|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
Cardiac effects of hypoxia in the neotenous tiger salamander Ambystoma tigrinum
WWAMI Medical Program and Department of Biological Sciences, University of Idaho, Moscow, ID 83843-3051, USA
* e-mail: tmck{at}uidaho.edu
Accepted 3 April 2002
| Summary |
|---|
|
|
|---|
Key words: hypoxia, heart, salamander, Ambystoma tigrinum, cardiac output, haematocrit, hypometabolism, cytochrome oxidase, elongation factor 2, representational difference analysis
| Introduction |
|---|
|
|
|---|
It is thought that neotenous salamanders use cutaneous and gill gas
exchange at relatively high oxygen tensions and progress to air-gulping and
lung ventilation when oxygen tensions become low
(Guimond and Hutchison, 1972
).
Zwemer and Prange (1990
)
studied adaptations to chronic hypoxia in neotenous Ambystoma
mexicanium in a laboratory setting. Animals that had been raised since
birth at an equivalent altitude of 4000 m (hypoxia-adapted) had a greater
underwater rate of oxygen consumption at PO2
values above 135 mmHg (18.0 kPa) than their normoxic counterparts. However,
the hypoxia-adapted animals had a reduced rate of oxygen consumption at
PO2 values below 40 mmHg (5.32 kPa) compared
with the normoxic animals, demonstrating that exposure to chronic hypoxia
results in adaptations that are beneficial to living in a low-oxygen
environment. Zwemer et al.
(1993
) exposed Ambystoma
mexicanum to 14 days of reduced oxygen level and found no differences
between the exposed and normoxic animals in a subsequent challenge to
progressive hypoxia. During the progressive hypoxia, animals from both groups
relied more on air-breathing than on gill ventilation at the reduced oxygen
tension and both had increased hematocrits following exposure to a
PO2 of 5 mmHg (0.7 kPa).
Many species of vertebrates have cardiac myocytes that are terminally
differentiated and do not re-enter cell division, although recent evidence
casts doubt on this long-held assumption
(Beltrami et al., 2001
). Some
species of adult salamander do have cardiac myocytes that undergo cell
division in cell culture, and the newt Notophthalmus viridescens has
been studied extensively (Mantz et al.,
1998
). Preliminary studies from this laboratory indicated that
adult tiger salamanders exposed to 5% oxygen for a period of 11 days increased
their cardiac mass compared with matched normoxic salamanders. Two-dimensional
protein gels derived from the hearts of hypoxic and normoxic salamanders
showed that hypoxic hearts expressed at least eight proteins that were not
expressed in the hearts of normoxic animals
(McKean et al., 2001
). Since
cardiac mass increased during hypoxic exposure, we were interested in learning
whether the increase in mass was accomplished through hyperplasia or
hypertrophy or combination of the two mechanisms. Further, we were interested
in any physiological changes that might be occurring in the heart as a result
of differential gene expression or posttranslational protein modification. The
working hypothesis of this study was that there is differential cardiac gene
expression in adult salamanders exposed to hypoxia that results in changes in
physiological function and cellular hyperplasia.
| Materials and methods |
|---|
|
|
|---|
Buffer-perfused hearts
In situ buffer perfusion of the heart was performed by inserting
an input cannula into the sinus venosus and an output cannula into the conus
arteriosus (McKean et al.,
1997
). Other vessels entering and leaving the heart were tied off
using surgical silk. Pressure was measured using a World Precision
Instruments, Inc. (Sarasota, FL, USA) blood pressure transducer and
transbridge amplifier. Flow in the output catheter was measured using a
Transonic Systems (Ithaca, NY, USA) flow probe (type 2N). Pressure and flow
signals were acquired and displayed on a microcomputer using a DASH-8 A/D
board (MetraByte Corp, Stoughton, MA, USA) and Labtech Notebook software
(Laboratory Technologies Corp, Wilmington, MA, USA). Flow and pressure
calibrations were performed at 20 °C. Buffer used to perfuse the heart had
the following composition (in mmoll-1): NaCl, 110; KCl, 1.88;
CaCl2, 1.8; NaH2PO4, 0.07; glucose, 5.6;
NaH2PO4 was added to adjust the pH to 7.8. Flow into the
sinus venosus was regulated by adjusting the height of the input reservoir
from 1 to 5 cm above the midlevel of the heart. Afterload was adjusted to a
value of 20 cm above the heart for cardiac output determinations and up to the
maximum height for which a cardiac output could be generated to determine
`fail height'.
Whole-animal studies
Cardiac output was measured in unanesthetized and minimally restrained
salamanders that had a flow probe (type 2S) placed around the conus
arteriosus. Animals had been anesthetized during the surgical procedures.
Following surgery, the incisions were sutured and the animals were given
antibiotics. These animals were placed in a plastic dishpan and heart rate and
flow measurements were made before and during hypoxia of up to 7 days
duration. It was thought that at least several days of continuous hypoxia
would be necessary to initiate the kinds of changes that might be reflective
of a chronic response. This would allow sufficient time for physiological
adjustments, gene expression and protein synthesis. For studies involving
changes in hematocrit and heart mass, exposures of 10-14 days were
utilized.
Hematocrit was determined by collecting whole blood in a capillary tube and spinning it for 5 min in a clinical hematocrit centrifuge. Whole-animal oxygen consumption was measured in closed-system respirometers filled with either room air or hypoxic gas mixtures. The cylindrical chambers were two-thirds filled with water so that the salamander could utilize both gill and lung ventilation. A magnetic stir-bar was used to facilitate oxygen equilibration between the gas and liquid phases. When the animal was in place, the chamber was flushed with the experimental gas mixture and the rate of oxygen consumption determined.
Differential gene expression in salamander ventricular tissue was
determined using representational difference analysis
(Hubank and Schatz, 1999
) of
ventricular cDNA obtained from hypoxic and normoxic salamanders.
cDNA synthesis
Total RNA was extracted from the ventricles of 15 hypoxic and 15 normoxic
salamanders using the Trizol reagent (Life Technologies, Inc., Rockville, MD,
USA). The poly(A) mRNA fraction was then isolated from total RNA using oligo
poly(T) paramagnetic beads and a kit purchased from Promega Corp, Madison, WI,
USA. Double-stranded cDNA was synthesized from the mRNA using a cDNA synthesis
kit purchased from Life Technologies, Rockville, MD, USA.
cDNA representational difference analysis
The driver (normoxia) and tester (hypoxia) cDNA were cleaved with
restriction endonuclease Sau3A and ligated with RBam24/12
dephosphorylated adaptors where the 24-mer was
5'-AGCACTCTCCAGCCTCTCACCGAG-3' and the 12-mer was
5'-GATCCGTTCATG-3'. The 12-mer adaptor was removed, so the 24-mer
served as a primer for the amplification by 25-30 polymerase chain reaction
(PCR) cycles to produce the driver and tester amplicons. The adaptors were
removed by Sau3A digestion, and Jam24/12 adaptors were
attached to the tester amplicons where the Jam 24-mer was
5'-ACCGACGTCGACTATCCATGAACG-3' and the Jam 12-mer was
5'-GATCCGTTCATG-3'. Subtractive hybridization was performed
between 4 µg of the non-adaptor driver amplicons and 0.1 µg of the
J-adaptor tester amplicons (driver-to-tester ratio of 40:1). The 12-mer was
removed by heating, and single-strand products were removed using mung bean
nuclease; the first differentially expressed products (DP1) were amplified
using PCR and visualized on a 2% agarose gel. The second differentially
expressed products (DP2) were generated by mixing 4 µg of driver and 0.01
µg of tester amplicons (400:1 ratio). DP3 was generated using a
driver-to-tester ratio of 4000:1, and the DP4 driver-to-tester ratio was 40
000:1. Difference products were visualized in a 1.8% agarose gel.
Cloning differentially expressed products
The difference products were removed from gels, and the cDNA was extracted
and purified with Qiaquick gel extraction kit (Qiagen, Valencia, CA, USA). The
difference products were cut with Sau3A1 and ligated into the
BamHI site of the pBluescript II KS phagemid (Stratagene, La Jolla,
CA, USA). Phagemids were introduced into the DH5
strain of
Escherichia coli and spread on LB-ampicillin/IPTG-X-galactose plates.
White colonies were selected, cultured and the phagemids extracted. The
presence of inserts was confirmed prior to sequencing by BamHI
treatment and gel electrophoresis. Phagemid DNA (400-500 µg) was mixed with
4 µl of dye-labeled nucleotides (Big-Dye), 2 µl of 5xPCR buffer
and water to bring the volume to 10 µl and subjected to 25 cycles of PCR.
The mixture was dried and cycle-sequenced using an ABI Prism model 377
sequencer (PE Biosystems, Foster City, CA, USA). Sequence similarity searches
were performed using the BLAST algorithm
(http:www.ncbi.nlm.nih.gov/BLAST/
).
Northern hybridization
Total RNA (10 µg of each sample) was electrophoresed on 1% agarose
formaldehyde gels and transferred onto nylon membranes. The blots were
hybridized at 68°C overnight with [
-32P]dCTP-labeled DNA
probes generated by representational difference analysis using a PerfectHypTM
Plus hybridization buffer (Sigma). Filters were rinsed as follows: one 5 min
wash at room temperature in 2x SSC/0.1% SDS, two 20 min washes at
68°C in 0.5x SSC/0.1% SDS and one 20 min wash at 68°C in
0.1x SSC/0.1% SDS. Blots were exposed to Kodak X-ray film using an
intensifying screen at -70°C.
Markers for cell division
Cardiac myocyte mitosis was evaluated by injecting salamanders
intraperitoneally with 5 mg of colchicine. The animals had previously been
exposed to 9% oxygen for 3 days. The animals were quickly returned to the
hypoxic aquarium; 24 h later, they were anesthetized and the heart was flushed
with Telly's fixative, removed from the animal and prepared for light
microscopy using haematoxylin and eosin staining.
Cell culture
Tiger salamander ventricular myocyte culture was attempted using techniques
described for the newt (Notophthalmus viridescens;
Mantz et al., 1998
). Briefly
the technique entailed removing the heart from anesthetized salamander after
it had been cleared of blood and subsequently placing it into a modified L-15
medium containing penicillin/streptomycin for 18 h. The ventricle was cut into
small pieces, placed into an enzyme solution and agitated for 10 h at
27°C. The solution was triturated with a 5 ml pipette (diameter 1.5 mm)
3-5 times every 2 h. The suspension was centrifuged at 400 g
for 5 min and filtered through 125 µm nylon mesh. Cells were examined under
a microscope and then preplated in culture dishes for several days. The
unattached cells were transferred to new dishes coated with laminin (20 µg
ml-1) and were cultured at 25°C.
Statistical analyses
Data are presented as the mean ± S.D. Statistical evaluation was
performed using SigmaStat (SPSS Inc., Chicago, IL, USA), and differences
between groups were established using the Student's t-test.
| Results |
|---|
|
|
|---|
|
Mechanical performance of the heart
The mechanical performance of the buffer-perfused salamander heart was
measured in both normoxic and hypoxic animals at different preloads and
afterloads. Fig. 2 shows
pressure and flow traces for a buffer-perfused salamander heart. Note that the
flow trace lags the pressure trace slightly and that flow reverses and becomes
negative during late diastole. The FrankStarling relationship can be
demonstrated in the buffer-perfused salamander hearts. At an afterload of 20
cmH2O (2 kPa), cardiac output increased as preload was increased
from 1 to 5 cmH2O (0.1-0.5 kPa)
(Fig. 3).
|
|
The slope of the line relating cardiac output to preload was approximately
20 ml min-1 g-1 kPa-1 increase in filling
pressure for both the normoxic (N=6) and hypoxic (N=4)
animals. Several other parameters related to heart performance were recorded
from hearts obtained from both normoxic and hypoxic animals. Maximum cardiac
output in the hearts from normoxic animals was 30.8±9.4 ml
min-1 kg-1, while the output measured in the hearts from
the hypoxic animals was 43.4±9.8 ml min-1 kg-1
(N=6). These differences did not quite achieve statistical
significance (P=0.07, t-test). The fail height of hearts
from the normoxic salamanders was 44±12 cm (N=6), while the
fail height of hearts from hypoxic salamanders was 49±3 cm
(N=7). These values also do not differ statistically
(P=0.29). The maximum cardiac power (Pmax) in the
buffer-perfused hearts of these animals was 1.0 mW g-1 heart. The
equation for cardiac power used is:
![]() |
=0.083 ml s-1 and
Mv=0.2 g; Pa is arterial pressure, Pv is
venous pressure, Ps is systolic pressure, Pd is diastolic
pressures,
is cardiac output and
Mv is ventricular mass. Cardiac output and heart rate in unanesthetized and intact animals increased slightly during initiation of hypoxia but then gradually stabilized (Fig. 4). At the termination of hypoxia, there was a brief increase in cardiac output followed by a return to the normoxic value. Cardiac output was elevated or maintained in hypoxic animals unless the oxygen levels were reduced below 1% and held for 10 min, which resulted in arrhythmias and cardiac failure.
|
Hematocrit and cardiac mass
Hematocrit increased in hypoxic animals compared with normoxic animals.
Hematocrit during normoxia was 0.414±6.3 (N=14) and increased
to 0.525±7.5 (N=8) during hypoxia (P=0.002). Body
mass and cardiac output did not differ between the hypoxic and control groups.
Body mass was 121±29 g in the normoxic animals (N=15) and
119±34 g in the hypoxic animals (N=8). Heart mass to body mass
ratio was greater in the hypoxic animals (P=0.01): the ratio was
1.8±0.5 mg g-1 in the hypoxic salamanders (N=8) and
1.3±0.3 mg g-1 in the normoxic animals (N=10).
Differential gene expression
On the basis of two-dimensional gel electrophoresis of proteins from the
hearts of hypoxic and normoxic salamanders (data not shown), there was
differential gene expression during long-term hypoxia. Agarose gel
electrophoresis (Fig. 5) shows
the difference products, after 1-4 rounds of subtractive hybridization,
between hypoxic and normoxic salamander hearts and the amplicons from the
hypoxic and normoxic hearts.
|
The differentially expressed products tend to appear as four bands in the gel, while the DNA in the amplicons has a continuous size distribution. The size of the differentially expressed products ranged from 0.2 to 0.6 kilobase pairs. Several dozen white colonies were picked at random during blue/white screening of the expressed products. cDNA from individual colonies was amplified and sequenced. Fourteen of the gene products from individual colonies were amplified and sequenced, and the gene fragments ranged in size from 394 to 613 bp. Two of the sequenced clones were used to probe hypoxic and normoxic salamander heart cDNA. The probes hybridized only with the cDNA obtained from hypoxic salamander hearts and not the cDNA from normoxic salamander hearts. The sequences of the gene fragments were entered into the http://www.ncbi.nlm.nih database, and a BLAST search was performed. One of the sequences matched that of the cloning vector, pBluescript II KS phagemid. The sequences of the remaining differentially expressed genes were close matches to known genes for either mitochondrial proteins including cytochrome oxidase subunit III or elongation factor 2. The sequence identity ranged from 86 to 98 %. In some cases, there was a comparable degree of match to known genes for both cytochrome oxidase and elongation factor 2. A comparison of the sequences of the cloned genes indicates that here is sequence similarity between three or more of the cloned genes in eight of the genes and little between-gene similarity in six of the cloned genes. The sequences of the gene fragments are presented in the Appendix.
Myocyte isolation and cell culture
Ventricular cardiac myocytes could be readily isolated by enzymatic
digestion and separation (Fig.
6). In only one instance were we successful in growing these cells
in culture. After plating, the cells began to dedifferentiate, lose their
striations and take on a rounded appearance.
|
Cell division
There was no evidence for cell division in cardiac tissue taken from
hypoxic salamanders. Fig. 7
shows that mitotic figures are present in gill epithelia, lung and small
intestine in micrographs taken from colchicine-injected hypoxic salamanders.
Mitotic figures were not observed in heart tissue from hypoxic animals
(N=5).
|
| Discussion |
|---|
|
|
|---|
The neotenous form of these salamanders has been shown to be more
hypoxia-tolerant than the metamorphosed form
(Branch and Altig, 1983
). By
living in permanent ponds that are free of aquatic predators such as fish, the
neotenous form of the salamander has a distinct advantage over the
metamorphosed form (Sexton and Bizer,
1978
). The latter is subjected to greater temperature extremes and
pressure from aerial and terrestrial predation but has the advantage that it
is able to colonize new ponds.
The tiger salamanders used in this study demonstrated decreased rates of
oxygen consumption at oxygen concentrations that were less than approximately
13 %, which corresponds to an approximate altitude of 3500 m and would be at
the upper limit for these animals. Sheafor et al.
(2000
) and Gatz et al.
(1974
) reported that dusky
salamanders have a lowered rate of oxygen consumption during hypoxia and the
rates of oxygen uptake compared favorably with those recorded in the present
study.
Cardiac output measurements in unanesthetized tiger salamanders indicated
that a small initial increase in cardiac output was associated with hypoxia.
Sheafor et al. (2000
) recorded
an increase in heart rate during hypoxia at all but the most severe hypoxic
challenges in dusky salmanders. Gamperl et al.
(1999
) also recorded a small
increase in cardiac output in unanesthetized toads (Bufo marinus)
subjected to hypoxia. It thus appears that there is an increase in the
activity of the heart under moderate hypoxic condition at a time during which
oxygen consumption is reduced compared with normoxia.
The cardiac power development of the buffer-perfused heart of the
salamander was 1.04 mW g-1 heart. This compares favorably with the
value of 0.8 mW g-1 measured in the heart of Bufo marinus
(McKean et al., 1997
) and 1.5
mW g-1 in the adrenaline-stimulated turtle heart (Farrell et al.,
1995). The slope of the FrankStarling curve in the salamander was 20 ml
min-1 g-1 kPa-1 compared with 50 ml
min-1 g-1 kPa-1 in the toad heart. The reason
for the difference in slopes is not known, but it indicates that the
salamander heart is less sensitive to stretch-induced increases in cardiac
output than the toad heart.
Exposure to hypoxia of more than several days duration resulted in an
increase in cardiac mass. The signal for an increase in heart size was
probably an increase in cardiac output or cardiac work associated with pumping
blood with a higher hematocrit. Increases in work are known to induce
increases in cardiac mass and protein expression
(Katz, 1992
). The larger
hearts did not, however, develop a statistically larger maximum cardiac output
during buffer perfusion, nor were they able to achieve a statistically greater
fail height than the smaller hearts from the normoxic animals.
Failure to detect mitotic figures in the hearts of colchicine-injected and
hypoxia-exposed animals supports hypertropy rather than hyperplasia as the
cause of the increase in cardiac mass. Very low levels of cell division might
not have been detected using the colchicine technique. If very low levels did
occur, the number of dividing cells must be very small since no mitotic
figures were detected among the several thousand heart cells examined.
However, mitotic figures were readily found in the gill, intestine and lung
tissues taken from colchicine-injected salamanders. Direct measures of
hypertropy such as increased expression of specific hypertrophy markers were
not attempted, so the suggestion that hypertrophy is the primary cause of
cardiac mass is based on the process of elimination of hyperplasia as a major
cause. Cardiac cell division under cell culture conditions in adults has been
described in other salamander species
(Mantz et al., 1998
) and we
observed it in one instance, but were not able to document it
photographically.
Differential cardiac gene expression during hypoxia was evident by virtue
of the 14 different mRNAs expressed in hearts from hypoxic animals compared
with control animals. On the basis of extensive reports in the literature
(e.g. Gracey et al., 2001
), we
expected to see increases in mRNA for proteins such as erythropoietin, glucose
transporters and glycolytic enzymes. It is likely that these mRNAs were
differentially expressed in the hearts from the hypoxic animals but were not
selected during the screening process. Instead, differentially expressed genes
fell into two groups: (i) those involved in mitochondrial gene expression and
(ii) those involved in protein synthesis (elongation factor 2). These messages
were probably selected because they were more abundant than other messages.
Since there was a considerable increase in cardiac mass associated with
hypoxia, it is not surprising that additional protein synthesis was necessary.
Increases in mitochondrial gene expression in hypoxic cardiac tissue were
initially unexpected since the mitochondrion is an oxygen consumer and, during
hypoxic exposure, oxygen conservation was expected. As cardiac mass increased
during the hypoxic exposure, it is likely that new mitochondria were also
synthesized. Storey (1999
) has
reported that exposure of adult freshwater turtles to acute hypoxia results in
increases in the expression of several mitochondrial genes including those for
cytochrome c oxidase subunits. The significance of the increases in
expression of these mitochondrial genes in the turtle is unclear; however,
Storey (1999
) suggests that
they may somehow participate in a more efficient utilization of the limited
oxygen associated with hypoxic exposure. It was not reported, nor was there
sufficient exposure time, to determine whether cardiac mass increased in these
animals. Bailey and Driedzic
(1996
) reported decreases
rather than increases in protein synthesis in isolated turtle hearts that had
been exposed to several hours of hypoxia compared with normoxic turtle hearts.
During the hypoxic exposure, mitochondrial protein synthesis was reduced even
more than total ventricular protein synthesis. The hearts in that study were
hypodynamic because cardiac power development was considerably less than the
power development of the salamander hearts in the current study and in other
studies using turtle hearts (Farrell et
al., 1994
). Because the hearts were under no stimulus to beat more
forcefully, there was probably no signal for increasing cardiac mass. However,
the oxygen levels achieved in the buffer-perfused turtle hearts were probably
much lower than those encountered by the salamander hearts during the extended
hypoxic exposure, and severe hypoxic per se may initiate a signal to
curtail protein synthesis (Land and
Hochachka, 1995
).
Common mechanisms shared among vertebrates to combat the deleterious
effects of hypoxia are cardiovascular and respiratory adjustments that attempt
to maintain an adequate flow of oxygen to the respiring tissues. Some
vertebrates, such as turtles (Hicks and
Wang, 1999
), neonatal dogs
(Rohlicek et al., 1998
) and
frogs (West and Boutilier,
1998
), enter a state of hypometabolism in response to
environmental hypoxia. In the present study, tiger salamanders exhibited
hypometabolism in response to acute hypoxia of less than 13% inspired oxygen
in the laboratory setting. The reduction in the rate of oxygen consumption was
approximately 60% in the 4-7% ambient oxygen environment and 30% in the 8-11%
oxygen environment. In anesthetized turtles, Hicks and Wang
(1999
) observed a 30%
reduction in the rate of O2 consumption during an exposure to 5%
ambient oxygen. The greater reduction in rate of O2 consumption of
the salamander in a 5% O2 environment compared with the turtle
might reflect a genuine species difference or it could be related to working
with an unanesthetized animal. In the unanesthetized salamander, there is
sometimes a startle component that lasts for several minutes. This component
could be seen in the studies in unanesthetized animals that were fitted with
flow probes and used in the cardiac output experiments. When animals that had
been undisturbed by humans for several hours were approached by the
investigators, there was sometimes a bradycardia that lasted for up to several
minutes. Presumably, if this component of the response were present, it would
also have been present in the salamanders in the normoxic group shown in
Fig. 1, and thus both normoxic
and hypoxic groups would have been equally affected. Since the rates of oxygen
consumption in our study compared favorably with values obtained in other
studies, a startle component either was probably not present or was minor in
magnitude. It is likely that the unanesthetized salamanders would retain
beneficial cardiopulmonary reflexes that may have been diminished by
pentobarbital anesthesia in the turtles. However, movement-associated
O2 consumption would have at an absolute minimum in the
anesthetized turtles, while the salamanders made periodic efforts to escape
confinement or the hypoxic stimulus.
Exposure to graded hypoxia in a different species of salamander
(Desmognathus fuscus) resulted in a decline in whole-animal oxygen
consumption. Animals exposed to a PO2 of 25
mmHg (3.3 kPa) decreased their rate of O2 consumption to 30% of
that of controls, and the rate reached a steady state within 5 min of hypoxic
exposure. Heart rate in these animals did not change except at the lowest
value of 4 mmHg (0.5 kPa) ambient PO2
(Gatz and Piiper, 1979
).
Sheafor et al. (2000
) also
studied the dusky salamander and determined that heart rate was stimulated by
graded hypoxia and that the threshold value for reducing oxygen consumption
was approximately 8-10% oxygen, a value similar to that found in the current
study. The maximum reduction in the rate of oxygen consumption was 66%, which
is also similar to the value determined in the present study.
A reduction in the O2 demand of the organism has an obvious
benefit during hypoxic exposure. Hicks and Wang
(1999
) suggest that hypoxic
hypometabolism represents a regulated response that might, for example,
involve a change in status of ATPases or ion channels rather than a failure to
utilize O2 because of a delivery failure. St-Pierre et al.
(2000
) suggest that changes in
mitochondrial function participate in the regulated response. A regulated
response probably occurs in the salamanders because cardiac pumping was
maintained at O2 levels of 5%. Cardiac failure did not occur until
O2 concentrations had been reduced to under 1% for almost 10 min,
so limitations in O2 delivery were probably not limiting for the
hypometabolism observed in the salamanders. Although flow probes were not
utilized during the O2 consumption studies, blood flow did not
decrease during either the acute or the chronic exposure to hypoxia. In the
salamander, it appears that there is the dual situation of cardiopulmonary
compensation for hypoxia by increased air-breathing with an increase in
O2 delivery in blood fueled by a small increase in cardiac output
together with an increase in hematocrit and, presumably, hemoglobin
concentration. The increased demand placed on the heart and/or some
hypoxia-associated transcription signal results in an increase in cardiac mass
and in the expression of specific cardiac gene products that include
mitochondrial and protein synthesis genes. These and probably other
undescribed mechanisms allow the neotenic tiger salamander to inhabit and
flourish in an environment in which oxygen content can present a
challenge.
| Appendix |
|---|
|
|
|---|
ACGAAAACGTAAGGGACTTAAAGAAGGCATCCCAGCACTTG
ACAACTTCCTGGACAAATTGTAGAACCAACGCAGTCCTCAG
TACCAACTGAACCAAACAAACGGTCATTGGACTCTTGAAAA
TGTAGCCATCGTAACGTGGAGCTGCCGGCACGATTGTTAGA
CTGCAACAACCATTTGCCTTGCATTTGAAGCGGAGCAACTT
GATTTCCCGAGTACATTGGTATTCAGCCTTATAGGTTTTTC
TGTGTTGCACATTATTTTTGGGGGGCACGCAAGGTGCCGTA
AAGCAAAACATTTCCACTTGATCAACATTCTTTGTAGCAAC
TGGCTTCCACGGCCTTCACGTTATTATT
Sequence 2
GGATCCCGAAGACTCCATCGTCGCTGCCTTCAAGTTGTT
AGACCCCAATGGCACTGGAAATGTTAAAAAAGATGAGTTGA
AACTACTCCTGATACTCGGTGAGAGGCTGGAGAGTGCTCGT
TCATGGACGTTGACTTTTCCTCTGAAGTAACGGCTGCCCTT
CGTGTCACAGATGGTGCTCTGGTGGTTGTAGACTGTGTATC
TGGCGTCTGTGTACAGACTGAAACGGTGCTACGTCAGGCCA
TTGCAGAGAGAATTCGTCCAGTATTGATGATGCCCCCTCGG
ATAGCACAGTTGCCTAGGCAACTGTGCTATCCGAGGGA
Sequence 3
GGATCCGAACCGTTAACGTTCTCGCCGAATAGCGACAGG
AAGATCACCGCCCTGGCCCCCAACACCATGAAGATCCCGAA
GACTCCATCGTCGCTGCCTTCAAGTTGTTAGACCCCAATGG
CACTGGAAATGTTAAAAAAGATGAGTTGAAACTACTCCTGA
TGACCCAAGCTGACAAGTTCTCAGACGAAGAGGTGGAGCAG
ATGTTTGCTGTAACGCCAATCGATGTGGCGGGAAACATTGA
CTACAAGTCACTGTGTTACATTATCACCCACGGAGATCATT
ATTCCTATCTGTTTGCCTATTTCGTCAAATTAACTACCACT
TTACATCTAACCACCATTTTAGGTTTGAAGCAGCTGCCTGA
TATTGACATTTCGTTGATGTTGTTTGATTATTCCTTTACGT
CTCCAATCTACTGATGA
Sequence 4
CGATCCGTTCATGGATACTGTTCAGGTTTGTTGCGGAGA
CACGAAAACGTAAGGGACTTAAAGAAGGCATCCCAGCACTT
GACAACTTCCTGGACAAATTGTAAAACCAACGCAGTCCTCA
GTACCAACTGAACCAAACAAACGGTCATTGGACTCTTGAAA
ATGTAGCCATCGTAACATGGAGCTGCCGGCAGATTGTTAGG
CTGCAACAACCATTTGCCTTGCATTTGAAGCGGAGCAACTT
GATTTCCCGAGTACATTGGTATTCAGCCTTATAGGTTTTTC
TGTGTTGCACATTATTTTTGGGGGGCACGCAAAGGTGCCGT
AAAGCAAAAACATTTCCACTTGATCCTCCCTCGGATGGCAC
AGTTGCCCGTTCATGGATAGT
Sequence 5
CTCTGGAGCGTGAGGCAGGAGCTGGAACGGGGTGAACTGT
ATATCCCCCACTTGCAGGGAACCTAGCCCATGCCGGGGCCTC
AGTCGATTTAACAATTTTTTCACTTCATTTAGCAGGTGTTTC
ATCTATCCTAGGTGCAATTAATTTTATTACAACCTCAATTAA
TATAAAACCCGCATCAATATCACAATATCAAACCCCTTTATT
TGTTTGATCATTATTCCTATCTGTTTGCCTATTTCGTCAAAT
TAACTACCACTTTACATCTAACCACCATTTTGGGTCTGAAGC
AGCTGCCTGATATTGACATTTCGTTGATGTTGTTTGATTATT
CCTTTACGTCTCAATCTACTGATGAGGGTCAACATTCTTTGT
AGCAACTGGCTTCCACGGCCTTCACGTTATTATTG
Sequence 6
CAATAATAACGTGAAGGGCGTGGAAGCCAGTTGCTACAA
AGAATGTTGATCAAGTGGAAATGTTTTGCTTTACGGCACCT
TGCGTGCCCCCCAAAAATAATGTGCAACACAGAAAAACCTA
TAAGGCTGAATACCAATGTACTCGGGAAATCAAGTTGCTCC
GCTTCAAATGCAAGGCAAATGGTTGTTGCAGTCTAACAATC
TGCCGGCAGCTCCACGTTACGATGGCTACATTTTCAAGAGT
CCAATGACCGTTTGTTTGGTTCAGTTGGTACTGAGGACTGC
GTTGGTTCTACAATTTGTCCAGGAAGTTGTCAAGTGCTGGG
ATGCCTTCTTTAAGTCCCTTACGTTTTCGTGTCTCCGCAAC
AACCTGAGCAGGACGGCCAGAA
Sequence 7
AATAATAACGTGAAGGCCGTGGAAGCCAGTTGCTACAAA
GAATGTTGATCAAGTGGAAATGTTTTGCTTTACGGCACCTT
GCGTGCCCCCCAAAAATAATGTGCAACACAGAAAAACCTAT
AAGGCTGAATACCAATGTACTCGGGAAATCAAGTTGCTCCG
CTTCAAATGCAAGGCAAATGGTTGTTGCAGTCTAACAATCT
GCCGGCAGCTCCACGTTACGATGGCTACATTTTCAAGAGTC
CAATGACCGTTTGTTTGGTTCAGTTGGTACTGAGGACTGCG
TTGGTTCTACAATTTGTCCAGGAAGTTGTCAAGTGCTGGGA
TGCCTTCTTTAAGTCCCTTACGTTTTCGTGTCTCCGCAACA
ACCTGAGCAGGACGGCCAGAA
Sequence 8
AATAATAACGTGAAGGNCGTGGAAGCCAGTTGCTACAAA
GAATGTTGATCAAGTGGAAATGTTTTGCTTTACGGCACCTT
GCGTGCCCCCCAAAAATAATGTGCAACACAGAAAAACCTAT
AAGGCTGAATACCAATGTACTCGGGAAATCAAGTTGCTCCG
CTTCAAATGCAAGGCAAATGGTTGTTGCAGTCTAACAATCT
GCCGGCAGCTCCACGTTACGATGGCTACATTTTCAAGAGTC
CAATGACCGTTTGTTTGGTTCAGTTGGTACTGAGGACTGCG
TTGGTTCTACAATTTGTCCAGGAAGTTGTCAAGTGCTGGGA
TGCCTTCTTTAAGTCCCTTTACGTTTTCGTGTCTCCGCAAC
AACCTGAGCAGGACGGCCAGAA
Sequence 9
GGAAGATATCCGCAGCACCCTGAGGGTCCCCGAAGAACA
ACGCGCGGGGCCCAAAACCCTATTGGGCGCGAACTCACGGA
GGAAGTAATGGCCACAAGGTTGGTACATCAAGGGCATAGCC
GAAGCCTGTGATATACTGACAGCCGGTCCCAAACCGCCCGG
AACTTACGACCCGGGAACCCAAAGTCCAAAGGCCGGGGGGC
CGAATGAGAGAGCCAAGATCGAATGAATAGGGTACACCTGA
CGGGGCCGCACATCGATGCCGGAAAAGCGATTGCACGCCAA
CTAATCCGATCCGGGGGGAAATCCCATATAAGGCCATTGGC
GGCATATGATGCATGAATTGCAATGGCAATCGTACATGACT
GAAAATGGGGGGGCATTTTACCGATGAACCATGGACCATTC
GGATTGCCATTACCATTTTGGGAAACGATGCATGAACCTGG
AGGAATTCCAGCAGTTAGGCAATTCGTTAGTTACCCAAATG
GAAATTTGCGCGACGACATGATGACG
Sequence 10
CGAGGGGGGGCCCGGTACCCAGCTTTTGTTCCCTTTAGT
GAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTG
TTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAA
CATACGAGCCGGGAGCATAAAGTGTAAAGCCTGGGGTGCCT
AATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTG
CCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTA
ATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTG
GGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGGGCTCG
GTCGNTCGGCTGCGGGGAGCGGTATCAACTTACTTCAAAGG
CGGGNAATACCGGTATNCACAAGAAACAAGGGGATAACGCA
LJGGAAAGAACATGTGAGCCAAAAAGGCCNGCCAAAANGGC
CANGGAACCCGNAAAAAANGGCCNCGGTTGGCTTGGCGNTT
TTTTCCATTAAGGCTTCCCGGCCCCCCCCTGGGGCGGAGGC
CATTTNNCAAAAAAAAATNNGACCCCCCTTCNAAAANNTNA
AANAANGGGGGGGGGGGAAAAACCCCCGNCCNNGGGGACCT
TNTTTAAAAGGAAATNCCCCAAGGGGGGGTTTTCCCCCCCT
GGGGAANACCTTCCCCTTTGGGGGGGGCCTT
Sequence 11
TCCCTCGGATAGCACAGTTGCCTAGGCAACTGTGCTATC
CGAGGGAGCATCATCAATACTGGACGAATTCTCTCTGCAAT
GGCCTGACGTAGCACCGTTTTAGTCTGTACACAGACGCCAG
ATACACAGTCCACAACCACCAGAGCACCATCTGTGACACGA
AGAGCAGCCGTTACTTCAGAGGAAAAGTCAACGTGGCCAGG
GGAGTCGATCCTCCCTCGGATAGCACAGTTGCCTAGGCAAC
TGTGCTATCCGAGGGAGCATCTCCGGGGGTGATAATGTAAC
ACAGGGACTTGTAGCCAATGTTTCCCGCCACATCGATTGGC
GTTACAGCAAACATCTGCTCCACCTCTTCGCTGAGAACTTG
CAGCTTGGGTCATCAGGAGTAGTTTCAACTCATCAGGAGTA
GGTTCAACTCATCCTTTTTAACATTTCCAGGGCCATTGGGG
GGCAAAGTTAATGTGAAGGACGAGGAACCGGAGGGAGATGC
TAAAGGAGGGAAAAGGTCCCATCAACCCCACGGGCCTTCCT
GGGCGCTATCCGCGAAAAGCTTAACGGGTCGGATCAACCTT
CTTTTGGGCAACCTGGCTTTCAAGGGCTTCACCGGATTATT
G
Sequence 12
AATAATAACGTGAAGGCCGTGGAAGCCAGTTGCTACAAA
GAATGTTGATCAAGTGGAAATGTTTTGCTTTACGGCACCTT
GCGTGCCCCCCAAAAATAATGTGCAACACAGAAAAACCTAT
AAGGCTGAATACCAATGTACTCGGGAAATCAAGTTGCTCCG
CTTCAAATGCAAGGCAAATGGTTGTTGCAGTCTAACAATCT
GCCGGCAGCTCCACGTTACGATGGCTACATTTTCAAGAGTC
CAATGACCGTTTGTTTGGTTCAGTTGGTACTGAGGACTGCG
TTGGTTCTACAATTTGTCCAGGAAGTTGTCAAGTGCTGGGA
TGCCTTCTTTAAGTCCCTTACGTTTTCGTGTCTCCGCAACA
ACCTGAGCAGGACGGCCAGAA
Sequence 13
AATAATAACGTGAAGGCCGTGGAAGCCAGTTGCTACAAA
GAATGTTGATCAAGTGGAAATGTTTTGCTTTACGGCACCTT
GCGTGCCCCCCAAAAATAATGTGCAACACAGAAAAACCTAT
AAGGCTGAATACCAATGTACTCGGGAAATCAAGTTGCTCCG
CTTCAAATGCAAGGCAAATGGTTGTTGCAGTCTAACAATCT
GCCGGCAGCTCCACGTTACGATGGCTACATTTTCAAGAGTC
CAATGACCGTTTGTTTGGTTCAGTTGGTACTGAGGACTGCG
TTGGTTCTACAATTTGTCCAGGAAGTTGTCAAGTGCTGGGA
TGCCTTCTTTAAGTCCCTTACGTTTTCGTGTCTCCGCAACA
ACCTGAGCAGGACGGCCAGAA
Sequence 14
AATAATAACGTGAAGGCCGTGGAAGCCAGTTGCTACAAA
GAATGTTGATCAAGTGGAAATGTTTTGCTTTACGGCACCTT
GCGTGCCCCCCAAAAATAATGTGCAACACAGAAAAACCTAT
AAGGCTGAATACCAATGTACTCGGGAAATCAAGTTGCTCCG
CTTCAAATGCAAGGCAAATGGNTGTTGCANNCTAACAATCT
GNCGGCAGCTCCACGTTACGATGGCTACATTTTCAAGAGTC
CAATGACCGTTTGTTTGGTTCAGTTGGTACTGAGGACTGCG
TTGGTTCTACAATTTGTCCAGGAAGTTGTCAAGTGCTGGGA
TGCCTTCTTTAAGTCCCTTACGTTTTCNTGTCTCCGCAACA
ACCTGAGCAGGACGGCCAGAAGGATCAACATTCTTTGTAGC
AACGNGGCTTCCACGGCCTTCCGTTATTTT
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bailey, J. and Driedzic, W. (1996). Decreased
total ventricular and mitochondrial protein synthesis during extended anoxia
in turtle heart. Am. J. Physiol.
271,R1660
-R1667.
Beltrami, A., Urbanek, K., Kajstura, J., Yan, S.-M., Finato, N.,
Bussani, R., Nadal-Ginard, B., Silvestri, F., Leri, A., Beltrami, A. and
Anversa, P. (2001). Evidence that human cardiac myocytes
divide after myocardial infarction. N. Eng. J. Med.
344,1750
-1757.
Branch, L. and Altig, R. (1983). Survival and behavior of four species of Ambystoma larvae under hypoxic conditions. Comp. Biochem. Physiol. 74A,395 -397.
Farrell, A., Franklin, C., Arthur, P., Thorarensen, H. and Cousin, K. (1994). Mechanical performance of an isolated in situ perfused heart from the turtle Chrysemys scripta during normoxia and anoxia at 5°C and 15°C. J. Exp. Biol. 191,207 -229.[Abstract]
Gamperl, K., Milson, W., Farrell, A. and Wang, T. (1999). Cardiorespiratory responses of the toad (Bufo marinus) to hypoxia at two different temperatures. J. Exp. Biol. 202,3647 -3658.[Abstract]
Gatz, R., Crawford, E., Jr and Piiper, J. (1974). Metabolic and heart rate response of the plethodontid salamander, Desmognathus fuscus, to hypoxia. Respir. Physiol. 20,43 -49.[Medline]
Gatz, R. and Piiper, J. (1979). Anaerobic energy metabolism during severe hypoxia in the lungless salamander Desmognathus fuscus (Plethodontidae). Respir. Physiol. 38,377 -384.[Medline]
Gracey, A. Y., Troll, J. V. and Somero, G. N.
(2001). Hypoxia-induced gene expression profiling in the euryoxic
fish Gillichthys mirabilis. Proc. Natl. Acad. Sci. USA
98,1993
-1998.
Guimond, R. W. and Hutchison, V. (1972). Pulmonary branchial and cutaneous gas exchange in the mud puppy, Necturus maculosus maculosus (Rafinesque). Comp. Biochem. Physiol. 42A,367 -392.
Hicks, J. and Wang, T. (1999). Hypoxic
hypometabolism in the anesthetized turtle, Trachemys scripta. Am.
J. Physiol. 277,R18
-R23.
Hubank, M. and Schatz, D. G. (1999). cDNA Representational Difference Analysis: A sensitive and flexible method for identification of differential expressed genes. Meth. Enzymol. 303,325 -349.[Medline]
Katz, A. M. (1992). Physiology of the Heart. Second edition. New York: Raven Press.655 pp.
Land, S. and Hochachka, P. (1995). A
heme-protein based oxygen-sensing mechanism controls the expression and
suppression of multiple proteins in anoxia-tolerant turtle hepatocytes.
Proc. Natl. Acad. Sci. USA
92,7505
-7509.
Mantz, D., Oberpriller, J. and Oberpriller, J. (1998). Comparison of mitosis in binucleated and mononucleated newt cardiac myocytes. Anat. Rec. 251,245 -255.[Medline]
McKean, T., Li, G. and Wei, K. (2001). Hypoxia in Tiger salmanders. FASEB J. 15, A89.
McKean, T., Scherzer, A. and Park, H. (1997). Hypoxia and ischemia in buffer perfused toad hearts. J. Exp. Biol. 200,2575 -2581.[Abstract]
Rohlicek, C., Saiki, C., Matsuoka, T. and Mortola, J.
(1998). Oxygen transport in conscious newborn dogs during hypoxic
hypometabolism. J. Appl. Physiol.
84,763
-768.
Sexton, O. and Bizer, J. (1978). Life history patterns of Ambystoma tigrinum in montane Colorado. Am. Midl. Nat. 99,101 -118.
Sheafor, E., Wood, S. and Tattersall, G. (2000). The effect of graded hypoxia an the metabolic rate and buccal activity of a lungless salamander (Desmognathus fuscus). J. Exp. Biol. 203,3785 -3793.[Abstract]
St-Pierre, J., Tattersall, G. and Boutilier, R.
(2000). Metabolic depression and enhanced O2 affinity
of mitochondria in hypoxic metabolism. Am. J. Physiol.
279,R1205
-R1214.
Storey, K. B. (1999). Stress-induced gene expression in freeze tolerant and anoxia tolerant vertebrates. In Environmental Stress and Gene Regulation (ed. K. B. Storey), pp. 1-23. Oxford: BIOS Scientific Publishers.
West, T. and Boutilier, R. (1998). Metabolic suppression in anoxic frog muscle. J. Comp. Physiol. 168B,273 -280.
Zwemer, C., Maginniss, L. and Prange, H. (1993). Mechanisms for maintenance of VO2 during progressive hypoxia in the axolotl, Ambystoma mexicanum, effect of chronic hypoxic exposure. FASEB J. 7,A5 .
Zwemer, C. and Prange, H. (1990). PO2 dependent O2 consumption in chronically hypoxic and normoxic axolotls (Ambystoma mexicanum). FASEB J. 4,A730 .
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
H. A. Shiels and E. White The Frank-Starling mechanism in vertebrate cardiac myocytes J. Exp. Biol., July 1, 2008; 211(13): 2005 - 2013. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||