|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
Characterization of the Drosophila melanogaster alkali-metal/proton exchanger (NHE) gene family
Division of Molecular Genetics, Institute of Biomedical and Life Sciences, University of Glasgow, Glasgow G11 6NU, UK
*Author for correspondence (e-mail: j.a.t.dow{at}bio.gla.ac.uk)
Accepted August 6, 2001
| Summary |
|---|
|
|
|---|
Key words: V-ATPase, epithelial transport, Malpighian tubule, Na+/H+ exchanger, Drosophila melanogaster.
| Introduction |
|---|
|
|
|---|
The Wieczorek model for ion transport
In insects, NHEs may play a significant additional role. Some animal plasma membranes, including most insect epithelia, are energised by proton-motive forces instead of the basolateral Na+/K+-ATPase that energises most animal epithelia (Harvey and Wieczorek, 1997; Klein et al., 1991; Wieczorek et al., 1991). In insect epithelia, apical plasma membrane H+ V-ATPases generate transmembrane electrochemical gradients, which in turn drive other processes such as acidification, fluid secretion and sensory signalling. According to the Wiezcorek model, the electrogenic V-ATPase drives one or more alkali-metal/proton exchangers, resulting in a net transepithelial transport of Na+ or K+. It has been established that the two transport functions are pharmacologically distinct because the V-ATPase is bafilomycin-sensitive (Wieczorek et al., 1991) and the antiport is sensitive to amiloride (Wieczorek, 1992). Although there is no reason a priori to assign such V-ATPase-partner antiporters to the NHE family [indeed, in Manduca sexta midgut, the exchanger may be electrogenic (Azuma et al., 1995)], both Na+ and K+ transport in insect epithelia are amiloride-sensitive (Hegarty et al., 1992; Wieczorek, 1992). It is therefore particularly interesting to characterise the insect NHE exchangers, both as possible candidates for the Wieczorek exchanger and as potential components of animal cell ionic regulation. Surprisingly, although there are some preliminary reports, no paper describing a sequence for insect cation/proton exchangers has been published.
The Drosophila melanogaster Malpighian tubule
The fruit fly Drosophila melanogaster is a useful genetic model with a completed genome sequence (Adams et al., 2000), powerful transgenic technology (Rubin, 1988; Spradling and Rubin, 1982; Spradling et al., 1995). It also serves as a good experimental model, permitting the use of biochemical, cell biological and physiological techniques in disciplines such as developmental biology, neurobiology (Rubin, 1988) and integrative physiology (Dow et al., 1998). The Malpighian tubule of D. melanogaster is known to be sensitive to both bafilomycin and amiloride (Dow et al., 1994), consistent with the V-ATPase/antiporter in that it has been shown to be energised by an apical V-ATPase confined to the principal cells (Davies et al., 1996). However, amiloride is a relatively non-specific probe for NHE function because it also inhibits a range of Na+ channels (Kleyman and Cragoe, 1988). In the present paper, we show that fluid secretion in the Malpighian tubules is inhibited by amiloride derivatives that are consistent with inhibition of NHEs rather than Na+ channels. Furthermore, no expression of epithelial Na+ channels (ENaCs) could be detected by reverse transcriptase/polymerase chain reaction (RT-PCR) in Malpighian tubules. In contrast, the Drosophila NHE family is shown to consist of three genes, called DmNHE1, DmNHE2 and DmNHE3, that encode distant relatives of the NHE exchanger family, all of which are expressed in Malpighian tubules.
| Materials and methods |
|---|
|
|
|---|
Fluid secretion assays
Malpighian tubules were dissected from adult female and male flies, and fluid secretion assays were performed as described previously (Dow et al., 1994). The bathing medium was a mixture of Schneiders insect culture medium and Drosophila saline (1:1 v/v). Drosophila saline (pH 6.7) consisted of (in mmol l1): NaCl, 117.5; KCl, 20; CaCl2, 2; MgCl2, 8.5; NaHCO3, 10.2; NaH2PO4, 4.3; Hepes, 15; glucose, 20. Volumes of secreted fluid were determined at 10 min intervals. The data were analysed using an Apple Macintosh computer and Excel 4.0. All data are reported as means ± S.E.M. Statistical significance of differences between treatments was assessed using Students t-test for unpaired samples, taking the critical value of P to be 0.05 (two-tailed).
Cardioacceleratory peptide 2b (CAP2b) and Drosophila leucokinin were custom-synthesised by Research Genetics, Inc. and added to tubules at 107 mol l1. This combined treatment powerfully stimulates diuresis, acting both on active cation transport and on the Cl shunt conductance (Dow and Davies, 2001; Dow et al., 1998), and so was expected to unmask any inhibition by amiloride. Amiloride (Sigma-Aldrich A7410) and 5-N,N-dimethyl amiloride (DMA) (Sigma-Aldrich A4562) were dissolved to 10500 mmol l1 in dimethylsulphoxide (DMSO), then 1:100 in Schneiders/saline, and used at a range of concentrations together with 1:100 (final dilution) DMSO in Schneiders/saline as the vehicle. Benzamil (Sigma-Aldrich B-2417), 2',4'-dichlorobenzamil (DCB; Molecular Probes D-6898) and 5-N-ethyl-N-isopropyl amiloride (EIPA; Sigma-Aldrich A3085) were dissolved in methanol to 50100 mmol l1, then diluted 1:100 in Schneiders/saline and used at a range of concentrations, together with 1:100 (final concentration) methanol in Schneiders/saline as the vehicle. Neither DMSO nor methanol vehicles had any effect on Malpighian tubules at these final concentrations (data not shown). The amiloride analogue was added to half the tubules after 30 min, and all the tubules were then treated with Drosophila leucokinin and CAP2b at 60 min. Secretion assays were performed at a range of concentrations from 104 mol l1 to 108 mol l1, and dose/response curves were plotted. For each experimental set of at least 10 tubules, the response to amiloride was defined as the mean maximum secretion rate (controls) minus the mean maximum secretion rate (amiloride-treated). This value was expressed as a percentage of the control maximum secretion rate.
Cyberscreening
Cyberscreening was performed using Netscape Communicator 4.5 on an Apple Macintosh computer and searching NCBI (http://www.ncbi.nlm.nih.gov/) and BDGP (http://www.fruitfly.org) databases with BLASTN, BLASTP, BLASTX or TBLASTN searches, as appropriate. Sequence alignments were performed and displayed using MacVector 6.5.1 or 7.0, AssemblyLIGN, SeqVu 1.0.1, ClustalW PPC and TreeView PPC.
RT-PCR
mRNA was prepared using the Dynabeads Oligo (dT)25 kit according to the manufacturers protocol (Dynex Technologies) and reverse-transcribed with SUPERSCRIPT II RNase H reverse transcriptase (Life Technologies) to produce a solid-state cDNA library. For each PCR reaction, 1 µl of beads, corresponding to cDNAs derived from one Malpighian tubule or approximately 0.2 head, was used. RT-PCR was performed on cDNA from whole male flies, whole female flies, heads, bodies, tubules, larvae and pupae using primers designed to bracket introns as a guard against genomic DNA contamination.
PCRs were performed as follows: 94°C for 1 min; followed by 30 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 2 min (depending on the length of the DNA template), and finally one cycle of 72°C for 5 min. PCR reactions were analysed on 1 % agarose gels, stained with ethidium bromide and photographed according to standard protocols (Sambrook and Russell, 2001).
cDNA clones
Low-stringency searches of the Drosophila genome allowed three candidate genetic loci to be identified. cDNA clones were identified by BLAST searching against expressed sequence tags (ESTs), using genomic sequence for each gene as a probe. All available clones were obtained from Research Genetics. No EST hits were obtained for DmNHE2, implying that it was not widely expressed. EST clones HL05853, AT11019 and LP03712, identified as the longest available 5' clones for DmNHE1, DmNHE2 and DmNHE3, respectively, on the basis of available EST information, were sequenced in full on both strands. To survey for possible alternative 3' splicing, the 3' ends of the other EST clones were also sequenced.
Primers used were as follows:
DmNHE1-2306R, CCCCACAACAGCCATTTAAT; Dm-NHE1-F1, AGCGACCACGTCACGTTTTGTC; DmNHE3-1943F, TACGAATGGCAGTTTGGG; DmNHE3-2700R, CATTTTCGATTTCAGTTGAGACC; DmNHE2-F2, TC-TACATGCTTCCACCGATTATCC; DmNHE2-R2, AGT-GAGGCAAATAGAAACACGTCC; DmNHE2-1684F, TT-GGCGTGGTGCTCTATTTC; DmNHE2-3509F, CCT- GCGGAAAGATGGGAATTTAC; DmNHE2-3803F, TGT- GATGTACCACATGATGGAG; DmNHE2-3849R, TGT-CCAAGCCAATCTCATTGTAGG; DmNHE2-4088R, AAA- TGGGTTCTATGACACGCAC; DmNHE2-4859F, TCAC-TTGATGGCTGGAATTGAG; DmNHE2-5324F, GAGCTG-AGCCGAAGATCATC; DmNHE2-5367R, CATCGTGAG-TTTGGAGTACGTC; DmNHE2-59554R, TCAGAGATC- AGAGAGACAGAGAGAG; PM001, CGTTAGAACGCGG-CTACAAT; M13 Forward, CTGGCCGTCGTTTTAC; M13 Reverse, CAGGAAACAGCTATGAC.
| Results |
|---|
|
|
|---|
|
|
Amiloride-sensitive Na+ channels previously described in Drosophila include two Drosophila degenerin/ENaC family genes, pickpocket (ppk) and ripped pocket (rpk) (Adams et al., 1998). Pickpocket appears to be abundantly transcribed in early-stage embryos and is possibly involved in early development, whereas ripped pocket is found in a subset of neurons of the peripheral nervous system and is amiloride-sensitive (Adams et al., 1998). Ripped pocket is identical to dGNaC1 (Darboux et al., 1998a) and pickpocket is identical to dmdNaC1 (Darboux et al., 1998b), genes found in the peripheral nervous system and the gonads, respectively. dGNaC1 has been shown to be amiloride-sensitive by expression in Xenopus laevis oocyte, whereas the amiloride sensitivity of dmdNaC1 is inferred from sequence similarity.
Our search of the Berkeley Drosophila genome project for Na+ channels led to the identification of nine genes, rpk, ppk, CG10972, CG14398, CG4805, CG8546, CG9499 and Nach. These genes are divergent in sequence, being at least as related to the human search sequence as to each other (Fig. 2A). By RT-PCR, none of these genes was detected in Malpighian tubules: some appeared to be expressed in heads or whole flies only, and for others, no expression could be detected (Fig. 2B). This is consistent with recent data implicating Drosophila ENaCs in very specialised roles in thermoreception (Zinkevich et al., 2001) and salt taste perception (Liu et al., 2001).
|
|
|
|
|
|
Alignment and phylogenetic relationships
The Drosophila NHE sequences were used in further BLAST searches to identify other members of the NHE family. Amongst proteins identified were those from a variety of species, mammalian (human, rat, bovine) and other vertebrate (trout, Cyprinus carpio NHE) and invertebrate (crab, Caenorhabditis elegans) sequences. Amongst these sequences were a number of novel human NHE protein sequences, a protein previously identified as KIAA0939, which is the closest homologue to DmNHE1 (55 % identity at the amino acid level) and 13 sequences newly emerged from the human genome project, partial protein sequences from working drafts of the human genome. KIAA0939 was identified in IMAGE clone 3134373 (GenBank accession number BF222481), from a Homo sapiens kidney cDNA library.
The Drosophila NHEs were aligned to the human and other members of the NHE family of exchangers (Fig. 7), and a phylogenetic tree was constructed to examine similarities between the different family members (Fig. 8). The alignment shows that the Drosophila NHEs are definitely members of the family, with different Drosophila NHEs more similar to different branches of the family. DmNHE1 is most closely related to the novel human NHE KIAA0939 and to some novel sequences from working drafts. DmNHE3 is more closely related to some new human NHE draft sequences and the human NHE6, which is the mitochondrial NHE isoform (Numata et al., 1998). DmNHE2, in contrast, is more closely related to the crab NHE from Carcinus maenas and to the exchanger from the yellow fever mosquito Aedes aegypti.
|
Expression patterns of Drosophila NHEs
Expression patterns of DmNHE1, DmNHE2 and DmNHE3 were mapped by RT-PCR using cDNA derived from a variety of tissues using primers designed to bracket introns and using genomic DNA as a positive control for the reaction (Fig. 9). This experiment showed that all three genes are expressed in the head, body and Malpighian tubules and at all developmental stages, indicating that they are widely expressed.
|
| Discussion |
|---|
|
|
|---|
benzamil (Fig. 1; Table 1). These results are consistent with those recently obtained in Aedes aegypti (Petzel, 2000), increasing our confidence that amiloride targets NHEs in insect Malpighian tubules. This is also consistent with our RT-PCR data showing that Drosophila NHE genes, but not ENaC genes (Fig. 9, see also Fig. 2), are expressed in Malpighian tubules. Our failure to identify ENaCs in Malpighian tubules is consistent with electrophysiological analysis, which showed that amiloride inhibited transepithelial Na+ secretion in Aedes aegypti Malpighian tubules without any effect on transepithelial and fractional membrane resistance (Hegarty et al., 1992).
The Drosophila NHE family
This paper describes three genes that appear to encode the Drosophila members of the NHE gene family. Their protein sequences are quite different from the protein sequences of the other members of the family, but there is sufficient similarity to the other NHEs to assign them unambiguously to this group of proteins (Fig. 6). More specifically, DmNHE1 appears to be very similar to a novel human NHE, KIAA0939, which has been found in kidney (IMAGE 3134373) and brain (GenBank accession number AB023156) (Nagase et al., 1999). DmNHE2 is most similar to two invertebrate NHEs, the NHE found in Carcinus maenas and the newly described NHE3 in Aedes aegypti (GenBank accession number AF80554; S. S. Gill, H. Wediak and L. S. Ross, unpublished). DmNHE3 sits near human mitochondrial NHE6 (although DmNHE3 encodes no mitochondrial targeting sequences) and also close to Arabidopsis thaliana and yeast genes.
The three DmNHEs described above are predicted to be plasma membrane integral proteins with 1012 transmembrane domains just like the other members of the family (Fig. 6). All the Drosophila NHEs have a putative signal peptide and a possible cleavage site. This is similar to the position in mammalian NHEs, although it is not certain whether the signal peptide is ever cleaved (Zizak et al., 2000); see Shrode et al. (Shrode et al., 1998) and Wakabayashi et al. (Wakabayashi et al., 2000). The presence of distinct messages for DmNHE2, encoding peptides with differing C-terminal domains, has interesting implications for control of the exchanger.
In principle, the elucidation of genes in Drosophila would allow the reverse genetic analysis of their function in mutants. However, there are no candidate P-element insertions documented at any of the three loci. The nearest mutation is an insertion, 2 kb beyond the 3' end of DmNHE3, that generates a lethal recessive phenotype. However, this insertion is at the 5' end of a novel gene (CG11329), and so the lethality is probably attributable to the latter locus.
Are any of these genes candidates for the Wieczorek exchanger? Their relative dissimilarity to cardinal vertebrate NHEs (Fig. 8) would allow them to be ascribed different functional properties. For example, DmNHE2 sits in a branch of the similarity tree with only invertebrate representatives and so would be a strong candidate. Our data show that, in Drosophila, all three exchangers are widely expressed (Fig. 9) and are certainly present in a relevant epithelium (the Malpighian tubule). However, the same general expression pattern would argue against a specialised role in transporting epithelia only, and our pharmacological analysis (Fig. 1) does not distinguish between an apical or basolateral localisation. Recent electrophysiological evidence suggests that amiloride may be acting at the basolateral membrane of Aedes aegypti Malpighian tubules (Petzel, 2000), and our results cannot be taken to contradict this view. In insects, it may have been naïve to assume that sensitivity to bafilomycin and amiloride is sufficient proof that an epithelium conforms to the Wieczorek model. However, whether DmNHE1, DmNHE2 or DmNHE3 transpires to be the elusive apical exchanger, or a vital part of the cells ion-regulatory machinery, the description of this gene family in a genetic model organism should be useful.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Adams, C. M., Anderson, M. G., Motto, D. G., Price, M. P., Johnson, W. A. and Walsh, M. J. (1998). Ripped Pocket and Pickpocket, novel Drosophila DEG/ENaC subunits expressed in early development and in mechanosensory neurons. J. Cell Biol. 140, 143152.
Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A., Gocayne, J. D., Amanatides, P. G., Scherer, S. E., Li, P. W., Hoskins, R. A., Galle, R. F. and et al. (2000). The genome sequence of Drosophila melanogaster. Science 287, 21852195.
Attaphitaya, S., Park, K. and Melvin, J. E. (1999). Molecular cloning and functional expression of a rat Na+/H+ exchanger (NHE5) highly expressed in the brain. J. Biol. Chem. 274, 43834388.
Azuma, M., Harvey, W. R. and Wieczorek, H. (1995). Stoichiometry of K+/H+ antiport helps to explain extracellular pH 11 in a model epithelium. FEBS Lett. 361, 153156.[Medline]
Bairoch, A., Bucher, P. and Hofmann, K. (1997). The PROSITE database, its status in 1997. Nucleic Acids Res. 25, 217221.
Brant, S. R., Yun, C. H., Donowitz, M. and Tse, C. M. (1995). Cloning, tissue distribution and functional analysis of the human Na+/H+ exchanger isoform, NHE3. Am. J. Physiol. 269, C198C206.
Busch, S. (1997). Cloning and sequencing of the cDNA encoding for a Na+/H+ exchanger from Xenopus laevis oocytes (X1-NHE). Biochim. Biophys. Acta 1325, 1316.[Medline]
Darboux, I., Lingueglia, E., Champigny, G., Coscoy, S., Barbry, P. and Lazdunski, M. (1998a). dGNaC1, a gonad-specific amiloride sensitive Na+ channel. J. Biol. Chem. 273, 94249429.
Darboux, I., Lingueglia, E., Pauron, D., Barbry, P. and Lazdanski, M. (1998b). A new member of the amiloride sensitive sodium channel family in Drosophila melanogaster peripheral nervous system. Biochem. Biophys. Res. Commun. 246, 210216.[Medline]
Davies, S. A., Kelly, D. C., Goodwin, S. F., Wang, S.-Z., Kaiser, K. and Dow, J. A. T. (1996). Analysis and inactivation of vha55, the gene encoding the V-ATPase B-subunit in Drosophila melanogaster, reveals a larval lethal phenotype. J. Biol. Chem. 271, 3067730684.
Dow, J. A. T. and Davies, S. A. (2001). The Drosophila melanogaster Malpighian tubule. Adv. Insect Physiol. 28, 183.
Dow, J. A. T., Davies, S. A. and Sozen, M. A. (1998). Fluid secretion by the Drosophila Malpighian tubule. Am. Zool. 38, 450460.
Dow, J. A. T., Maddrell, S. H. P., Görtz, A., Skaer, N. V., Brogan, S. and Kaiser, K. (1994). The Malpighian tubules of Drosophila melanogaster: a novel phenotype for studies of fluid secretion and its control. J. Exp. Biol. 197, 421428.[Abstract]
Harvey, W. R. and Wieczorek, H. (1997). Animal plasma membrane energization by chemiosmotic H+ V-ATPases. J. Exp. Biol. 200, 203216.[Abstract]
Hegarty, J. L., Carroll, M. C., Cragoe Jr, E. J. and Beyenbach, K. W. (1992). Effects of amiloride on isolated Malpighian tubules of the yellow fever mosquito (Aedes aegypti). J. Insect Physiol. 38, 329337.
Klanke, C. A., Su, Y. R., Callen, D. F., Wang, Z., Meneton, P., Baird, N., Kandasamy, R. A., Orlowski, J., Otterud, B. E., Leppert, M., Shull, G. E. and Menon, A. G. (1995). Molecular cloning and physical and genetic mapping of a novel human Na+/H+ exchanger (NHE5/SLC9A5) to chromosome 16q22. Genomics 25, 615622.[Medline]
Klein, U., Löffelmann, G. and Wieczorek, H. (1991). The midgut as a model system for insect K+-transporting epithelia: immunocytochemical localization of a vacuolar-type H+ pump. J. Exp. Biol. 161, 6175.
Kleyman, T. R. and Cragoe, E. J., Jr (1988). Amiloride and its analogs as tools in the study of ion transport. J. Membr. Biol. 105, 121.[Medline]
Liu, L., Johnson, W. A. and Welsh, M. J. (2001). Defective salt taste behavior caused by disruption of DEG/ENaC protein function in Drosophila melanogaster. In Proc. 42nd International Drosophila Conference, p. 23. Washington, DC: Genetics Society of America.
Malakooti, J., Dahdal, R. Y., Schmidt, L., Layden, T. J., Dudeja, P. K. and Ramaswamy, K. (1999). Molecular cloning, tissue distribution and functional expression of the human Na+/H+ exchanger NHE2. Am. J. Physiol. 277, G383G390.
Marra, M. A., Prasad, S. S. and Baillie, D. L. (1993). Molecular analysis of two genes between let-653 and let-56 in the unc-22(IV) region of Caenorhabditis elegans. Mol. Gen. Genet. 236, 289298.[Medline]
McLean, L. A., Zia, S., Gorin, F. A. and Cala, P. M. (1999). Cloning and expression of the Na+/H+ exchanger from Amphiuma RBCs: resemblance to mammalian NHE1. Am. J. Physiol. 276, C1025C1037.
Mitchell, P. (1961). Coupling of phosphorylation to electron and hydrogen transfer by a chemiosmotic type of mechanism. Nature 191, 144146.[Medline]
Nagase, T., Ishikawa, K., Suyama, M., Kikuno, R., Hirosawa, M., Miyajima, N., Tanaka, A., Kotani, H., Nomura, N. and Ohara, O. (1999). Prediction of the coding sequences of unidentified human genes. XIII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. DNA Res. 6, 6370.[Abstract]
Nakai, K. and Horton, P. (1999). PSORT: a program for detecting sorting signals in proteins and predicting their subcellular localization. Trends Biochem. Sci. 24, 3436.[Medline]
Noel, J. and Pouyssegur, J. (1995). Hormonal regulation, pharmacology and membrane sorting of vertebrate Na+/H+ exchanger isoforms. Am. J. Physiol. 268, C283C296.
Numata, M., Petrecca, K., Lake, N. and Orlowski, J. (1998). Identification of a mitochondrial Na+/H+ exchanger. J. Biol. Chem. 273, 69516959.
Orlowski, J. and Grinstein, S. (1997). Na+/H+ exchangers of mammalian cells. J. Biol. Chem. 272, 2237322376.
Orlowski, J., Kandasamy, R. A. and Shull, G. E. (1992). Molecular cloning of putative members of the Na/H exchanger gene family. cDNA cloning, deduced amino acid sequence and mRNA tissue expression of the rat Na/H exchanger NHE-1 and two structurally related proteins. J. Biol. Chem. 267, 93319339.
Padan, E. and Schuldiner, S. (1994). Molecular biology of Na+/H+ antiporters: molecular devices that couple the Na+ and H+ circulation in cells. Biochim. Biophys. Acta 1187, 206210.[Medline]
Petzel, D. H. (2000). Na+/H+ exchange in mosquito Malpighian tubules. Am. J. Physiol. 279, R1996R2003.
Quintero, F. J., Blatt, M. R. and Pardo, J. M. (2000). Functional conservation between yeast and plant endosomal Na+/H+ antiporters. FEBS Lett. 471, 224228.[Medline]
Rubin, G. M. (1988). Drosophila melanogaster as an experimental organism. Science 240, 14531459.
Sambrook, J. and Russell, D. W. (2001). Molecular Cloning. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Sardet, C., Franchi, A. and Pouyssegur, J. (1988). Molecular cloning of the growth-factor-activatable human Na+/H+ antiporter. Cold Spring Harb. Symp. Quant. Biol. 53, 10111018.
Shrode, L. D., Gau, B. S., DSouza, S. J. A., Orlowski, J. and Grinstein, S. (1998). Topological analysis of NHE1, the ubiquitous Na+/H+ exchanger, using chymotryptic cleavage. Am. J. Physiol. 275, C431C439.
Shi, H., Ishitani, M., Kim, C. and Zhu, J.-K. (2000). The Arabidopsis thaliana salt tolerance gene SOS1 encodes a putative Na+/H+ antiporter. Proc. Natl. Acad. Sci. USA 97, 68966901.
Spradling, A. C. and Rubin, G. M. (1982). Transposition of cloned P elements into Drosophila germ line chromosomes. Science 218, 341347.
Spradling, A. C., Stern, D., Kiss, I., Roote, J., Laverty, T. and Rubin, G. M. (1995). Gene disruptions using P transposable elements: an integral component of the Drosophila genome project. Proc. Natl. Acad. Sci. USA 92, 1082410830.
Towle, D. W., Rushton, M. E., Heidysch, D., Magnani, J. J., Rose, M. J., Amstutz, A., Jordan, M. K., Shearer, D. W. and Wu, W. S. (1997). Sodium/proton antiporter in the euryhaline crab Carcinus maenas: molecular cloning, expression and tissue distribution. J. Exp. Biol. 200, 10031014.[Abstract]
von Heijne, G. (1992). Membrane protein structure prediction. Hydrophobicity analysis and the positive-inside rule. J. Mol. Biol. 225, 487494.[Medline]
Wakabayashi, S., Pang, T., Su, X. and Shigekawa, M. (2000). A novel topology model of the human Na+/H+ exchanger isoform 1. J. Biol. Chem. 275, 79427949.
Wakabayashi, S., Shigekawa, M. and Pouyssegur, J. (1997). Molecular physiology of vertebrate Na+/H+ exchangers. Physiol. Rev. 77, 5174.
Wieczorek, H. (1992). The insect V-ATPase, a plasma-membrane proton pump energizing secondary active transport molecular analysis of electrogenic potassium transport in the tobacco hornworm midgut. J. Exp. Biol. 172, 335343.
Wieczorek, H., Putzenlechner, M., Zeiske, W. and Klein, U. (1991). A vacuolar-type proton pump energizes K+/H+ antiport in an animal plasma membrane. J. Biol. Chem. 266, 1534015347.
Zinkevich, N., Bosenko, D., Liu, L., Israel, P., Welsh, M. J. and Johnson, W. A. (2001). Thermosensory function of Drosophila epithelial sodium channel family members in antennae and maxillary palp. In Proc. 42nd International Drosophila Conference, p. 23. Washington, DC: Genetics Society of America.
Zizak, M., Cavet, M. E., Bayle, D., Tse, C.-M., Hallen, S., Sachs, G. and Donowitz, M. (2000). Na+/H+ exchanger NHE3 has 11 membrane spanning domains and a cleaved signal peptide: topology analysis using in vitro transcription/translation. Biochemistry 39, 81028112.[Medline]
This article has been cited by other articles:
![]() |
J. P. Day, S. Wan, A. K. Allan, L. Kean, S. A. Davies, J. V. Gray, and J. A. T. Dow Identification of two partners from the bacterial Kef exchanger family for the apical plasma membrane V-ATPase of Metazoa J. Cell Sci., August 1, 2008; 121(15): 2612 - 2619. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Hille and B. Walz Characterisation of neurotransmitter-induced electrolyte transport in cockroach salivary glands by intracellular Ca2+, Na+ and pH measurements in duct cells J. Exp. Biol., February 15, 2008; 211(4): 568 - 576. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Rheault, B. A. Okech, S. B. W. Keen, M. M. Miller, E. A. Meleshkevitch, P. J. Linser, D. Y. Boudko, and W. R. Harvey Molecular cloning, phylogeny and localization of AgNHA1: the first Na+/H+ antiporter (NHA) from a metazoan, Anopheles gambiae J. Exp. Biol., November 1, 2007; 210(21): 3848 - 3861. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Kang'ethe, K. G. Aimanova, A. K. Pullikuth, and S. S. Gill NHE8 mediates amiloride-sensitive Na+/H+ exchange across mosquito Malpighian tubules and catalyzes Na+ and K+ transport in reconstituted proteoliposomes Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1501 - F1512. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Hille and B. Walz A vacuolar-type H+-ATPase and a Na+/H+ exchanger contribute to intracellular pH regulation in cockroach salivary ducts J. Exp. Biol., April 15, 2007; 210(8): 1463 - 1471. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Pullikuth, K. Aimanova, W. Kang'ethe, H. R. Sanders, and S. S. Gill Molecular characterization of sodium/proton exchanger 3 (NHE3) from the yellow fever vector, Aedes aegypti J. Exp. Biol., September 15, 2006; 209(18): 3529 - 3544. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Ianowski and M. J. O'Donnell Electrochemical gradients for Na+, K+, Cl- and H+ across the apical membrane in Malpighian (renal) tubule cells of Rhodnius prolixus J. Exp. Biol., May 15, 2006; 209(10): 1964 - 1975. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. C. Lin, W. P. Williams, Y. Luu, R. S. Molday, J. Orlowski, and M. Numata Secretory carrier membrane proteins interact and regulate trafficking of the organellar (Na+,K+)/H+ exchanger NHE7 J. Cell Sci., May 1, 2005; 118(9): 1885 - 1897. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Brett, M. Donowitz, and R. Rao Evolutionary origins of eukaryotic sodium/proton exchangers Am J Physiol Cell Physiol, February 1, 2005; 288(2): C223 - C239. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Massaro, L. W. Lee, A. B. Patel, D. S. Wu, M.-J. Yu, B. N. Scott, D. A. Schooley, K. M. Schegg, and K. W. Beyenbach The mechanism of action of the antidiuretic peptide Tenmo ADFa in Malpighian tubules of Aedes aegypti J. Exp. Biol., July 15, 2004; 207(16): 2877 - 2888. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Dailianis and M. Kaloyianni Cadmium induces both pyruvate kinase and Na+/H+ exchanger activity through protein kinase C mediated signal transduction, in isolated digestive gland cells of Mytilus galloprovincialis (L.) J. Exp. Biol., April 15, 2004; 207(10): 1665 - 1674. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Pullikuth, V. Filippov, and S. S. Gill Phylogeny and cloning of ion transporters in mosquitoes J. Exp. Biol., November 1, 2003; 206(21): 3857 - 3868. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||