|
| ![]() |
|
||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
TEMPERATURE AND MYOGENIC FACTOR TRANSCRIPT LEVELS DURING EARLY DEVELOPMENT DETERMINES MUSCLE GROWTH POTENTIAL IN RAINBOW TROUT (ONCORHYNCHUS MYKISS) AND SEA BASS (DICENTRARCHUS LABRAX)
1
Department of Anatomy and Developmental Biology, Royal Free and University
College Medical School, University of London, Rowland Hill Street, London NW3
2PF, UK
2
Department of Veterinary Basic Sciences, The Royal Veterinary College,
University of London, Royal College Street, London NW1 OTU, UK
3
INRA-IFREMER, Station D Hydrobiologie 64310 Saint
Pée Sur Nivelle, France
4
Biology Department, University of Crete, PO Box 1470, 71110 Iraklio,
Crete, Greece
5
Institute of Marine Biology of Crete, PO Box 2214, 71003 Iraklio, Crete,
Greece
6
INRA Fish Physiology, Campus de Beaulieu, 35042 Rennes, France
*
Author for correspondence (e-mail:
g.goldspink{at}rfc.ucl.ac.uk
)
Accepted May 17, 2001
| Summary |
|---|
|
|
|---|
Key words: Muscle development, trout, sea bass, growth, MyoD, myogenin, myosin, MRF, rainbow trout, Oncorhynchus mykiss, sea bass, Dicentrarchus labrax
| Introduction |
|---|
|
|
|---|
Muscle in fish, which is the major edible tissue, represents about 60% of
total body mass. Skeletal muscle development in fish differs from that of
mammalian muscle in that in fish muscle mass continues to increase throughout
the animal's lifetime by hyperplasia and hypertrophy (Weatherley et al.,
1988
). In mammals it has been
shown that, after embryological differentiation, muscle growth occurs mainly
by hypertrophy of existing fibres (Stickland,
1983
). However, in fish the
initial developmental processes may determine the extent of both muscle
hyperplasia and muscle hypertrophy post-hatching (Veggetti et al.,
1990
).
Myogenic regulatory factors (MRFs), such as MyoD and myogenin, play an
important role in the initial formation and differentiation of skeletal muscle
(Weintraub et al., 1989
;
Krempler and Brenig, 1999
;
Sabourin and Rudnicki, 2000
).
Fish as ectotherms offer the possibility of manipulating the levels of MRFs
thus enabling the effects on development to be studied in relation to number
of muscle fibres formed and the expression of structural genes. In rainbow
trout, recent studies have indicated that the timing and spatial expression of
myogenic regulatory factors (MRFs) are important during early development. Two
MyoD genes exist in trout, TMyoD and TmyoD2 (Rescan and Gauvry,
1996
). TmyoD was first
detected in the adaxial cells of forming somites from the midgastrula on
either side of the elongating embryonic shield; TmyoD2 is expressed later in
the posterior compartment of somites (stage 14), which have already formed. In
the adult skeletal musculature, the TMyoD2 mRNA transcript is only detected in
red muscle (Delalande and Rescan,
1999
). The first expression of
myogenin is only seen in somites formed when around 15 somites are present
(Rescan et al., 1995
; Rescan
et al., 1999
; S. Q. Xie, D.
Wilkes, S. Andre, P. S. Mason, J. Bredi, G. Goldspink, B. Fauconneau and N. C.
Stickland, manuscript submitted for publication).
Myosin is the most abundant protein in muscle, and in fish this is the most
abundant tissue. As well as encoding proteins that have a structural function,
the myosin heavy chain (MyHC) genes also encode the molecular motors that
generate the contractile power for movement. Therefore the MyHC genes seem to
be the appropriate choice for assessing muscle gene expression in general. One
problem is that these are part of a multigene family, which is even larger in
fish than it is in mammals. In some species different MyHC genes are expressed
at warm temperatures than at cold temperatures during seasonal adaptation
(Gerlach et al., 1990
) and at
different developmental stages (Ennion et al.,
1999
). With respect to
development, it is possible that regulatory sequences ensure expression of the
correct MyHC genes in the type of environment that exists in embryonic cells,
and this involves the MRFs. The effect of temperature on muscle development in
rainbow trout was investigated and it was found that with increased incubation
temperature, from 5°C to 10°C, the observed fibre number decreased
(Matscha et al., 1998
).
Another study (S. Q. Xie, D. Wilkes, S. Andre, P. S. Mason, J. Bredi, G.
Goldspink, B. Fauconneau and N. C. Stickland, manuscript submitted for
publication) indicated that low incubation temperature (4°C) delays
myogenin expression and muscle differentiation in rainbow trout embryos when
compared with a higher temperature (12°C). This study indicated a greater
distribution of myogenin throughout the somites in fish reared at lower
incubation temperatures, and this was associated with a greater number of
muscle fibres at hatching.
The aim of the present study was to examine if there is a correlation between water temperature during early larvae fish muscle development and the levels of mRNA of MyoD and myogenin genes in relation to muscle development, in two species of fish that are adapted to different environmental temperatures and are also of considerable economic importance.
| Materials and methods |
|---|
|
|
|---|
Sea bass (Dicentrarchus labrax) were incubated at the experimental
aquaculture facilities of the Institute of Marine Biochemistry of Crete
(Heraklion Crete, Greece). After fertilisation (
epiboly), the eggs
were divided into three groups and incubated at different fixed temperatures
during development: 20.0±0.2°C, 15.0±0.1°C and
13.0±0.2°C (mean ± S.D.). Stages of sea bass embryonic and
yolk sac larval development were defined according to Divanach (Divanach,
1985
).
Species-specific gene probes by cDNA isolation and cloning cDNA
synthesis
Total RNA (1 µg) extracted from either trout or sea bass white muscle by
the method described by Chomczynski and Sacchi (Chomczynski and Sacchi,
1987
) was resuspended in 11
µl of DEPC (diethylpyrocarbonate)-treated water, heated to 70°C for 10
min, then quickly chilled on ice. To this was added 1 µl of RNAase
inhibitor (40 units, Promega), 4 µl first strand buffer (GibcoBRL catalogue
number Y00146), 2 µl 0.1 mol 1-1 DTT and 500 µg (1 µl) of
the oligonucleotide primer RoRiT17: (5'
ATCGATGGTCGACGCATGCGGATCCAAAGCTTGAATTCGAGCTCTTTTTTTTTTTTTTTTT 3')
(Harvey and Darlison, 1991
).
The mix was incubated to bring the temperature to 42°C for 2 min, 1 µl
(200 units) of SuperscriptII (GibcoBRL catalogue number 18064-022) was added
and the incubation was continued at 42°C for 50 min. Heating at 70°C
for 15 min inactivated the enzyme.
Polymerase chain reaction
PCR (polymerase chain reaction) of first-strand cDNA and cloning to obtain
species-specific probes were performed using methods described by Ennion et
al. (Ennion et al., 1999
),
except that the PCR products were subcloned in the vector pGEM T easy
(Promega). Primers used for PCR cloning are listed below. Reverse primer for
all reactions was the universal primer (Ro) that hybridised to the RoRiT17
primer sequence used for first strand cDNA synthesis: (5'
ATCGATGGTCGACGCATGCGGATCC 3'). Primers used for PCR to obtain clones for
species-specific MyoD, myogenin and MyHC were chosen from regions of DNA that
showed high interspecies DNA homology, thus MyoD: (5'
CCAACTGCTCAGACGGAATGATGGA 3'), myogenin: (5'
CTGACGTCCATCGTGGACAGCATC 3'), fast (white) MyHC: (5'
GAGAAGATGTGCCGTACTCTTGAG 3').
Inserts were confirmed by sequencing with universal vector primers (T7 and SP6) and Amersham Pharmacia Biotech T7 Sequenase Kit. Subsequent sequence identification was performed using Blast search in the EMBL database.
In situ hybridisation
As the RNA for the northern blot was extracted from pooled samples of whole
eggs or larvae, in situ hybridisation was used to determine whether
the gene probes were tissue specific. The whole-mount in situ method
was as described by Ennion et al. (Ennion et al.,
1999
)
(Fig. 1).
|
Quantification of MRF and MyHC mRNA in larvae
The molecular biology analysis was carried out on batches of trout from
embryos at hatching (yolk sacs removed) and yolk sac reabsorption, taken from
each temperature regime, and 0.5 g wet mass of larvae were stored in liquid
nitrogen prior to RNA extraction. Total RNA was extracted by the method of
Chomczynski and Sacchi (Chomczynski and Sacchi,
1987
). After careful
consideration of all genes for normalisation, it was decided that for this
study normalisation by housekeeping genes was inappropriate (Suzuki et al.,
2000
). Electrophoresis of RNA
(20 µg) was performed in 1.0% agarose gels prepared in Mops buffer (0.02
mol l-1 Mops, 5 mmol l-1 sodium acetate, 1 mmol
l-1 EDTA, pH 7.0) with 0.66 mol l-1 formaldehyde.
Following electrophoresis, RNA was transferred onto N+ nylon
membrane (Amersham) in 10x standard saline citrate (SSC: 10x is
1.5 mol l-1 NaCl, 0.15 mol l-1 sodium citrate) and fixed
by baking at 80°C for 2h. Hybridisation and subsequent washes were carried
out at 65°C. Hybridisation was performed in Church buffer (Church and
Gilbert, 1984
) with the
addition of sheared single-stranded calf thymus DNA at a final concentration
of 0.05 mg ml-1. Trout myogenin (Rescan et al.,
1995
) and trout MyHC probes
were radiolabelled according to the method of Feinberg and Vogelstein
(Feinberg and Vogelstein,
1983
).
50-100 ng of probe was made up to 34 µl with dH2O and
denatured by boiling for 5 min, then cooled to 37°C. 10 µl of
oligo-labelling buffer (OLB), 5 U DNA Poll (Klenow fragment), 2 µl BSA (10
mg ml-1) and 1.1 mBq of [
-32P]dCTP were added and
incubated at 37°C for a minimum of 3 h.
After incubation, the mixture was spun through a Sephadex G50 column equilibrated with TE at 700 g, to remove unincorporated nucleotides. Probes were added to a concentration of 106 cts ml-1. Membranes were sequentially washed following hybridisation to remove excess probe using decreasing concentrations of SSC (2x, 1x, 0.1x) containing 0.1 % SDS for 30 min at 65°C, or until detected radiation was 5-10 cts min-1. Membranes were then mounted and wrapped in cling film, and placed in a phosphoimaging cassette (Molecular Dynamics). The cassettes were exposed in a Storm 860 phosphoimager (Molecular Dynamics), and subsequent quantitative analysis was performed using Imagequant software (Molecular Dynamics). Normal semi-quantitative analysis by northern blotting usually involves scanning exposed autoradiograph film on a flat-bed scanner and quantifying the density of the signals on the scanned image (see Fig. 2). The phosphoimager analysis was chosen rather than conventional densitometry as the dynamic range of X-ray film is orders of magnitude less than a phosphoimaging screen. More importantly, there is no saturation effect as would be the case with densitometry using autoradiography, even if a more sensitive photographic emulsion was used. All the RNA samples from the same species and same experiment were included on the same membrane and analysed sequentially. All measurements on pooled samples were carried out in duplicate. As well as duplicate northern analyses of each RNA sample the hybridization and washing procedures were performed at the same time. It was considered important that the samples from the different temperature conditions were run simultaneously on the same gels. As the samples were pooled, the variation between individual larvae was not a problem.
|
Muscle fibre number and area
Fibre number and area were estimated as previously described by
Alami-Durante et al., 2000
(for
sea bass) and Stickland et al.,
1988
(for trout).
| Results |
|---|
|
|
|---|
MyoD expression
The quantified signals of MyoD expression at the different stages and at
the different temperatures are shown in
Fig. 3. Interestingly at
hatching, trout larvae raised at 4°C showed higher levels of MyoD RNA than
those incubated at 12°C and 8°C. There is also a higher level of MyoD
RNA at 8°C than at 12°C at yolk-sac absorption
(Fig. 3A). As described in
zebrafish (Weinberg et al.,
1996
) MyoD expression declined
after hatching, except at 8°C. Trout larvae in the time window experiment
showed elevated levels of MyoD expression at the lower temperature as compared
to the 12°C control group (Fig.
3A). These showed that the MyoD RNA levels were considerably
enhanced when the temperature was dropped to 4°C (LAW4) or 8°C (LAW8)
after fertilization had taken place i.e. at the time the muscles were being
formed.
|
Myogenin expression
The data obtained again showed expression levels higher in larvae incubated
a 4°C compared to 12°C. Trout larvae that were subjected to lower
temperatures during early development in the time window experiment also
showed elevated levels of MyoD expression compared to the 12°C control
group (Fig. 3B). As with MyoD,
myogenin mRNA levels for the 4°C, 8°C and 12°C groups were seen to
drop from hatching to yolk sac resorption when the muscle precursor cells are
fully appear fully to enter terminal differentiation and develop into
myotomes. In the time window experiment the myogenin RNA levels were enhanced
when the temperature after fertilization was dropped to 4°C (LAW4) and
even 8°C (LAW8) (Fig. 3B)
compared to 12°C.
MyHC expression
Myosin heavy chain expression (Fig.
3C) followed MyoD and myogenin expression and was apparent when
muscle fibre formation commenced (Akster et al.,
1995
). Again larvae incubated
at 4°C show higher levels of MyHC mRNA than those incubated at 12°C,
reflecting the pattern of expression seen for MyoD and myogenin. In contrast
to MyoD and myogenin the expression levels of MyHC increase continuously from
hatching to yolk sac resorption. This would be expected, as muscle formation
is still proceeding during this period of growth and thereafter. In the time
window experiments LAW4 and LAW8 (Fig.
3C) the enhancement in RNA levels of this structural protein were
also seen.
MRFs and MyHC transcript levels during early development of sea
bass
As with the trout larvae, the RNA extracted from probed samples of sea bass
larvae was of good quality with no discernable degradation and northern
blotting with the species-specific probes provided good hybridisation signals
for quantitative phosphoimaging analysis.
MyoD expression
Highest levels of myoD mRNA expression
(Fig. 4A) were recorded at the
three-quarter embryo stage with 15°C>13°C>20°C (data not
shown). The levels were then seen to fall at the hatching stage and to fall
further at first exogenous feeding. The optimum conditions at which there is
maximum MyoD RNA appear to be at 15°C at hatching and yolk sac
resorption.
|
Myogenin expression
At hatching, a tendency to a higher myogenin mRNA levels was noticed in the
larvae at 13°C and 15°C. Between hatching and the first exogenous
feeding, myogenin mRNA level increased, particularly in the larvae at 15°C
(Table 3).
|
MyHC expression
At hatching MyHC RNA expression levels were
15°C>20°C>13°C (Table
3). There was then a marked increase in expression levels after
hatching in the larvae at 15°C but in comparison the larvae at 13°C
and 20°C showed reduced levels.
| Discussion |
|---|
|
|
|---|
|
|
Different species of fish have evolved to reproduce and flourish at
different environmental temperatures. The rainbow trout is a member of the
salmonid family, which lay their eggs in cold mountain streams at temperatures
about 4°C to 8°C, where larval development proceeds until the fish
become large enough to migrate downstream. In contrast, the European sea bass
lays its eggs in water at about 15°C. In natural conditions, sexual
maturation extends from September to March in the Mediterranean with a
temperature range of 11-15°C (Barnabe,
1976
; Mananos et al., 1977;
Mendez et al., 1995
). In the
laboratory or hatchery, embryonic development can occur at a wider range of
temperatures, i.e. 8-20°C (Marangos et al.,
1986
; Jennings and Pawson,
1992
). The data obtained
indicate that the levels of regulatory factor transcripts e.g. MRF and
structural gene mRNA e.g. MyHC, are the most abundant at these respective
temperatures for the strains of trout and sea bass studied. This may suggest
that, if the temperature is elevated, the rate of RNA degradation may exceed
the rate of gene transcription, leading to decreased concentrations of
regulatory and structural proteins. During the course of evolution it seems
that the optimisation of development for individual species has therefore been
adjusted in the thermal stability of the RNA as well as the cellular processes
involved in protein synthesis. It should be mentioned that a precursory
investigation of a commercial strain of trout (LA) did not show such a low
optimum temperature and it is likely that sea bass from the Atlantic will have
a lower optimum than those from the Mediterranean.
These data on MRF and structural gene expression can be related to morphological parameters of larval development of the same strain of trout and sea bass studied. Details of the morphological differences plus the methods used will be published elsewhere, but the major differences are highlighted here so the influence of the environmental temperature on mRNA concentrations of the myogenic factors can be seen (Table 1, Table 2, Table 3). At hatching the total cross-sectional area of an apaxial quadrant of white muscle of the larvae reared at 20°C was higher than those of 13°C and 15°C. At the stage of flexion the reverse is true, with a smaller total white muscle cross-sectional area at a higher rearing temperature. In addition the post-larval growth, as indicated by the body mass for the trout, are given to show the marked change in growth potential of fish raised at 4°C compared to eggs and larvae raised at higher environmental temperatures.
These data have considerable economic significance, as there has been a tendency in the aquaculture industry to raise trout and sea bass eggs and larvae at elevated temperatures to speed up development. Although it may be faster it is apparently less complete, as this results in lower levels of MRF transcripts and these are associated with a reduced fibre number and a diminished growth potential. In the case of sea bass, fish raised at 20°C had 25% less body mass at the end of the production period than those raised initially at 15°C.
The fact that MyoD expression preceded myogenin expression in both sea bass
and trout suggests that there are time windows of gene expression in the
formation of muscle and the determination of muscle fiber number. This is in
agreement with the finding that the optimum temperatures for these two species
were those at which the concentrations of these MRFs were found to be maximal,
i.e. the rate of RNA degradation does not exceed that of RNA transcripts for
the particular genes in question. It has been shown that proteins from fish
that live at different environmental temperatures have different thermal
stabilities (Johnston and Goldspink,
1975
; Sidell,
1977
). Thus far the thermal
stabilities of MRF and MyHC RNAs have not been studied. It is likely that the
thermal stability and transcription levels of RNA are both important in
determining the amount of message available for translation into protein.
However, the relative importance of these two factors in determining the
optimum RNA concentrations for early development and hence the subsequent
structural changes during larval and post-larval growth have to be
investigated in more detail. As the molecular mechanisms involved in early
development seem to be particularly sensitive to temperature, adaptation of
these mechanisms to a given thermal niche must have been under strong
selective pressure during evolution.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Akster, H. A. and Koumans, J. T. M. (1995). Myogenic calls in development and growth of fish. Comp. Biochem. Physiol. 110A,3 -20.
Alami-Durante, H., Bergot, P., Rouel, M. and Goldspink, G. (2000). Effects of environmental temperature on the development of the myotomal white muscle in larval carp (Cyprinus carpio L.). J. Exp. Biol. 203,3675 -3688.[Abstract]
Barnabe, G. (1976). Contribution a la connaissance de la biologic du loup Dicentrarchus labrax (Poisson Serranide) de la region de Sete. These d'Etat, Universite des Sciences et Techniques de Languedoc, Montpellier.
Bobe, J., Ander, S. and Fauconneau, B. (2000). Embryonic muscle development in rainbow trout (Oncorhynchus mykiss): a scanning electron microscopy and immunohistological study. J. Exp. Zool. 286,379 -389.[Medline]
Brett, J. R. (1979). Environmental factors and growth. In Fish Physiology, vol.8 (ed. W. S. Hoar, D. J. Randall and J. R. Brett), pp.599 -675. New York: Academic Press.
Chomczynski, P. and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanatephenolchloroform extraction. Anal. Biochem. 162,156 -159.[Medline]
Church, G. M. and Gilbert, W. (1984). Genomic
sequencing. Proc. Natl. Acad. Sci. USA
81,1991
-1995
Delalande, J. M. and Rescan, P. Y. (1999). Differential expression of two nonallelic MyoD genes in developing and adult myotomal musclature of the trout (Oncorhynchus mykiss). Dev. Genes Evol. 209,432 -437.[Medline]
Divanach, P. (1985). Contribution de la Biologic et de I'Elevage de 6 Sparides Mediterraneens: Sparus aurata, Diplodus sargus, Diplodus vulgaris, Diplodus annularis, Lithognathus mormyrus, Puntazzo puntazzo (Poissons Teleosteens). These d'Etat, Universite des Sciences et Techniques de Languedoc.479 p.
Ennion, S., Wilkes, D., Gauvry, L., Alami-Durante, H. and Goldspink, G. (1999). Identification and expression analysis of two developmentally regulated myosin heavy chain gene transcripts in Carp (Cyprinus carpo). J. Exp. Biol. 202,1081 -1090.[Abstract]
Feinberg, A. P. and Vogelstein, B. (1983). A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6-13[Medline]
Gerlach, G.-F., Turay, L., Malik, K., Lida, J., Scutt, A. and
Goldspink, G. (1990). The mechanisms of seasonal temperature
acclimation in the carp; a combined physiological and molecular biology
approach. Am. J. Physiol.
259,R237
-R244.
Harvey, R. J. and Darlison, M. G. (1991). Random-priming cDNA synthesis facilitates the isolation of multiple 5'-cDNA ends by RACE. Nucl. Acid Res. 25, 4002.
Jennings, S. and Pawson, M. G. (1992). The origin and recruitment of bass, Dicentrarchus labrax, larvae to nursery areas. J. Mar. Biol. Ass. UK 72,199 -212.
Johnston, I. A. and Goldspink, G. (1975). Thermodynamic activation parameters of fish myofibrillar ATPase enzyme and evolutionary adaptations to temperature. Nature 257,620 -622.[Medline]
Johnston, I. A. Frearson, N. and Goldspink, G. (1975). Adaptations in myofibrillar ATPase induced by temperature acclimation. FEBS Lett. 50,293 -295.[Medline]
Krempler, A. and Brenig, B. (1999). Zinc finger proteins: watchdogs in muscle development. Mol. Gen. Genet. 261,209 -215.[Medline]
Loughna, P. T. and Goldspink, G. (1985). Muscle
protein synthesis rates during temperature acclimation in a eurythmal
(Cyprinus carpio) and a stenothermal (Salmo gairdneri)
species of teleost. J. Exp. Biol.
118,267
-276.
Mananos, E. L., Zanuy, S., Carrillo, M. (1997). Photoperiodic manipulations of the reproductive cycle of sea bass (Dicentrarchus labrax) and their effects on gonadal development, and plasma 17,3-estradiol and vitellogenin levels. Fish Physiol. Biochem. 16,211 -222.
Marangos, C., Yagi, H., Ceccaldi, H. J. (1986). The role of temperature and salinity on hatching rate and morphogenesis during embryo development in Dicentrarchus labrax (Linnaeus, 1758) (Pisces, Teleostei, Serranidae). Aquaculture 54,287 -300.
Matscha, T. W., Hopcroft, T., Mason, P. S., Crook, A. R. and Stickland, N. C. (1998). Temperature and oxygen tension influence the development of muscle cellularity in embryonic rainbow trout. J. Fish Biol. 53,581 -590.
Mendez, E., Anastasiadis, P., Kentouri, M., Pavlidis, M. and Divanach, P. (1995). Preliminary data on spawning activity of five Mediterranean tesleost species kept in captivity, in Crete (Greece). In Proc. Fifth National Congress on Aquaculture (ed. I. Castello, F. Orvay, I. Calderer and A. Reig), pp.398 -403. Universitat de Barcelona, Spain.
Rescan, P. Y., Gauvry, L. and Paboeuf, G. (1995). A gene with homology to myogenin is expressed in developing myotomal musculature of the rainbow trout and in vitro during the conversion of myosatellite cells to myotubes. FEBS Lett. 362,89 -92.[Medline]
Rescan, P. Y. and Gauvry, L. (1996). Genome of the rainbow trout (Onchrhynchus mykiss) encodes two distinct muscle regulatory factors with homology to myoD. Comp. Biochem. Physiol. 113B,711 -715.
Rescan, P. Y., Delalande, J. M., Gauvry, L., Paboeuf, G. and Fauconneau B. (1999). Differential expression of two MyoD genes during early development of the trout: comparison with myogenin. J. Fish. Biol. 55A,19 -25.
Sabourin, L. A. and Rudnicki, M. A. (2000). The molecular regulation of myogenesis. Clin. Genet. 7, 16-25.
Sidell, B. D. (1977). Turnover of cytochrome c in skeletal muscle of green sunfish (Leopmis cyanellus, R) during thermal acclimation. J. Exp. Zool. 199,233 -250.[Medline]
Stickland, N. C., White, R. N., Mescall, P. E., Crook, A. R. and Thorpe, J. E. (1988). The effect of temperature on myogenesis in embryonic development of the Atlantic Salmon (Salmo Salmar L). Anat. Embryol. 178,253 -257.[Medline]
Stickland, N. C. (1983). Growth and development of muscle fibres in the rainbow trout (Salmo gairdneri). J. Anat. 137,323 -333.
Sumpter, J. P. (1992). Control of growth of rainbow trout (Oncorhynchus mykiss). Aquaculture 100,299 -320.
Suzuki, T., Higgins, P. J., and Crawford, D. R. (2000). Control selection for RNA quantitation. Biotech. 29,332 -337.
Veggetti, A., Mascarello, F., Scapolo, P. A. and Rowlerson, A. (1990). Hyperplastic and hypertrophic growth of lateral muscle in Dicentrarchus labrax (L.). An ultrastructural and morphometric study. Anat. Embryol. 182, 1-10.[Medline]
Weatherley, A. H., Gill, H. S. and Lobo, A. F. (1988). Recruitment and maximal diameter of axial muscle fibres in teleosts and their relationship to somatic growth an ultimate size. J. Fish Biol. 33,851 -859.
Weinberg, E. S., Allende, M. L., Kelly, C. S, Abdelhamid, A., Murakami, T., Andermann. P., Doerre, O. G., Grunwald, D. J. and Riggleman, B. (1996). Developmental regulation of zebrafish MyoD in wild-type, no tail and spadetail embryos. Development 122,271 -280.[Abstract]
Weintraub, H., Tapscott, S. J., Davis, R. L. Thayer, M. J.,
Adam, M. A., Lassar, A. B. and Miller, A. D. (1989).
Activation of muscle-specific genes in pigment, nerve, fat, liver and
fibroblast cell lines by forced expression of MyoD. Proc. Natl.
Acad. Sci. USA 86,5434
-5438.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
M. Vornanen, M. Hassinen, H. Koskinen, and A. Krasnov Steady-state effects of temperature acclimation on the transcriptome of the rainbow trout heart Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2005; 289(4): R1177 - R1184. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||