|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
A DROSOPHILA MELANOGASTER Strain From Sub-Equatorial Africa Has Exceptional Thermotolerance But Decreased Hsp70 Expression
1 Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Vavilov Street 32, 117984 Moscow, Russia,
2 The Committee on Evolutionary Biology and
3 Department of Organismal Biology and Anatomy, The University of Chicago, 1027 East 57th Street, Chicago, IL 60637, USA
*Author for correspondence (e-mail: m-feder{at}uchicago.edu)
Accepted March 19, 2001
| Summary |
|---|
|
|
|---|
Key words: Drosophila melanogaster, evolutionary physiology, heat-shock protein, Hsp70, molecular chaperone, transposable element
| Introduction |
|---|
|
|
|---|
In D. melanogaster, typically cultured at 1825°C, survival at high temperature is normally inversely related to the duration and severity of heat shock, with 1h heat shocks of 3839°C sufficient to cause 50% mortality (David et al., 1983; Feder and Krebs, 1997). Culture at higher temperatures, either constantly at slightly elevated temperatures (e.g. 28°C) or cycling between typical and still higher temperatures, can increase thermotolerance above these basal levels (Bettencourt et al., 1999; Lansing et al., 2000). This enhanced thermotolerance can ensue both within the lifetime of an individual fly (i.e. phenotypic plasticity, thermal acclimation) or via genetic change among generations (i.e. evolution). Moreover, pretreatment with a mild heat shock (e.g. 1h at 3537°C) can rapidly increase tolerance of a more severe heat shock; this is termed inducible thermotolerance. Expression of the heat-shock proteins is one of the primary mechanisms underlying inducible thermotolerance in D. melanogaster. In this species, one such inducible protein, Hsp70, is encoded by five nearly identical genes at two chromosomal loci (87A7, two genes; 87C1, three genes) (for a review, see Feder and Hofmann, 1999). At least eight other members of the hsp70 gene superfamily, both inducible and constitutively expressed, are present in the genome (Burmester et al., 2000; Easton et al., 2000; Rubin et al., 1993). Hsp70 is the most abundant heat-shock protein induced by heat, and manipulation of its abundance (via antisense and engineering of hsp70 copy number) is sufficient for large changes in inducible thermotolerance (Feder et al., 1996; Solomon et al., 1991; Welte et al., 1993). Activation of the heat-shock transcription factor HSF via trimerization, phosphorylation and nuclear localization is a key step in heat-shock protein expression. HSF is negatively regulated through interaction with Ku autoantigen, HSBP1 and Hsp70 family members (Cotto and Morimoto, 1999; Lerman and Feder, 2001; Tuteja and Tuteja, 2000; Zatsepina et al., 2000). When activated, HSF can bind heat-shock response elements (HSEs) in the hsp70 promoter to induce transcription; the number and arrangement of the HSEs affect hsp70 gene expression (Lis and Wu, 1994).
These findings for typical D. melanogaster led us to investigate basal and inducible thermotolerance in the T (thermotolerant) strains descended from those D. melanogaster collected in Chad and their patterns of Hsp70 protein accumulation and its transcriptional regulation. Not only can the T strain survive prolonged culture at temperatures above 30°C, it tolerates several high-temperature treatments (36°C for 26h; 38°C for 4h) better and low temperatures more poorly than does Canton-S, a standard wild-type line (Tikhomirova and Belyatskaya, 1980). When subjected to ionizing radiation and heat shock in combination, the T strain is less prone to mutagenesis and repairs radiation injuries more readily than wild-type and Hsp-deficient strains (Tikhomirova, 1980; Tikhomirova et al., 1993). In part, this resistance depends on culture temperature because both adults and oocytes of T flies reared at 25°C (hereafter T25) show intermediate levels of resistance compared with those reared at 32°C (hereafter T32) and Canton-S flies (Tikhomirova and Belyatskaya, 1980; Tikhomirova and Belyatskaya, 1993). Here, we differentiate between basal thermotolerance, which is presumably due to mechanisms other than heat-shock proteins, and inducible thermotolerance, which is due in part to heat-shock proteins, in the T32, T25 and a wild-type strain, and relate these differences to levels and varieties of heat-shock proteins and the regulation of their expression. Although we initially hypothesized that study of the T strain would disclose molecular and evolutionary mechanisms of increased thermotolerance, we report here several unique features of this strain that are apparently associated with decreased inducible thermotolerance.
| Materials and methods |
|---|
|
|
|---|
Thermotolerance
Eclosing individuals were sequestered daily and, when 4 days old, were transferred by aspiration to a fresh glass vial containing 8ml of medium. A circle of filter paper above the medium allowed flies access to it but prevented them from adhering to it. Each vial usually contained 1620 animals, but occasionally contained as few as 10. On the next day, vials were capped with a moistened stopper above a cotton plug, placed in a rack with vials evenly spaced and immersed in a water bath at pretreatment and heat-shock temperatures. Some flies underwent direct exposure to heat shock (3741°C) for 30min. Others underwent exposure to a pretreatment temperature (3638°C) for 30min followed by 25°C for 1h, and then underwent heat shock. Thermotolerance was measured as the proportion of flies in a vial that were able to walk 24h after heat shock.
Measurement of Hsp70 protein in entire flies
Flies were heat-shocked as above but for different durations depending on the experimental design, immediately frozen in liquid nitrogen and then stored at -80°C until analysis. Pairs of identically treated flies were lysed in 200400µl of ice-cold 1x Complete Protease Inhibitor (Boehringer-Mannheim Corp) in phosphate-buffered saline by grinding briefly with an ice-cold disposable pestle. Lysates were centrifuged at 14000g for 30min at 4°C, and the protein content of the supernatant was determined (BCA Assay, Pierce Chemical Co., Rockford, IL, USA). Supernatants prepared the same day were diluted to 20µgml-1 protein in ice-cold coating buffer and used to coat micro-well plates (Falcon no. 3915 ProBind) for determination of Hsp70 content by ELISA (Feder et al., 1997; Feder et al., 1996). Plates were left overnight at 4°C to allow proteins to adsorb. After extensive rinsing, bound Hsp70 was detected using a 1:5000 dilution of the Drosophila Hsp70-specific antibody 7FB (Velazquez et al., 1980; Velazquez et al., 1983) coupled to alkaline phosphatase via a secondary antibody (1:1000 rabbit anti-rat IgG; Cappel Organon Teknika) and a tertiary antibody (1:1000 alkaline-phosphatase-conjugated goat anti-rabbit IgG; Sigma). Plates were incubated at 37°C with the phosphatase substrate p-nitrophenyl phosphate (1mgml-1) prepared according to the manufacturers instructions (Sigma), and the colored reaction product was measured at 405nm in a micro-plate reader. For at least one replicate of each sample or standard, the primary antibody was omitted to allow correction for non-specific signal. The ELISA signal is proportional to Hsp70 concentration in the lysates and is expressed as a percentage of a standard signal, that for a lysate of D. melanogaster S2 cells in tissue culture that had been exposed to 36.5°C for 1h and to 25°C for 1h before lysis.
Protein labeling, gel electrophoresis and immunoblotting
Ten salivary glands from third-instar larvae were labeled in 20µl of Schneiders insect medium without methionine (Sigma) after the addition of 1µl (1.85MBq) of L-[35S] methionine (Amersham) for 1h at 25°C after various treatments. Two-dimensional gel electrophoresis and other procedures applied were as described by OFarrell et al. (OFarrell et al., 1977) and Ulmasov et al. (Ulmasov et al., 1992). The position of major Hsps and actin was determined both by autoradiography (see above) and by subsequent staining of gels with silver (Creighton, 1990). Salivary glands were also labeled with 14C-labeled amino acids, which yielded essentially the same results (data not shown).
For immunoblotting, after sodium dodecyl sulfate/polyacrylamide electrophoresis (SDSPAGE) of larval lysate prepared as above, the proteins were transferred to a nitrocellulose membrane (Hybond ECL; Amersham) according the manufacturers protocol. Monoclonal antibodies specific to the entire D. melanogaster Hsp70 family (7.10.3) and to Hsp70 alone (7FB, see above) were obtained from Dr Susan Lindquist (The University of Chicago). Immune complexes were detected via chemoluminescence (ECL kit, Amersham) and 3,3'-diaminobenzidine (DAB) (Sigma) with corresponding peroxidase-conjugated anti-rat secondary antibodies.
Preparation of RNA and northern hybridization
RNA was prepared by the standard method using 4moll-1 guanidine isothiocyanate (Chomczynsky and Sacchi, 1987). Blotting and northern hybridization with a ClaI-BamHI fragment containing the Drosophila melanogaster hsp70 gene cloned into the BamHI site of pUC13 (McGarry and Lindquist, 1985) was performed (Sambrook and Fritsch, 1989) with slight modifications. Hybridization was overnight at 42°C in 50% formamide; this was followed by two 20min washes in 2xSSC, 0.2% SDS at 42°C, two 20min washes in 1xSSC, 0.2% SDS at 42°C and one 20min wash in 0.2xSSC, 0.2% SDS at 68°C.
Southern hybridization and restriction digests
Genomic DNA from the different D. melanogaster strains (adult flies) was prepared as described previously (Zelentsova et al., 1986). Genomic DNA (20µg) was used for a typical restriction enzyme digestion. Digests were prepared for hybridization by electrophoresis on 1% agarose gels, denaturation and capillary-blotting onto nylon membranes according to the manufacturers protocol. Fixation was by ultraviolet cross-linking with a UV Stratalinker 2400 (Stratagene). Standard high-stringency hybridization and wash conditions were used (Zelentsova et al., 1986). The probe was the same as that used in northern blots.
Gel mobility-shift assay
Flies were frozen and pulverized in liquid nitrogen, and the powder was suspended (1:5) in a buffer containing 20mmoll-1 Hepes, pH7.9, 25% v/v glycerol, 0.42moll-1 NaCl, 1.5mmoll-1 MgCl2, 0.2mmoll-1 EDTA, 0.5mmoll-1 phenymethylsulfonyl fluoride (PMSF) and 0.5mmoll-1 dithiothreitol and centrifuged at 100000g for 20min. The supernatants were frozen in liquid nitrogen and stored at -70°C. The protein concentration of the extracts was estimated with a modified Lowry method (Ulmasov et al., 1992).
Consensus HSE probe (Wu et al., 1988) was prepared by annealing partially complementary oligonucleotides (ATCCGAGCGCGCCTCGAATGTTCTAGAA and CTCGCGCGGAGCTTACAAGATCTTTTCCA) in 10mmoll-1 potassium phosphate buffer, pH8.2, in the presence of 0.1mmoll-1 NaCl. Single-stranded termini were filled with Klenow polymerase and [32P]ATP (Sambrook and Fritsch, 1989). For the gel mobility-shift assay, extracts containing 50µg of protein were mixed with 0.5ng of [32P]HSE in the binding buffer (as described by Mosser et al., 1993). The binding-reaction mixture was incubated at room temperature (20°C) for 20min. Free probe was separated from HSEHSF complexes by electrophoresis through 5% polyacrylamide gels (Mosser et al., 1993). The gels were dried and exposed to X-ray film (Kodak X-Omat) at -70°C.
To identify bands corresponding to HSF or Ku autoantigen, cell extracts of control or heat-shocked cells were preincubated for 20min either with anti-D. melanogaster Ku antibodies (gift of D. Rio) or with anti-D. melanogaster HSF serum (gift of C. Wu, NIH) before incubation with the labeled HSE probe; the samples were then subjected to electrophoresis.
Analyses of nucleotide sequences
Genomic DNA from 75 adults per strain was obtained by standard phenol/chloroform extraction and was used as templates for amplification products to be cloned and sequenced. Single-fly DNA for polymorphism screens was prepared from individual flies by homogenizing adults in 50µl of buffer with 0.2µgµl-1 Proteinase K (Gloor et al., 1993). Samples were incubated at 37°C for 30min, heated to 95°C to inactivate Proteinase K and stored at 20°C.
Polymerase chain reaction (PCR) of single-fly preparations was performed by adding 2µl of template DNA to buffer (10mmoll-1 Tris-HCl, pH9.0, 50mmoll-1 KCl, 0.1% Triton X-100) with 1.53.0mmoll-1 MgCl2, 0.2mmoll-1 each dNTP, 5pmol of each primer and 1.25units of Taq DNA polymerase (Promega) per 25µl reaction mixture. For PCR amplification of fragments to be cloned and sequenced, 1µl of template DNA from mass preparations was added to buffer (50mmoll-1 KCl, 50mmoll-1 Tris-HCl, pH8.3) with 1.5mmoll-1 MgCl2, 0.2mmoll-1 each dNTP, 5pmol of each primer and 2.5units of MasterAmp TAQurate DNA polymerase mix (Epicentre Technologies) per 100µl reaction. Reaction conditions for all PCRs were 30 cycles of 1min at 92°C, 1min at 54°C and 1.5min at 72°C. To amplify a portion of the 87A7 locus, primers were: upper, 5'CATCCCAAAAATCTGTAAAGC3'; lower, 5'ACTGTGTTTCTGGGGTTCAT3'. These flank both an H.M.S. Beagle element insertion site and an approximately 140basepair (bp) insertion characteristic of 56H8-type alleles (Bettencourt, 2001), if present. To amplify the hsp70Ba promoter, primers were: upper, 5'GCAAGCAATCATCATCCAAT3'; lower, 5'ACTGTGTTTCTGGGGTTCAT3'. These flank a Jockey element insertion site. Fig.8A displays the sizes of the resultant amplification products, which were resolved via agarose gel electrophoresis. To screen individual flies for the Jockey element, primers were the foregoing hsp70Ba primers plus a Jockey-specific internal primer (lower, 5'AAGAAGACTCAAGCGACACC3').
|
| Results |
|---|
|
|
|---|
|
Hsp70 levels after pretreatment and heat shock were likewise lower in the T32 strain than in the other strains (Fig.2). In OR25 flies, Hsp70 levels increased during exposure to high temperature, continued to increase for 13h afterwards, depending on temperature, and then decreased. In the T32 strain, the peak Hsp70 level was only 3050% of the level in OR25 flies. T25 flies were intermediate in this respect. Immunoblots of Hsp70 corroborate this finding (Fig.3). Similarly, amounts of hsp70 mRNA, determined 1h after a 30min exposure to 35°C and 37.5°C, were also greatest in OR25, intermediate in T25 and lowest in T32 (Fig.4). After 39°C heat shock, in contrast, hsp70 mRNA levels in T32 were intermediate to those in the other strains (Fig.4), and Hsp70 was detectable only in the T strains (Fig.3). As with Hsp70 levels, hsp70 mRNA abundance was least after the most intense heat shock in all strains. According to ELISA, the kinetics of Hsp70 variation were similar in the three strains, and the T32 strain did not accumulate more Hsp70 than the other strains at the highest temperature examined (Fig.2, inset). Rearing eggs of the T32 strain to adulthood at 25°C increased Hsp70 levels above those in both the T32 strain reared at 32°C and the T25 strain (Fig.2, arrow in inset).
|
|
|
The T32 flies reared at 25°C expressed much more hsp70 mRNA after 35°C heat shock than the T32 flies reared at 3132°C. This difference was absent or much less evident after 37.5°C and 39°C heat shock (Fig.4).
Qualitative differences in the heat-shock proteins and genes of the T strains and OR
Two-dimensional gel electrophoresis detected numerous differences between the protein patterns of OR25 and T flies, both in identifiable heat-shock proteins and in other proteins (Fig.5, Fig.6). A 45kDa protein labeled conspicuously after heat shock in T but not in OR25 (Fig.5, arrow c). Several small (2227kDa) heat-inducible proteins, presumably members of the D. melanogaster small Hsp family (Michaud et al., 1997), also differ in mobility between T and OR25 (Fig.5, arrows 27,b,d,e). The Hsp70 family clearly differed between T and OR25 strains. Both strains expressed Hsp68 (Fig.6), but this expression was more rapid in OR25 (Fig.6C) than in T (Fig.6E). Also, a third (i.e. in addition to Hsp68 and Hsp70) heat-inducible family member was evident in T but not in OR (low MW in Fig.6E). This protein co-migrates with Hsp70 in the isoelectric focusing dimension and has a slightly lower molecular mass than Hsp68. It is also detected by antibody 7FB, which recognizes D. melanogaster Hsp70 but not other D. melanogaster Hsp70 family members (Palter et al., 1986) (data not shown).
|
|
|
|
| Discussion |
|---|
|
|
|---|
At the outset, the extraordinary thermotolerance of the T strain was evident from its ability to thrive above temperatures previously considered to be the limit for continuous culture of this species (Parsons, 1973). This exceptional ability clearly extends to tolerance of acute high-temperature exposure (i.e. basal thermotolerance), in which the T strain in the present study outperforms other Drosophila melanogaster strains and compares favorably with many cactophilic Drosophila species (Krebs, 1999; Krebs and Loeschcke, 1995a; Krebs and Loeschcke, 1995b; Parsons, 1979; Stratman and Markow, 1998). In other strains and species, mechanisms of basal thermotolerance may include enhanced stability of cellular proteins through modification of primary structure and synthesis of thermoprotective osmolytes such as trehalose and sorbitol, constitutively expressed molecular chaperones, homeoviscous adaptation (i.e. adjustment in the lipid constituents of cells) and regulated depression of cellular function to moderate energy requirements. Although only semi-quantitative, the various determinations of constitutively expressed molecular chaperones reveal no obvious differences between T and OR25 flies (Fig.3, Fig.5, Fig.6); if anything, levels are lower in T flies than in OR25 flies. Investigation of the other mechanisms of basal tolerance in the T strain, in which they are presently unknown, may well be fruitful.
In contrast, in terms of inducible thermotolerance, the T strain is unremarkable if not comparatively poor. Heat-shock protein expression is a principal mechanism of inducible thermotolerance in D. melanogaster (Feder et al., 1996; Solomon et al., 1991; Welte et al., 1993). Correspondingly, the T strain exhibits both lower amounts of most Hsps after heat shock and slower kinetics of Hsp70 and Hsp68 expression than the OR25 strain. The only obvious exceptions to this conclusion are an apparent low-molecular-mass Hsp70 and several putative small Hsps (Fig.5), the latter identified exclusively by electrophoretic mobility and heat inducibility. Small Hsps, related to
-crystallins, clearly protect against stress (including high temperature) in other species, and their encoding genes have evolved in response to environmental temperature in D. melanogaster (Frydenberg et al., 1999). Their role in thermotolerance has not been confirmed in D. melanogaster, however. In any event, decreased inducible thermotolerance and increased expression of small Hsps would seemingly be inconsistent. The low-molecular-mass Hsp70 (Fig.6) is detected both by an antibody specific for all Hsp70 family members (7.10) and by one specific for D. melanogaster Hsp70 (7FB), and its electrophoretic mobility resembles that of Protein 38 in Fig.2B of Buzin and Petersen (Buzin and Petersen, 1982). Indeed, Buzin and Peterson detected isoforms of Hsp70 considerably more numerous than the Hsp70-encoding genes, and they hypothesized that this was due to alternative post-translational modifications. In the T strain, however, this particular Hsp70 is far more abundant than in other strains (Buzin and Petersen, 1982; Palter et al., 1986). Whether this Hsp70 is functional and the basis for its low molecular mass are presently unknown.
Part of the distinctive thermal phenotype of the T strain is due to its thermal history while in laboratory culture. The T25 strain is intermediate to OR25 and T32 in basal thermotolerance, in inducible thermotolerance, in Hsp70 expression (present study) and in several other aspects of resistance to heat and ionizing radiation (Tikhomirova, 1980; Tikhomirova and Belyatskaya, 1993; Tikhomirova et al., 1993). Laboratory evolution at the respective culture temperatures of the T25 and T32 strains is clearly sufficient to generate such differences in thermal phenotype and the heat-shock response (Bettencourt et al., 1999; Gilchrist and Huey, 1999; McColl et al., 1996; McKechnie et al., 1998; Sorensen et al., 1999), and the two strains differ in hsp70Ba allele frequency. Within a generation, culture at different temperatures (i.e. thermal acclimation) can also affect diverse traits in D. melanogaster, and these effects can persist for multiple generations (Crill et al., 1996; Hercus and Hoffmann, 2000). Thermal acclimation can affect the threshold temperature for induction of a heat-shock response (for a review, see Lerman and Feder, 2001), but several attempts to demonstrate a large effect in D. melanogaster (Bettencourt et al., 1999; Lerman and Feder, 2001) have failed.
This work adds to a growing list of Drosophila studies suggesting that, under certain conditions, evolution at high temperatures leads to decreased expression of Hsp70, a seemingly paradoxical outcome given the role of Hsp70 in thermotolerance in Drosophila. D. melanogaster undergoing laboratory natural selection at 28°C (henceforth Cavicchi 28°C lines) and D. buzzatii (a cactophilic species) reared for 6h each day at 38.2°C both express less Hsp70 than 25°C controls (Bettencourt et al., 1999; Sorensen et al., 1999). Similarly, subtropical D. buzzatii collected from a low (i.e. warm) elevation express less Hsp70 than conspecifics collected from a high (i.e. cool) elevation (Sorensen et al., 2001). We suggest, as have others (Bettencourt et al., 1999; Krebs and Feder, 1997a; Krebs and Feder, 1997b; Krebs and Feder, 1998b; Krebs et al., 1998; Lansing et al., 2000; Sorensen et al., 2001; Sorensen et al., 1999), that this pattern is due (i) to the low levels of Hsp70 present in wild-type D. melanogaster transiently exposed to temperatures that these high-temperature lines chronically experience, (ii) to deleterious consequences of these low Hsp70 levels and (iii) to natural selection to reduce these low Hsp70 levels, which reduces Hsp70 levels at all temperatures as a correlated response to selection (Fig.10).
|
Regardless of its ultimate significance (sensu Mayr), the lower levels of Hsp70 expression in the T strains must have a mechanistic basis. Features determining the concentration of Hsp70 in D. melanogaster cells include hsp70 copy number (Feder et al., 1996; Solomon et al., 1991; Welte et al., 1993), chromatin structure (Wu, 1980), transcription (Li et al., 1996; Mason and Lis, 1997; Morimoto et al., 1994), RNA processing (Lindquist, 1993; Yost et al., 1990), message stability (Petersen and Lindquist, 1989) and translation (Hess and Duncan, 1996; Zapata et al., 1991) and the sequestration and degradation of protein (Feder et al., 1992). As in prior studies (Bettencourt et al., 1999), we find no unequivocal evidence for genes other than the typical five hsp70 genes in the T strain (data not shown). At the level of transcriptional activation, the T strain exhibits the same temperature-sensitivity of HSFHSE interaction as the OR25 strain (Fig.9). As in other organisms (Zatsepina et al., 2000), HSF constitutively forms additional complexes, one with Ku autoantigen and one of unknown composition, but both complexes are similarly abundant in both the T and OR25 strains. Presumably, therefore, the lower Hsp70 concentrations in the T strain have their basis downstream of HSF activation and binding to HSEs; indeed, the sizes of restriction fragments and PCR products indicate polymorphism in the hsp70 loci, both in the strains examined here and worldwide (Bettencourt, 2001). One discrete candidate mechanism is disruption of the hsp70 promoters by transposable elements, leading to altered transcription. It has been shown that both H.M.S. Beagle and Jockey elements may affect the expression of other genes whose promoters they disrupt (Kimbrell et al., 1988; Kimbrell et al., 1989; White and Jacobson, 1996a; White and Jacobson, 1996b). When present in the hsp70Ba promoter of the T strain, the Jockey element intervenes between the proximal and distal pairs of HSEs. Although the two proximal HSEs constitute the minimal Hsp70 promoter, the distal HSEs contribute to heat-inducible hsp70 transcription (Lee et al., 1992; Topol et al., 1985). The H.M.S. Beagle element is in a region of the 87A7 locus whose impact on hsp70 transcription is unclear. Nonetheless, the H.M.S. Beagle sequence includes putative enhancer-like elements that may affect transcriptional regulation at some distance from the promoter (Kimbrell et al., 1988; Kimbrell et al., 1989). Transposable elements may be a significant evolutionary force in D. melanogaster via their alteration of the pre-existing genome, and it is tempting to conclude that these elements reduce Hsp70 levels in the T strain, which natural selection has then favored in the native environment of the strain. Whether disruption of one or two hsp70 genes out of five would be sufficient to reduce the overall transcription of hsp70 mRNA is not known, however, and whether the H.M.S. Beagle and Jockey elements actually disrupt transcription as hypothesized requires further study.
The heat-shock genes and the proteins they encode are among the most ancient and highly conserved known, so much so that they have been considered useful in defining the phylogeny of major species groups in Drosophila (Bettencourt and Feder, 2001; Drosopoulou et al., 1996; Molto et al., 1994; Sinibaldi and Storti, 1982) and even phyla and kingdoms (Feder and Hofmann, 1999). Against this background, the variation among populations of a single species (i.e. T versus Oregon R) is remarkable. Evidently, adaptation via natural selection is sufficiently strong to overcome even the immense phylogenetic inertia of the heat-shock response.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bettencourt, B. R. (2001). Molecular and phenotypic adaptation of Hsp70 and thermotolerance in Drosophila. Ph.D. dissertation, University of Chicago.
Bettencourt, B. R. and Feder, M. E. (2001). hsp70 duplication in the Drosophila melanogaster species group: how and when did two become five? Mol. Biol. Evol. (in press).
Bettencourt, B. R., Feder, M. E. and Cavicchi, S. (1999). Experimental evolution of Hsp70 expression and thermotolerance in Drosophila melanogaster. Evolution 53, 484492.
Burmester, T., Mink, M., Pal, M., Laszloffy, Z., Lepesant, J. A. and Maroy, P. (2000). Genetic and molecular analysis in the 70CD region of the third chromosome of Drosophila melanogaster. Gene 246, 157167.[Medline]
Buzin, C. H. and Petersen, N. S. (1982). A comparison of the multiple Drosophila heat shock proteins in cell lines and larval salivary glands by two-dimensional gel electrophoresis. J. Mol. Biol. 158, 181201.[Medline]
Cavicchi, S., Guerra, D., La Torre, V. and Huey, R. B. (1995). Chromosomal analysis of heat-shock tolerance in Drosophila melanogaster evolving at different temperatures in the laboratory. Evolution 49, 676684.
Cavicchi, S., Guerra, V., Natali, V., Pezzoli, C. and Giorgi, G. (1989). Temperature related divergence in experimental populations of Drosophila melanogaster. II. Correlation between fitness and body dimensions. J. Evol. Biol. 2, 235251.
Chomczynsky, P. and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate phenol chloroform extraction. Anal. Biochem. 162, 156159.[Medline]
Cotto, J. J. and Morimoto, R. I. (1999). Stress-induced activation of the heat-shock response: cell and molecular biology of heat-shock factors. Biochem. Soc. Symp. 64, 105118.[Medline]
Creighton, T. E. (1990). Protein Structure: A Practical Approach. Oxford, UK; New York: IRL Press.
Crill, W. D., Huey, R. B. and Gilchrist, G. W. (1996). Within- and between-generational effects of temperature on the morphology and physiology of Drosophila melanogaster. Evolution 50, 12051218.
Dahlgaard, J., Loeschcke, V., Michalak, P. and Justesen, J. (1998). Induced thermotolerance and associated expression of the heat-shock protein HSP70 in adult Drosophila melanogaster. Funct. Ecol. 12, 786793.
David, J. R., Allemand, R., Van Herrewege, J. and Cohet, Y. (1983). Ecophysiology: abiotic factors. In The Genetics and Biology of Drosophila, vol. 3d (ed. M. Ashburner H. L. Carson and J. N. Thompson), pp. 105170. London: Academic Press, Inc.
Dorner, A. J., Krane, M. G. and Kaufman, R. J. (1988). Reduction of endogenous GRP78 levels improves secretion of a heterologous protein in CHO cells. Mol. Cell Biol. 8, 40634070.
Dorner, A. J., Wasley, L. C. and Kaufman, R. J. (1992). Overexpression of GRP78 mitigates stress induction of glucose regulated proteins and blocks secretion of selective proteins in Chinese hamster ovary cells. EMBO J. 11, 15631571.[Medline]
Drosopoulou, E., Konstantopoulou, I. and Scouras, Z. G. (1996). The heat shock genes in the Drosophila montium subgroup: chromosomal localization and evolutionary implications. Chromosoma 105, 104110.[Medline]
Easton, D. P., Kaneko, Y. and Subjeck, J. R. (2000). The Hsp110 and Grp 170 stress proteins: newly recognized relatives of the Hsp70s. Cell Stress & Chaperones 5, 276290.[Medline]
Evgenev, M. B., Kolchinski, A., Levin, A., Preobrazhenskaya, A. L. and Sarkisova, E. (1978). Heat-shock DNA homology in distantly related species of Drosophila. Chromosoma 68, 357365.
Evgenev, M. B., Sheinker, V. S., Levin, A. V. and Karaev, K. (1987). Molecular mechanisms of adaptation to hyperthermia in eucaryotic organisms. I. The synthesis of heat shock proteins in cell cultures of different species of silkworms. Mol. Biol. 21, 484494.
Feder, J. H., Rossi, J. M., Solomon, J., Solomon, N. and Lindquist, S. (1992). The consequences of expressing Hsp70 in Drosophila cells at normal temperatures. Genes Devl. 6, 14021413.
Feder, M. E. (1999a). Engineering candidate genes in studies of adaptation: the heat-shock protein Hsp70 in Drosophila melanogaster. Am. Nat. 154, S55S66.
Feder, M. E. (1999b). Organismal, ecological and evolutionary aspects of heat-shock proteins and the stress response: established conclusions and unresolved issues. Am. Zool. 39, 857864.
Feder, M. E., Blair, N. and Figueras, H. (1997). Natural thermal stress and heat-shock protein expression in Drosophila larvae and pupae. Funct. Ecol. 11, 90100.
Feder, M. E., Cartaño, N. V., Milos, L., Krebs, R. A. and Lindquist, S. L. (1996). Effect of engineering hsp70 copy number on Hsp70 expression and tolerance of ecologically relevant heat shock in larvae and pupae of Drosophila melanogaster. J. Exp. Biol. 199, 18371844.[Abstract]
Feder, M. E. and Hofmann, G. E. (1999). Heat-shock proteins, molecular chaperones and the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61, 243282.[Medline]
Feder, M. E. and Krebs, R. A. (1997). Ecological and evolutionary physiology of heat-shock proteins and the stress response in Drosophila: complementary insights from genetic engineering and natural variation. In Stress, Adaptation and Evolution (ed. R. Bijlsma and V. Loeschcke), pp. 155173. Basel: Birkhäuser Verlag.
Frydenberg, J., Pierpaoli, M. and Loeschcke, V. (1999). Drosophila melanogaster is polymorphic for a specific repeated (CATA) sequence in the regulatory region of hsp23. Gene 236, 243250.[Medline]
Gilchrist, G. W. and Huey, R. B. (1999). The direct response of Drosophila melanogaster to selection on knockdown temperature. Heredity 83, 1529.
Gloor, G. B., Preston, C. R., Johnson-Schlitz, D. M., Nassif, N. A., Phillis, R. W., Benz, W. K., Robertson, H. M. and Engels, W. R. (1993). Type I repressors of P element mobility. Genetics 135, 8195.[Abstract]
Goldschmidt-Clermont, M. (1980). Two genes for the major heat-shock protein of Drosophila melanogaster arranged as an inverted repeat. Nucleic Acids Res. 8, 235252.
Hercus, M. J. and Hoffmann, A. A. (2000). Maternal and grandmaternal age influence offspring fitness in Drosophila. Proc. R. Soc. Lond. B 267, 21052110.[Medline]
Hess, M. A. and Duncan, R. F. (1996). Sequence and structure determinants of Drosophila Hsp70 mRNA translation, 5'UTR secondary structure specifically inhibits heat shock protein mRNA translation. Nucleic Acids Res. 24, 24412449.
Ish-Horowicz, D., Pinchin, S. M., Schedl, P., Artavanis-Tsakonas, S. and Mirault, M. E. (1979). Genetic and molecular analysis of the 87A7 and 87C1 heat-inducible loci of D. melanogaster. Cell 18, 13511358.[Medline]
Jaattela, M. (1999a). Escaping cell death: survival proteins in cancer. Exp. Cell Res. 248, 3043.[Medline]
Jaattela, M. (1999b). Heat shock proteins as cellular lifeguards. Ann. Med. 31, 261271.[Medline]
Jeanmougin, F., Thompson, J. D., Gouy, M., Higgins, D. G. and Gibson, T. J. (1998). Multiple sequence alignment with Clustal X. Trends Biochem. Sci. 23, 403405.[Medline]
Johnston, J. A., Ward, C. L. and Kopito, R. R. (1998). Aggresomes: A cellular response to misfolded proteins. J. Cell Biol. 143, 18831898.
Kimbrell, D. A., Berger, E., King, D. S., Wolfgang, W. J. and Fristrom, J. W. (1988). Cuticle protein gene-expression during the 3rd instar of Drosophila-melanogaster. Insect Biochem. 18, 229235.
Kimbrell, D. A., Tojo, S. J., Alexander, S., Brown, E. E., Tobin, S. L. and Fristrom, J. W. (1989). Regulation of larval cuticle protein gene-expression in Drosophila melanogaster. Devl. Genet. 10, 198209.
Kohler, H. R., Zanger, M., Eckwert, H. and Einfeldt, I. (2000). Selection favours low hsp70 levels in chronically metal-stressed soil arthropods. J. Evol. Biol. 13, 569582.
Krebs, R. A. (1999). A comparison of Hsp70 expression and thermotolerance in adults and larvae of three Drosophila species. Cell Stress & Chaperones 4, 243249.[Medline]
Krebs, R. A. and Feder, M. E. (1997a). Deleterious consequences of Hsp70 overexpression in Drosophila melanogaster larvae. Cell Stress & Chaperones 2, 6071.[Medline]
Krebs, R. A. and Feder, M. E. (1997b). Natural variation in the expression of the heat-shock protein Hsp70 in a population of Drosophila melanogaster and its correlation with tolerance of ecologically relevant thermal stress. Evolution 51, 173179.
Krebs, R. A. and Feder, M. E. (1998a). Experimental manipulation of the cost of thermal acclimation in Drosophila melanogaster. Biol. J. Linn. Soc. 63, 593601.
Krebs, R. A. and Feder, M. E. (1998b). Hsp70 and larval thermotolerance in Drosophila melanogaster: how much is enough and when is more too much? J. Insect Physiol. 44, 10911101.[Medline]
Krebs, R. A., Feder, M. E. and Lee, J. (1998). Heritability of expression of the 70-kD heat-shock protein in Drosophila melanogaster and its relevance to the evolution of thermotolerance. Evolution 52, 841847.
Krebs, R. A. and Loeschcke, V. (1994). Costs and benefits of activation of the heat-shock response in Drosophila melanogaster. Funct. Ecol. 8, 730737.
Krebs, R. A. and Loeschcke, V. (1995a). Resistance to thermal stress in adult Drosophila buzzatii: acclimation and variation among populations. Biol. J. Linn. Soc. 56, 505515.
Krebs, R. A. and Loeschcke, V. (1995b). Resistance to thermal stress in preadult Drosophila buzzatii: variation among populations and changes in relative resistance across life stages. Biol. J. Linn. Soc. 56, 517531.
Lansing, I., Justesen, J. and Loeschcke, V. (2000). Variation in the expression of HSP70, the major heat-shock protein and thermotolerance in larval and adult selection lines of Drosophila melanogaster. J. Therm. Biol. 25, 443450.[Medline]
Lee, H., Kraus, K. W., Wolfner, M. F. and Lis, J. T. (1992). DNA sequence requirements for generating paused polymerase at the start of hsp70. Genes Devl. 6, 284295.
Lerman, D. N. and Feder, M. E. (2001). Laboratory selection at different temperatures modifies heat shock transcription factor (HSF) activation in Drosophila melanogaster. J. Exp. Biol. 204, 315323.[Abstract]
Li, B., Weber, J. A., Chen, Y., Greenleaf, A. L. and Gilmour, D. S. (1996). Analyses of promoter-proximal pausing by RNA polymerase II on the hsp70 heat shock gene promoter in a Drosophila nuclear extract. Mol. Cell. Biol. 16, 54335443.[Abstract]
Lindquist, S. (1980). Varying patterns of protein synthesis in Drosophila during heat shock: implications for regulation. Devl. Biol. 77, 463479.[Medline]
Lindquist, S. (1993). Autoregulation of the heat-shock response. In Translational Regulation of Gene Expression 2, vol. 2 (ed. J. Ilan), pp. 279320. New York: Plenum Press.
Lis, J. T. and Wu, C. (1994). Transcriptional regulation of heat shock genes. In Transcription: Mechanisms and Regulation (ed. R. C. Conaway and J. W. Conaway), pp. 459475. New York: Raven Press, Ltd.
Lyashko, V. N., Vikulova, V. K., Chernikov, V. G., Ivanov, V. I., Ulmasov, K. A., Zatsepina, O. G. and Evgenev, M. B. (1994). Comparison of the heat shock response in ethnically and ecologically different human populations. Proc. Natl. Acad. Sci. USA 91, 1249212495.
Mason, P. B. and Lis, J. T. (1997). Cooperative and competitive protein interactions at the Hsp70 promoter. J. Biol. Chem. 272, 3322733233.
Mason, P. I., Torok, I., Kiss, I., Karch, F. and Udvardy, A. (1982). Evolutionary implications of a complex pattern of DNA sequence homology extending far upstream of the hsp70 genes at loci 87A7 and 87C1 in Drosophila melanogaster. J. Mol. Biol. 156, 2135.[Medline]
McColl, G., Hoffmann, A. A. and McKechnie, S. W. (1996). Response of two heat shock genes to selection for knockdown heat resistance in Drosophila melanogaster. Genetics 143, 16151627.[Abstract]
McGarry, T. J. and Lindquist, S. (1985). The preferential translation of Drosophila hsp70 mRNA requires sequences in the untranslated leader. Cell 42, 903911.[Medline]
McKechnie, S. W., Halford, M. M., McColl, G. and Hoffmann, A. A. (1998). Both allelic variation and expression of nuclear and cytoplasmic transcripts of Hsr-omega are closely associated with thermal phenotype in Drosophila. Proc. Natl. Acad. Sci. USA 95, 24232428.
Michaud, S., Marin, R. and Tanguay, R. M. (1997). Regulation of heat shock gene induction and expression during Drosophila development. Cell. Mol. Life Sci. 53, 104113.[Medline]
Mizrokhi, L. J., Obolenkova, L. A., Priimagi, A. F., Ilyin, Y. V., Gerasimova, T. I. and Georgiev, G. P. (1985). The nature of unstable insertion mutations and reversions in the locus Cut of Drosophila melanogaster molecular mechanism of transposition memory. EMBO J. 4, 37813787.[Medline]
Molto, M. D., Martinez-Sebastian, M. J. and de Frutos, R. (1994). Phylogenetic relationships between Drosophila subobscura, D. guanche and D. madeirensis based on Southern analysis of heat shock genes. Hereditas 120, 217223.[Medline]
Morimoto, R. I., Jurivich, D. A., Kroeger, P. E., Mathur, S. K., Murphy, S. P., Nakai, A., Sarge, K., Abravaya, K. and Sistonen, L. T. (1994). Regulation of heat shock gene transcription by a family of heat shock factors. In The Biology of Heat Shock Proteins and Molecular Chaperones (ed. R. I. Morimoto, A. Tissieres and C. Georgopoulos), pp. 417456. New York: Cold Spring Harbor Laboratory Press.
Mosser, D. D., Duchaine, J. and Massie, B. (1993). Saccharomyces cerevisiae HSP70 heat shock elements are functionally distinct. Mol. Cell. Biol. 13, 56375646.
Newnam, G. P., Wegrzyn, R. D., Lindquist, S. L. and Chernoff, Y. O. (1999). Antagonistic interactions between yeast chaperones Hsp104 and Hsp70 in prion curing. Mol. Cell. Biol. 19, 13251333.
OFarrell, P. Z., Goodman, H. M. and OFarrell, P. H. (1977). High resolution two-dimensional electrophoresis of basic as well as acidic proteins. Cell 12, 11331142.[Medline]
Omichinski, J. G., Pedone, P. V., Felsenfeld, G., Gronenborn, A. M. and Clore, G. M. (1997). The solution structure of a specific GAGA factorDNA complex reveals a modular binding mode. Nature Struct. Biol. 4, 122132.[Medline]
Palter, K. B., Watanabe, M., Stinson, L., Mahowald, A. P. and Craig, E. A. (1986). Expression and localization of Drosophila melanogaster Hsp70 cognate proteins. Mol. Cell. Biol. 6, 11871203.
Parsons, P. A. (1973). Genetics of resistance to environmental stresses in Drosophila populations. Annu. Rev. Genet. 7, 239265.[Medline]
Parsons, P. A. (1979). Resistance of the sibling species Drosophila melanogaster and Drosophila simulans to high temperatures in relation to humidity: evolutionary implications. Evolution 33, 131136.
Petersen, R. B. and Lindquist, S. (1989). Regulation of HSP70 synthesis by messenger RNA degradation. Cell Regul. 1, 135149.[Medline]
Priimagi, A. F., Mizrokhi, L. J. and Ilyin, Y. V. (1988). The Drosophila mobile element Jockey belongs to LINEs and contains coding sequences homologous to some retroviral proteins. Gene 70, 253262.[Medline]
Ritossa, F. (1996). Discovery of the heat shock response. Cell Stress & Chaperones 1, 9798.[Medline]
Roberts, S. P. and Feder, M. E. (1999). Natural hyperthermia and expression of the heat-shock protein Hsp70 affect developmental abnormalities in Drosophila melanogaster. Oecologia 14, 353357.
Roberts, S. P. and Feder, M. E. (2000). Changing fitness consequences of hsp70 copy number in transgenic Drosophila larvae undergoing natural thermal stress. Funct. Ecol. 14, 353357.
Rubin, D. M., Mehta, A. D., Zhu, J., Shoham, S., Chen, X., Wells, Q. R. and Palter, K. B. (1993). Genomic structure and sequence analysis of Drosophila melanogaster HSC70 genes. Gene 128, 155163.[Medline]
Sambrook, J. and Fritsch, E. F. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sinibaldi, R. M. and Storti, R. V. (1982). One- and two-dimensional polyacrylamide gel analysis of the heat shock proteins of the virilis group of Drosophila. Biochem. Genet. 20, 791807.[Medline]
Snyder, M. P., Kimbrell, D., Hunkapiller, M., Hill, R., Fristrom, J. and Davidson, N. (1982). A transposable element that splits the promoter region inactivates a Drosophila cuticle protein gene. Proc. Natl. Acad. Sci. USA 79, 74307434.
Solomon, J. M., Rossi, J. M., Golic, K., McGarry, T. and Lindquist, S. (1991). Changes in Hsp70 alter thermotolerance and heat-shock regulation in Drosophila. New Biol. 3, 11061120.[Medline]
Sorensen, J. G., Dahlgaard, J. and Loeschcke, V. (2001). Genetic variation in thermal tolerance among natural populations of Drosophila buzzatii: Down regulation of Hsp70 expression and variation in heat stress resistance traits. Funct. Ecol. (in press).
Sorensen, J. G., Michalak, P., Justesen, J. and Loeschcke, V. (1999). Expression of the heat-shock protein HSP70 in Drosophila buzzatii lines selected for thermal resistance. Hereditas 131, 155164.[Medline]
Stratman, R. and Markow, T. A. (1998). Resistance to thermal stress in desert Drosophila. Funct. Ecol. 12, 965970.
Tikhomirova, M. M. (1980). Modifying effect of extremal temperature depending on the organism adaptation to this factor on the action of radiation. II. Analysis of the potential damages using heat-resistance. Genetika 16, 290298.[Medline]
Tikhomirova, M. M. and Belyatskaya, O. Y. (1980). Modifying effect of extremal temperature depending on the organism adaptation to this factor on the action of radiation. I. Characteristics of Drosophila stock adapted to high temperature. Genetika 16, 115122.
Tikhomirova, M. M. and Belyatskaya, O. Y. (1993). Formation of heat resistance of germ cells in oogenesis of Drosophila and relation of this character to the mutation process. Genetika 29, 444448.[Medline]
Tikhomirova, M. M., Mazur, E. L., Barabanova, L. B. and Mamon, L. A. (1993). Heat modification of the mutational process and heat shock proteins. Genetika 29, 280287.[Medline]
Topol, J., Ruden, D. M. and Parker, C. S. (1985). Sequences required for in vitro transcriptional activation of a Drosophila hsp70 gene. Cell 42, 527537.[Medline]
Tuteja, R. and Tuteja, N. (2000). Ku autoantigen: A multifunctional DNA-binding protein. Crit. Rev. Biochem. Mol. Biol. 35, 133.[Medline]
Ulmasov, H. A., Karaev, K. K., Lyashko, V. N. and Evgenev, M. B. (1993). Heat-shock response in camel (Camelus dromedarius) blood cells and adaptation to hyperthermia. Comp. Biochem. Physiol. 106B, 867872.
Ulmasov, K. A., Ovezmukhammedov, A., Karaev, K. K. and Evgenev, M. B. (1988). Molecular mechanisms of adaptation to hyperthermia in higher organisms. III. Induction of heat-shock proteins in two Leishmania species. Mol. Biol. 22, 15831589.
Ulmasov, K. A., Shammakov, S., Karaev, K. and Evgenev, M. B. (1992). Heat shock proteins and thermoresistance in lizards. Proc. Natl. Acad. Sci. USA 89, 16661670.
Velazquez, J. M., DiDomenico, B. J. and Lindquist, S. (1980). Intracellular localization of heat shock proteins in Drosophila. Cell 20, 679689.[Medline]
Velazquez, J. M., Sonoda, S., Bugaisky, G. and Lindquist, S. (1983). Is the major Drosophila heat shock protein present in cells that have not been heat shocked? J. Cell Biol. 96, 286290.
Welte, M. A., Tetrault, J. M., Dellavalle, R. P. and Lindquist, S. L. (1993). A new method for manipulating transgenes: engineering heat tolerance in a complex, multicellular organism. Curr. Biol. 3, 842853.[Medline]
White, L. D. and Jacobson, J. W. (1996a). Insertion of the retroposable element, jockey, near the Adh gene of Drosophila melanogaster is associated with altered gene expression. Genet. Res. 68, 203209.[Medline]
White, L. D. and Jacobson, J. W. (1996b). Molecular analysis of a spontaneous insertion mutation near the alcohol dehydrogenase gene of Drosophila melanogaster. Insect Biochem. Mol. Biol. 26, 593598.[Medline]
Wilkins, R. C. and Lis, J. T. (1997). Dynamics of potentiation and activation: GAGA factor and its role in heat shock gene regulation. Nucleic Acids Res. 25, 39633968.
Wu, C. (1980). The 5' ends of Drosophila heat shock genes in chromatin are hypersensitive to DNase I. Nature 286, 854860.[Medline]
Wu, C., Tsai, C. and Wilson, S. (1988). Affinity chromatography of sequence-specific DNA-binding proteins. In Genetic Engineering, vol. 10 (ed. J. K. Setlow), pp. 6774. New York: Plenum Publishing Corporation.
Xie, Y., Cahill, C. M., Asea, A., Auron, P. E. and Calderwood, S. K. (1999). Heat shock proteins and regulation of cytokine expression. Infect. Dis. Obstet. Gynecol. 7, 2630.[Medline]
Yost, H. J., Petersen, R. B. and Lindquist, S. (1990). Posttranscriptional regulation of the heat shock protein synthesis in Drosophila. In Stress Proteins in Biology and Medicine (ed. R. J. Morimoto, A. Tissieres and C. Georgopoulos), pp. 379409. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Zapata, J. M., Maroto, F. G. and Sierra, J. M. (1991). Inactivation of mRNA cap-binding protein complex in Drosophila melanogaster embryos under heat shock. J. Biol. Chem. 266, 1600716014.
Zatsepina, O. G., Ulmasov, K. A., Beresten, S. F., Molodtsov, V. B., Rybtsov, S. A. and Evgenev, M. B. (2000). Thermotolerant desert lizards characteristically differ in terms of heat-shock system regulation. J. Exp. Biol. 203, 10171025.[Abstract]
Zelentsova, E. S., Vashakidze, R. P., Krayev, A. S. and Evgenev, M. B. (1986). Dispersed repeats in Drosophila virilis elements mobilized by interspecific hybridization. Chromosoma 93, 469476.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
D. G. Folk, L. A. Hoekstra, and G. W. Gilchrist Critical thermal maxima in knockdown-selected Drosophila: are thermal endpoints correlated? J. Exp. Biol., August 1, 2007; 210(15): 2649 - 2656. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Folk, P. Zwollo, D. M. Rand, and G. W. Gilchrist Selection on knockdown performance in Drosophila melanogaster impacts thermotolerance and heat-shock response differently in females and males J. Exp. Biol., October 15, 2006; 209(20): 3964 - 3973. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Fangue, M. Hofmeister, and P. M. Schulte Intraspecific variation in thermal tolerance and heat shock protein gene expression in common killifish, Fundulus heteroclitus J. Exp. Biol., August 1, 2006; 209(15): 2859 - 2872. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Y. Shilova, D. G. Garbuz, E. N. Myasyankina, B. Chen, M. B. Evgen'ev, M. E. Feder, and O. G. Zatsepina Remarkable Site Specificity of Local Transposition Into the Hsp70 Promoter of Drosophila melanogaster Genetics, June 1, 2006; 173(2): 809 - 820. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Tomanek Two-dimensional gel analysis of the heat-shock response in marine snails (genus Tegula): interspecific variation in protein expression and acclimation ability J. Exp. Biol., August 15, 2005; 208(16): 3133 - 3143. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. N. Lerman and M. E. Feder Naturally Occurring Transposable Elements Disrupt hsp70 Promoter Function in Drosophila melanogaster Mol. Biol. Evol., March 1, 2005; 22(3): 776 - 783. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rohmer, J. R. David, B. Moreteau, and D. Joly Heat induced male sterility in Drosophila melanogaster: adaptive genetic variations among geographic populations and role of the Y chromosome J. Exp. Biol., July 15, 2004; 207(16): 2735 - 2743. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Garbuz, M. B. Evgenev, M. E. Feder, and O. G. Zatsepina Evolution of thermotolerance and the heat-shock response: evidence from inter/intraspecific comparison and interspecific hybridization in the virilis species group of Drosophila. I. Thermal phenotype J. Exp. Biol., July 15, 2003; 206(14): 2399 - 2408. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Riehle, A. F. Bennett, R. E. Lenski, and A. D. Long Evolutionary changes in heat-inducible gene expression in lines of Escherichia coli adapted to high temperature Physiol Genomics, June 24, 2003; 14(1): 47 - 58. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. N. Lerman, P. Michalak, A. B. Helin, B. R. Bettencourt, and M. E. Feder Modification of Heat-Shock Gene Expression in Drosophila melanogaster Populations via Transposable Elements Mol. Biol. Evol., January 1, 2003; 20(1): 135 - 144. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Buckley, M.-E. Owen, and G. E. Hofmann Adjusting the thermostat: the threshold induction temperature for the heat-shock response in intertidal mussels (genus Mytilus) changes as a function of thermal history J. Exp. Biol., March 12, 2002; 204(20): 3571 - 3579. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||