. A.
(1988). Coordinate changes in fast thin filament and Z-line
protein expression in the early response to chronic stimulation. J.
Biol. Chem. 263,13975
-13978.
Schachat, F. H., Bronson, D. D. and McDonald, O. B.
(1985a). Heterogeneity of contractile proteins: a continuum of
troponin-tropomyosin expression in mammalian skeletal muscle. J.
Biol. Chem. 260,1108
-1113.
Schachat, F. H., Canine, A. C., Briggs, M. M. and Reedy, M.
C. (1985b). The presence of two skeletal muscle
alpha-actinins correlates with troponin-tropomyosin expression and Z-line
width. J. Cell Biol.
101,1001
-1008.
Schachat, F. H., Diamond, M. S. and Brandt, P. W. (1987). The effect of different troponin T-tropomyosin combinations on thin filament activation. J. Mol. Biol. 198,551 -554.[Medline]
Scott, A. B. and Collins, C. C. (1973). Division of labor in human extraocular muscle. Arch. Ophthalmol. 90,319 -322.[Medline]
Shall, M. S. and Goldberg, S. J. (1992). Extraocular motor units: type classification and motoneuron stimulation frequency-muscle unit force relationships. Brain Res. 587,291 -300.[Medline]
Shall, M. S. and Goldberg, S. J. (1995). Lateral rectus EMG and contractile responses elicited by cat abducens motoneurons. Muscle Nerve 18,948 -955.[Medline]
Spencer, R. F. and Porter, J. D. (1988). Structural organization of the extraocular muscles. In Neuroanatomy of the Oculomotor System (ed. J. A. Buttner-Ennever), pp.33 -79. Amsterdam: Elsevier Science.
Talmadge, R. J. and Roy, R. R. (1993).
Electrophoretic separation of rat skeletal muscle myosin heavy-chain isoforms.
J. Appl. Physiol. 75,2337
-2340.
Wasicky, R., Ziya-Ghazvini, F., Blumer, R., Lukas, J. R. and
Mayr, R. (2000). Muscle fiber types of human extraocular
muscles: a histochemical and immunohistochemical study. Invest.
Ophthalmol. Vis. Sci. 41,980
-990.
Weiss, A., McDonough, D., Wertman, B., Acakpo-Satchivi, L.,
Montgomery, K., Kucherlapati, R., Leinwand, L. and Krauter, K.
(1999). Organization of human and mouse skeletal myosin heavy
chain gene clusters is highly conserved. Proc. Natl. Acad. Sci.
USA 96,2958
-2963.
Wieczorek, D. F., Periasamy, M., Butler-Browne, G., Whalen, R.
G. and Nadal-Ginard, B. (1985). Co-expression of multiple
myosin heavy chain genes, in addition to a tissue-specific one, in extraocular
musculature. J. Cell Biol.
101,618
-629.
Winters, L. M., Briggs, M. M. and Schachat, F. (1998). The human extraocular muscle myosin heavy chain gene (MYH13) maps to the cluster of fast and developmental myosin genes on chromosome 17. Genomics 54,188 -189.[Medline]
Related articles in JEB:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||